CN1877328A - Method for detecting aquatic animal pathogenic bacteria by using 23S ribosome gene probe array - Google Patents
Method for detecting aquatic animal pathogenic bacteria by using 23S ribosome gene probe array Download PDFInfo
- Publication number
- CN1877328A CN1877328A CN 200610014764 CN200610014764A CN1877328A CN 1877328 A CN1877328 A CN 1877328A CN 200610014764 CN200610014764 CN 200610014764 CN 200610014764 A CN200610014764 A CN 200610014764A CN 1877328 A CN1877328 A CN 1877328A
- Authority
- CN
- China
- Prior art keywords
- probe
- sequence
- vibrio
- hybridization
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a bacteria detecting technology which comprises designing special probes with biological information, including designing 34 pieces oligonucleotide as filtered probes and the corresponding PCR and hybridizing reacting conditions; enlarging via PCR and marking bacteria 23srRNA gene internal sub array with Digoxin, and hybridizing the PCR products and a group of special oligonucleotide probes; after enzyme-linked immunoassay color-rendering, identifying whether has aquatic infectious pathogeny bacteria from the sample.
Description
Technical field
The present invention relates to a kind of bacteriologic test technology, be utilization making nucleic acid molecular hybridization reaction detection malignant bacteria specifically, particularly aquatic animal pathogenic bacteria (comprises aeromonas salmonicida, Aeromonas hydrophila, Aeromonas caviae, C.perfringens, clostridium botulinum Channel-catfish fish tarda, kill the fish enterococcus, streptococcus, have a liking for the cold bacillus of subduing, Flexibacter columnaris, multocida, kill the fish pasteurella, pseudomonas putida, Pseudomonas fluorescens, cloves group pseudomonad, comma bacillus, vibrio mimicus, breathe out the arc maintenance bacterium, Vibrio vulnificus, vibrio parahaemolytious, vibrio fluvialis, the Fu Shi vibrios, 23 kinds of bacteriums such as vibrio alginolyticus) technology.
Background technology
At present, aquatic animal pathogenic microorganism detection method relies on biochemical identification and culture identification basically.These evaluations are wasted time and energy, and are again results and unreliable in the evaluation of kind of level.Along with the development of molecular biology identification method, be corrected gradually based on the division bacteria of these methods.This situation has illustrated the necessity of setting up the molecular biology identification method from the side.Correlative study is extensively carried out in the world, and domestic this respect research is also being risen gradually.
In aquatic animal pathogenic microorganism context of detection, domestic what adopt basically is biochemical method, rarely has the bibliographical information of chip or microarray applications, though the research report of aquatic animal pathogenic microorganisms checking chip is arranged in the world, the scope of its detection is not comprehensive.From technological layer, the maximum DNA target spots of the utilization of bacteria molecule detection at present are 16S rRNA genes.But in many cases, the difference between the close kind on 16S rRNA gene order very limited (the bacterial 16 S rRNA gene order difference that belongs to together is basically less than 4% similarity), and sometimes these difference sites distribute more even.Differentiate that the probe difficulty is bigger so design close kind, and identification result is often undesirable with the difference site on the 16S rRNA gene.23S rRNA Variable Area is many, and molecular weight is bigger, and compare variant sites with 16S rRNA gene abundant and concentrate, but have conservative property on the level of kind.Adding general bacterium all has the rRNA operon of a plurality of copies, makes that to utilize 23S design species specificity probe very convenient, and has improved the specificity of probe greatly.
Dna microarray has wide practical use in aquatic animal eqpidemic disease context of detection, can improve efficiency of test greatly, saves manpower, the time.Really can accomplish once to check the comprehensive information of the infection state of the pathogenic microorganism that provides PI, and the result is accurate, easy and simple to handle fast.
Summary of the invention
The standard method of pathogen does not still detect in China at aquatic animal eqpidemic disease context of detection utilization oligonucleotide microarray at present, has still continued to use enrichment, PCR method, fluorescence PCR method detection aquatic animal eqpidemic disease pathogen.Increase the classical method of inspection such as bacterium, separation and Culture, biochemical identification before enrichment need pass through and detect object bacteria.Test period is long, and it is little to handle sample size, and sensitivity and specificity are all relatively low.And that PCR method, fluorescence PCR method detect flux is low, once can only realize the check of a kind of pathogen.
At above-mentioned situation, the present invention has overcome shortcoming of the prior art, provide a kind of method of using oligonucleotide microarray to detect pathogen technology for detection aquatic animal eqpidemic disease pathogen (to comprise: aeromonas salmonicida, Aeromonas hydrophila, Aeromonas caviae, C.perfringens, clostridium botulinum Channel-catfish fish tarda, kill the fish enterococcus, streptococcus, have a liking for the cold bacillus of subduing, Flexibacter columnaris, multocida, kill the fish pasteurella, pseudomonas putida, Pseudomonas fluorescens, cloves group pseudomonad, comma bacillus, vibrio mimicus, breathe out the arc maintenance bacterium, Vibrio vulnificus, vibrio parahaemolytious, vibrio fluvialis, the Fu Shi vibrios, 23 kinds of bacteriums such as vibrio alginolyticus) in order to solve the problems of the technologies described above, the present invention is achieved by the following technical solutions: at first as follows with bioinformatics method design specific probe sequence:
Sequence one: (Aeromonas general probe AFp1) CTCAGTAGCGGCGAGCGAACG
Sequence two: (aeromonas salmonicida probe Asal1) TATCGTTACATGAATACATAGTGTAACGAG
Sequence three: (Aeromonas hydrophila probe Ahyr1) TAAGTGAATACATAGCTTAACGAGGCGA
Sequence four: (Aeromonas caviae probe Acav1) TTACTGAATACATAGGTAATAGAGGCGA
Sequence five: (fusobacterium general probe CloFp) CCAGAGTACCACGAGACACGTGAAA
Sequence six: (C.perfringens probe Cper1) AAGTGGAGGCTATTGTAACTGAAGAGAA
Sequence seven: (clostridium botulinum probe Cbot1) GAGAAATTATGGTTAACCGAACACAAC
Sequence eight: ACGAAGGTGCACAGCTGTGAGTT (Channel-catfish fish tarda probe Eict1)
Sequence nine: (killing fish enterococcus probe Eserp1) ACTATGTTATGCATAGTATCCGTAAGTGAA
Sequence ten: (streptococcus general probe Strp1) TATAGAAGAATTACCTGGGAAGGTAAGC
Sequence 11: (having a liking for the cold bacillus probe FleFp that subdues) TAGCCCAAACCDAWGTTGTTACGG
Sequence 12: (Flexibacter columnaris probe 1Fclup1) ACTTTCCAGTAAATTCTAATTCTATCCGC
Sequence 13: (Flexibacter columnaris probe 2Fclup2) ATAAGTAATAGAAGATAACGATAGTGGTATCC
Sequence 14: (multocida probe 1Pmulp1)
AGTAAGTTTTAGCTAGCATATTAGAGGAATTG
Sequence 15: (multocida probe 2Pmulp2) GTACTCGAAAGTATGTTAGTGGAACTAAGC
Sequence 16: (killing fish pasteurella probe Ppisp) CTTAAGCTAATCTTGCGTTAGGTGAAC
Sequence 17: (pseudomonas putida probe 1Pputp1) GACCAGCCCTTAAGTTGATTTGAGAT
Sequence 18: (pseudomonas putida probe 2Pputp2) CCGTACACGAAAATCTCTTGTCAATG
Sequence 19: (Pseudomonas fluorescens probe 1Pflup1) GACTAGCCCTTAAGTGGCTTTGAGAT
Sequence 20: (Pseudomonas fluorescens probe 2Pflup2) CCTGTACGCGAAAATCTCTTAGTCATG
Sequence 21: (cloves group pseudomonad probe Psyrp2) ACGCGAAAATCCCTTTGCAATGAA
Sequence 22: (comma bacillus and vibrio mimicus probe 1Vchmip11)
ACTCGGTGAAGTAGGTGAACAAGCTGG
Sequence 23: (comma bacillus and vibrio mimicus probe 2Vchmip12)
GAAGTAGGTGAACAAGCTGGAAAGCT
Sequence 24: (comma bacillus and vibrio mimicus probe 3Vcmap13) GCTGGAAAGCTTGGCGATACAG
Sequence 25: (breathing out arc maintenance bacterium probe 1Vharp11) CTTTTTATGCGTCAGGTGAAACTTCTG
Sequence 26: (breathing out arc maintenance bacterium probe 2Vharp12) GTGAAACTTCTGGAAAGTTGTGCGATA
Sequence 27: (breathing out arc maintenance bacterium probe 3Vharp21) TAACCGGCAACGCATATAAAGTGAA
Sequence 28: (Vibrio vulnificus probe 1Vvulp11) AAGCTTTACATGTGTTAGACGAACGG
Sequence 29: (Vibrio vulnificus probe 2Vvulp21) TTGTAGATGCATGTTCAGTGAAATCG
Sequence 30: (vibrio parahaemolytious probe V.parp21) TTGACGACGTGTGTTCAGTGAAATC
Sequence 31: (vibrio fluvialis and Fu Shi vibrios probe 1Vflfup11) TTTACATGCGTCAGGTGAAGGTTCT
Sequence 32: (vibrio fluvialis and Fu Shi vibrios probe 2Vflfup12) TCTGGAAAGGACCGCGAAACAG
Sequence 33: (vibrio alginolyticus probe Vflfup21) AGCCGACAGCGCATGTTCAGTG
Sequence 34: (vibrio alginolyticus probe Valgp21) AACTGACGACGCATATTCAGTGAAAT
Wherein D represents any one among base A or G or the T; W represents any one among base A or the T.Whole intragenic part dna segment of 23S rRNA of microorganisms in the pcr amplification testing sample then, simultaneously employed PCR primer tasteless nucleotide sequence is as follows during the mark of Gaoxin:
Primer P23forward before the primer sequence 1:(23S rRNA gene fragment amplification)
GCGATTTCYG?AAYGGGGRAACCC
Primer P23reverse behind the primer sequence 2:(23S rRNA gene fragment amplification)
TTCGCCTTTCCCTCACGGTA?CT
Wherein Y represents any one among base C or the T; R represents any one among base A or the G.The method that the utilization oligonucleotide microarray detects multiple aquatic animal pathogenic bacteria may further comprise the steps:
1. the design specific oligonucleotide probe is used for molecular hyridization-enzyme linked immunological color developing detection;
2.PCR the part dna segment of the 23S rRNA gene of whole prokaryotic micro-organisms, simultaneously Gaoxin mark in the amplification testing sample;
3. the specific oligonucleotide gene probe point with design is having on the nylon membrane of positive charge (Amersham company, the U.S.), forms the probe microarray, and the some system of microarray is pressed order and the position among Fig. 1, carries out under long-wave ultra violet lamp crosslinked 5-10 minute; The pairing probe of point in institute's drawings attached of present patent application all with the same shown in Fig. 1 is:
1 positive control
2 negative controls
3 Aeromonas general probe AFp1CTCAGTAGCGGCGAGCGAACG
4 aeromonas salmonicida probe Asal1TATCGTTACATGAATACATAGTGTAACGAG
5 Aeromonas hydrophila probe Ahyr1TAAGTGAATACATAGCTTAACGAGGCGA
6 Aeromonas caviae probe Acav1TTACTGAATACATAGGTAATAGAGGCGA
7 fusobacterium general probe CloFp CCAGAGTACCACGAGACACGTGAAA
8 C.perfringens probe Cper1AAGTGGAGGCTATTGTAACTGAAGAGAA
9 clostridium botulinum probe Cbot1GAGAAATTATGGTTAACCGAACACAAC
10 Channel-catfish fish tarda probe Eict1ACGAAGGTGCACAGCTGTGAGTT
11 kill fish enterococcus probe Eserp1ACTATGTTATGCATAGTATCCGTAAGTGAA
12 streptococcus general probe IIEser﹠amp; Strp1TATAGAAGAATTACCTGGGAAGGTAAGC
13 have a liking for the cold bacillus probe FleFpTAGCCCAAACCDAWGTTGTTACGG that subdues
14 Flexibacter columnaris probe 1Fclup1ACTTTCCAGTAAATTCTAATTCTATCCGC
15 Flexibacter columnaris probe 2Fclup2ATAAGTAATAGAAGATAACGATAGTGGTATCC
16 multocida probe 1Pmulp1AGTAAGTTTTAGCTAGCATATTAGAGGAATTG
17 multocida probe 2Pmulp2GTACTCGAAAGTATGTTAGTGGAACTAAGC
18 kill fish pasteurella probe PpispCTTAAGCTAATCTTGCGTTAGGTGAAC
19 pseudomonas putida probe 1Pputp1GACCAGCCCTTAAGTTGATTTGAGAT
20 pseudomonas putida probe 2Pputp2CCGTACACGAAAATCTCTTGTCAATG
21 Pseudomonas fluorescens probe 1Pflup1GACTAGCCCTTAAGTGGCTTTGAGAT
22 Pseudomonas fluorescens probe 2Pflup2CCTGTACGCGAAAATCTCTTAGTCATG
23 cloves group pseudomonad probe Psyrp2ACGCGAAAATCCCTTTGCAATGAA
24 comma bacillus and vibrio mimicus probe 1Vchmip11ACTCGGTGAAGTAGGTGAACAAGCTGG
25 comma bacillus and vibrio mimicus probe 2Vchmip12GAAGTAGGTGAACAAGCTGGAAAGCT
26 comma bacillus and vibrio mimicus probe 3Vcmap13GCTGGAAAGCTTGGCGATACAG
27 breathe out arc maintenance bacterium probe 1Vharp11CTTTTTATGCGTCAGGTGAAACTTCTG
28 breathe out arc maintenance bacterium probe 2Vharp12GTGAAACTTCTGGAAAGTTGTGCGATA
29 breathe out arc maintenance bacterium probe 3Vharp21TAACCGGCAACGCATATAAAGTGAA
30 Vibrio vulnificus probe 1Vvulp11AAGCTTTACATGTGTTAGACGAACGG
31 Vibrio vulnificus probe 2Vvulp21TTGTAGATGCATGTTCAGTGAAATCG
32 vibrio parahaemolytious probe Vparp21TTGACGACGTGTGTTCAGTGAAATC
33 river Fu Shi vibrios probe 1Vflfup11TTTACATGCGTCAGGTGAAGGTTCT
34 river Fu Shi vibrios probe 2Vflfup12TCTGGAAAGGACCGCGAAACAG
35 vibrio alginolyticus probe Vflfup21AGCCGACAGCGCATGTTCAGTG
36 vibrio alginolyticus probe Valgp21AACTGACGACGCATATTCAGTGAAAT
4. the colour developing of the enzyme linked immunological of hybridization and hybridization spot is carried out according to Roche company digoxin dna marker and detection kit explanation.
Each component composition is as follows in the PCR reaction system:
Constituent concentration application of sample amount
10 times of 5 μ L of PCR damping fluid
MgCl
2 20mmol/L 5μL
Taq archaeal dna polymerase 5u/ μ L 0.3 μ L
Primer 1 10mol/L 2 μ L
Sequence 36 (primer) 10 μ mol/L 2 μ L
Every kind of 10mmol/L of dNTPs 0.3 μ L
DIG-dNTPs DIG-dUTP 1mmol/L 0.3μL
DNA sample 2 μ L
Distilled water 33.1 μ L
Cumulative volume 50 μ L
Amplification program is in the PCR method
1)95℃ 10min
2)95℃ 30s
3)55℃ 20s
4)72℃ 30s
5) get back to the 2nd)-4) in the step, repeat 5 times
6)95℃ 30s
7)68℃ 30s
8) get back to the 6th)-7) in the step, repeat 25 times
9)72℃ 2min
With concentration is that the oligonucleotide probe solution 0.1 μ L point of 1mmol/L is having on the nylon membrane of positive charge, carries out under long-wave ultra violet lamp crosslinked 5-10 minute.
Its digoxigenin labeled PCR product and oligonucleotide probe hybridization method are as follows:
* prehybridization
Prehybridization solution is preheating to hybridization temperature (50 ℃) earlier, and the nylon membrane of clicking and entering oligonucleotide probe is put into polybag, adds prehybridization solution, seals mouth.Prehybridization 30min, 50 ℃.
* PCR product thermal denaturation increases
The PCR product of DIG mark is heated to 95 ℃, and 10min inserts ice bath rapidly.
* digoxigenin labeled target DNA molecule and nylon membrane hybridization
The good chip of the prehybridization polybag of packing into, add the PCR product 10uL of the DIG mark of sex change, add the 1mL hybridization solution again, seal mouth.50 ℃, hybridization 1hr, the gentle stirring.
Compared with prior art, the invention has the beneficial effects as follows: this method have detect accurately, the characteristics of high specificity, can identify special target bacteria fast and accurately.At first, avoided cultivating repeatedly, saved time; And the hybridization authentication method of DNA-DNA is more accurate than the authentication method of Physiology and biochemistry, is not subjected to the influence of condition of culture and bacterium physiological status, and this will fill up the authentication method that uses dna molecule hybridize and carry out the blank that aquatic animal eqpidemic disease pathogen detects.
Description of drawings
Fig. 1: the probe location synoptic diagram of microarray.
The microarray assay of Fig. 2: embodiment 1 certain batch of live fish detects the result of aeromonas salmonicida.
The microarray assay of Fig. 3: embodiment 2 certain batch of live fishes detects the result of Aeromonas hydrophila.
The microarray assay of Fig. 4: embodiment 3 certain batch of live fishes detects the result of Aeromonas caviae.
The microarray assay of Fig. 5: embodiment 4 certain batch of live fishes detects the result of C.perfringens.
The microarray assay of Fig. 6: embodiment 5 certain batch of live fishes detects the result of clostridium botulinum.
The result of the microarray assay Jian Chu Channel-catfish fish tarda of Fig. 7: embodiment 6 certain batch of live fishes.
The microarray assay of Fig. 8: embodiment 7 certain batch of live fishes detects the enterococcal result of fish extremely.
The microarray assay of Fig. 9: embodiment 8 certain batch of live fishes detects the streptococcic result of beta hemolysis type.
The microarray assay of Figure 10: embodiment 9 certain batch of live fishes detects has a liking for the cold result who subdues bacillus.
The microarray assay of Figure 11: embodiment 10 certain batch of live fishes detects the result of Flexibacter columnaris.
The microarray assay of Figure 12: embodiment 11 certain batch of live fishes detects the result of multocida.
The microarray assay of Figure 13: embodiment 12 certain batch of live fishes detects the result of fish pasteurella extremely.
The microarray assay of Figure 14: embodiment 13 certain batch of live fishes detects the result of pseudomonas putida.
The microarray assay of Figure 15: embodiment 14 certain batch of live fishes detects the result of Pseudomonas fluorescens.
The microarray assay of Figure 16: embodiment 15 certain batch of live fishes detects the result of comma bacillus.
The microarray assay of Figure 17: embodiment 16 certain batch of live fishes detects the result of vibrio mimicus.
The microarray assay of Figure 18: embodiment 17 certain batch of live fishes detects the result who breathes out the arc maintenance bacterium.
The microarray assay of Figure 19: embodiment 18 certain batch of live fishes detects the result of Vibrio vulnificus.
The microarray assay of Figure 20: embodiment 19 certain batch of live fishes detects the result of vibrio parahaemolytious.
The microarray assay of Figure 21: embodiment 20 certain batch of live fishes detects the result of vibrio fluvialis.
The microarray assay of Figure 22: embodiment 21 certain batch of live fishes detects the result of Fu Shi vibrios.
The microarray assay of Figure 23: embodiment 22 certain batch of live fishes detects the result of vibrio alginolyticus.
Embodiment
Embodiment 1
Sample: certain batch of outlet live fish.Conventional microbe culture and biochemistry detection go out the doubtful bacterium colony of aeromonas salmonicida.
1.DNA extracting
Sample thief flap lower epidermis, nephridial tissue, hepatic tissue, each gram of heart, mix vibration after the homogenate, getting homogenate 1mL left standstill in ice bath 5 minutes, at room temperature 12000 rev/mins then, centrifugal 5 minutes, abandoning supernatant, add 100 μ L lysozyme solns, 37 ℃ are incubated 10 minutes, add TE damping fluid 500 μ l, the vibration mixing.Add with the saturated phenol pH of volume Tris value 8.0, strong vibration, 12000 rev/mins, centrifugal 3 minutes, draw supernatant, repeat the phenol extracting.Draw supernatant, add the sodium acetate (2mol/L) of 0.1 times of volume, mixing adds isopyknic ice ethanol again, and stand at low temperature is 30 minutes behind the mixing, and is centrifugal 5 minutes in 12000 rev/mins.Supernatant discarded adds 70% ice ethanol vibration washing once, and following 12000 rev/mins of room temperature centrifugal 5 minutes, is abandoned supernatant.Add 50 μ LTE solution, put-20 ℃ of preservations.
2.PCR amplification 23S genetic fragment
Constituent concentration application of sample amount
10 times of 5 μ L of PCR damping fluid
MgCl
2 20mmol/L 5μL
Taq archaeal dna polymerase 5u/ μ L 0.3 μ L
Primer 1 10 μ mol/L 2 μ L
Primer 2 10 μ mol/L 2 μ L
Every kind of 10mmol/L of dNTPs 0.3 μ L
DIG-dNTPs DIG-dUTP 1mmol/L 0.3μL
DNA sample 2 μ L
Distilled water 3 3.1 μ L
Cumulative volume 50 μ L
Amplification program is in the PCR method
1)95℃ 10min
2)95℃ 30s
3)55℃ 20s
4)72℃ 30s
5) get back to the 2nd)-4) in the step, repeat 5 times
6)95℃ 30s
7)68℃ 30s
8) get back to the 6th)-7) in the step, repeat 25 times
9)72℃ 2min
3. the hybridization of probe on target gene amplified production and the nylon membrane
* prehybridization
Prehybridization solution is preheating to hybridization temperature (50 ℃) earlier, and the nylon membrane of clicking and entering oligonucleotide probe is put into polybag, adds prehybridization solution, seals mouth.Prehybridization 30min, 50 ℃.
* PCR product thermal denaturation increases
The PCR product of DIG mark is heated to 95 ℃, and 10min inserts ice bath rapidly.
* digoxigenin labeled target DNA molecule and nylon membrane hybridization
The good chip of the prehybridization polybag of packing into, add the PCR product 10uL of the DIG mark of sex change, add the 1mL hybridization solution again, seal mouth.50 ℃, hybridization 1hr, the gentle stirring.
4. the enzyme linked immunological colour developing of hybridization positive spots
The enzyme linked immunological colour developing of hybridization spot is carried out according to Roche company digoxin dna marker and detection kit explanation.
*Interpretation as a result
The all dark blue color dot of (the 3 Aeromonas general probe 3AFp1) probe site four (aeromonas salmonicida probe 4) of probe site three on the interpretation results of hybridization nylon membrane is positive results of hybridization, shows and contains aeromonas salmonicida in the sample, sees Fig. 2.
After 2 days, conventional microbe culture contains aeromonas salmonicida in the use bio-chemical detector is reached a conclusion sample.The positive findings of this explanation aeromonas salmonicida oligonucleotide probe is effective.
Embodiment 2
Sample: certain batch of outlet live fish.Conventional microbe culture and biochemistry detection go out the doubtful bacterium colony of Aeromonas hydrophila.
1.DNA extracting: with embodiment 1
2.PCR amplification 23S genetic fragment: with embodiment 1
3. the hybridization of probe on target gene amplified production and the nylon membrane: with embodiment 1
4. the enzyme linked immunological colour developing of hybridization positive spots
The enzyme linked immunological colour developing of hybridization spot is carried out according to Roche company digoxin dna marker and detection kit explanation.
*Probe site three on the results of hybridization of the interpretation interpretation as a result nylon membrane (Aeromonas general probe AFp1), probe site five (Aeromonas hydrophila probe Ahyr1) are dark blue color dot and are positive results of hybridization, show and contain the Aeromonas hydrophila probe in the sample, see Fig. 3.
After 2 days, conventional microbe culture contains Aeromonas hydrophila in the use bio-chemical detector is reached a conclusion sample.This explanation oligonucleotide probe site three, probe site five positive findingses are effective.
Embodiment 3
Sample: certain batch of import live fish.Conventional microbe culture and biochemistry detection go out the doubtful bacterium colony of Aeromonas caviae.
1.DNA extracting: with embodiment 1
2.PCR amplification 23S genetic fragment: with embodiment 1
3. the hybridization of probe on target gene amplified production and the nylon membrane: with embodiment 1
4. the enzyme linked immunological colour developing of hybridization positive spots
The enzyme linked immunological colour developing of hybridization spot is carried out according to Roche company digoxin dna marker and detection kit explanation.
*Probe site three on the results of hybridization of the interpretation interpretation as a result nylon membrane (Aeromonas general probe AFp1), all dark blue color dot of probe site six (Aeromonas caviae probe Acav1) are positive results of hybridization, show and contain Aeromonas caviae in the sample, see Fig. 4.
After 5 days, conventional microbe culture contains Aeromonas caviae in the use bio-chemical detector is reached a conclusion sample.The positive findings of this explanation oligonucleotide probe site three, probe site six is effective.
Embodiment 4
Sample: certain batch of import live fish.Conventional microbe culture and biochemistry detection go out the doubtful bacterium colony of C.perfringens.
1.DNA extracting: with embodiment 1
2.PCR amplification 23S genetic fragment: with embodiment 1
3. the hybridization of probe on target gene amplified production and the nylon membrane: with embodiment 1
4. the enzyme linked immunological colour developing of hybridization positive spots
The enzyme linked immunological colour developing of hybridization spot is carried out according to Roche company digoxin dna marker and detection kit explanation.
*Interpretation as a result
Probe site seven on the interpretation results of hybridization nylon membrane (fusobacterium general probe CloFp), all dark blue color dot of probe site eight (C.perfringens probe Cper1) are positive results of hybridization, show and contain C.perfringens in the sample, see Fig. 5.
After 5 days, conventional microbe culture contains C.perfringens in the use bio-chemical detector is reached a conclusion sample.The positive findings of this explanation oligonucleotide probe site seven, probe site eight is effective.
Embodiment 5
Sample: certain batch of import live fish.Conventional microbe culture and biochemistry detection go out the doubtful bacterium colony of clostridium botulinum.
1.DNA extracting: with embodiment 1
2.PCR amplification 23S genetic fragment: with embodiment 1
3. the hybridization of probe on target gene amplified production and the nylon membrane: with embodiment 1
4. the enzyme linked immunological colour developing of hybridization positive spots
The enzyme linked immunological colour developing of hybridization spot is carried out according to Roche company digoxin dna marker and detection kit explanation.
*Probe site seven on the results of hybridization of the interpretation interpretation as a result nylon membrane (fusobacterium general probe CloFp), all dark blue color dot of probe site nine (clostridium botulinum probe Cbot1) are positive results of hybridization, show and contain clostridium botulinum in the sample, see Fig. 6.
After 5 days, conventional microbe culture contains clostridium botulinum in the use bio-chemical detector is reached a conclusion sample.The positive findings of this explanation oligonucleotide probe site seven, probe site nine is effective.
Embodiment 6
Sample: certain batch of import live fish.Conventional microbe culture and the doubtful bacterium colony of biochemistry detection Chu Channel-catfish fish tarda.
1.DNA extracting: with embodiment 1
2.PCR amplification 23S genetic fragment: with embodiment 1
3. the hybridization of probe on target gene amplified production and the nylon membrane: with embodiment 1
4. the enzyme linked immunological colour developing of hybridization positive spots
The enzyme linked immunological colour developing of hybridization spot is carried out according to Roche company digoxin dna marker and detection kit explanation.
*Interpretation as a result
Probe site ten (Channel-catfish fish tarda probe Eict1 on the interpretation results of hybridization nylon membrane) show and contain clostridium botulinum in the sample, see Fig. 7.
After 5 days, conventional microbe culture is Han You Channel-catfish fish tarda in the use bio-chemical detector is reached a conclusion sample.The positive findings in this explanation oligonucleotide probe site ten is effective.
Embodiment 7
Sample: certain batch of import live fish.Conventional microbe culture and biochemistry detection go out the doubtful bacterium colony of fish enterococcus extremely.
1.DNA extracting: with embodiment 1
2.PCR amplification 23S genetic fragment: with embodiment 1
3. the hybridization of probe on target gene amplified production and the nylon membrane: with embodiment 1
4. the enzyme linked immunological colour developing of hybridization positive spots
The enzyme linked immunological colour developing of hybridization spot is carried out according to Roche company digoxin dna marker and detection kit explanation.
*Interpretation as a result
Probe site 11 on the interpretation results of hybridization nylon membrane (killing fish enterococcus probe Eserp1) shows to contain in the sample kills the fish enterococcus, sees Fig. 8.
After 5 days, conventional microbe culture contains fish enterococcus extremely in the use bio-chemical detector is reached a conclusion sample.The positive findings in this explanation oligonucleotide probe site 11 is effective.
Embodiment 8
Sample: certain batch of import live fish.Conventional microbe culture and biochemistry detection go out the doubtful bacterium colony of beta hemolysis type streptococcus.
1.DNA extracting: with embodiment 1
2.PCR amplification 23S genetic fragment: with embodiment 1
3. the hybridization of probe on target gene amplified production and the nylon membrane: with embodiment 1
4. the enzyme linked immunological colour developing of hybridization positive spots
The enzyme linked immunological colour developing of hybridization spot is carried out according to Roche company digoxin dna marker and detection kit explanation.
*Interpretation as a result
(the streptococcus general probe IIEser﹠amp of probe site 12 on the interpretation results of hybridization nylon membrane; Strp1) show and contain streptococcus in the sample, see Fig. 9.
After 5 days, conventional microbe culture contains streptococcus in the use bio-chemical detector is reached a conclusion sample.The positive findings in this explanation oligonucleotide probe site 12 is effective.
Embodiment 9
Sample: certain batch of import live fish.Conventional microbe culture and biochemistry detection go out to have a liking for the cold doubtful bacterium colony of bacillus of subduing.
1.DNA extracting: with embodiment 1
2.PCR amplification 23S genetic fragment: with embodiment 1
3. the hybridization of probe on target gene amplified production and the nylon membrane: with embodiment 1
4. the enzyme linked immunological colour developing of hybridization positive spots
The enzyme linked immunological colour developing of hybridization spot is carried out according to Roche company digoxin dna marker and detection kit explanation.
*Interpretation as a result
Probe site 13 on the interpretation results of hybridization nylon membrane (having a liking for the cold bacillus probe FleFp that subdues) shows to contain in the sample and has a liking for the cold bacillus of subduing, and sees Figure 10.
After 5 days, conventional microbe culture contains in the use bio-chemical detector is reached a conclusion sample has a liking for the cold bacillus of subduing.The positive findings in this explanation oligonucleotide probe site 13 is effective.
Embodiment 10
Sample: certain batch of import live fish.Conventional microbe culture and biochemistry detection go out the doubtful bacterium colony of Flexibacter columnaris.
1.DNA extracting: with embodiment 1
2.PCR amplification 23S genetic fragment: with embodiment 1
3. the hybridization of probe on target gene amplified production and the nylon membrane: with embodiment 1
4. the enzyme linked immunological colour developing of hybridization positive spots
The enzyme linked immunological colour developing of hybridization spot is carried out according to Roche company digoxin dna marker and detection kit explanation.
*Interpretation as a result
Probe site 14 on the interpretation results of hybridization nylon membrane (Flexibacter columnaris probe 1Fclup1) 15 (Flexibacter columnaris probe 2Fclup2) shows and contains Flexibacter columnaris in the sample, sees Figure 11.
After 5 days, conventional microbe culture contains the Flexibacter columnaris bacterium in the use bio-chemical detector is reached a conclusion sample.The positive findings in this explanation oligonucleotide probe site 14,15 is effective.
Embodiment 11
Sample: certain batch of import live fish.Conventional microbe culture and biochemistry detection go out the doubtful bacterium colony of multocida.
1.DNA extracting: with embodiment 1
2.PCR amplification 23S genetic fragment: with embodiment 1
3. the hybridization of probe on target gene amplified production and the nylon membrane: with embodiment 1
4. the enzyme linked immunological colour developing of hybridization positive spots
The enzyme linked immunological colour developing of hybridization spot is carried out according to Roche company digoxin dna marker and detection kit explanation.
*Interpretation as a result
Probe site 16 on the interpretation results of hybridization nylon membrane (multocida probe 1Pmulp1) probe site 17 (multocida probe 2Pmulp2) shows and contains the multocida bacterium in the sample, sees Figure 12.
After 5 days, conventional microbe culture contains multocida in the use bio-chemical detector is reached a conclusion sample.The positive findings in this explanation oligonucleotide probe site 14 is effective.
Embodiment 12
Sample: certain batch of import live fish.Conventional microbe culture and biochemistry detection go out the doubtful bacterium colony of fish pasteurella extremely.
1.DNA extracting: with embodiment 1
2.PCR amplification 23S genetic fragment: with embodiment 1
3. the hybridization of probe on target gene amplified production and the nylon membrane: with embodiment 1
4. the enzyme linked immunological colour developing of hybridization positive spots
The enzyme linked immunological colour developing of hybridization spot is carried out according to Roche company digoxin dna marker and detection kit explanation.
*Interpretation as a result
Probe site 18 on the interpretation results of hybridization nylon membrane (killing fish pasteurella probe Ppisp) shows to contain in the sample kills the fish pasteurella, sees Figure 13.
After 5 days, conventional microbe culture contains fish pasteurella extremely in the use bio-chemical detector is reached a conclusion sample.The positive findings in this explanation oligonucleotide probe site 18 is effective.
Embodiment 13
Sample: certain batch of import live fish.Conventional microbe culture and biochemistry detection go out the doubtful bacterium colony of pseudomonas putida.
1.DNA extracting: with embodiment 1
2.PCR amplification 23S genetic fragment: with embodiment 1
3. the hybridization of probe on target gene amplified production and the nylon membrane: with embodiment 1
4. the enzyme linked immunological colour developing of hybridization positive spots
The enzyme linked immunological colour developing of hybridization spot is carried out according to Roche company digoxin dna marker and detection kit explanation.
*Interpretation as a result
Probe site 19 on the interpretation results of hybridization nylon membrane (pseudomonas putida probe 1Pputpl) probe site 20 (pseudomonas putida probe 2Pputp2) shows and contains pseudomonas putida in the sample, sees Figure 14.
After 5 days, conventional microbe culture contains pseudomonas putida in the use bio-chemical detector is reached a conclusion sample.The positive findings in this explanation oligonucleotide probe site 19,20 is effective.
Embodiment 14
Sample: certain batch of import live fish.Conventional microbe culture and biochemistry detection go out the doubtful bacterium colony of Pseudomonas fluorescens.
1.DNA extracting: with embodiment 1
2.PCR amplification 23S genetic fragment: with embodiment 1
3. the hybridization of probe on target gene amplified production and the nylon membrane: with embodiment 1
4. the enzyme linked immunological colour developing of hybridization positive spots
The enzyme linked immunological colour developing of hybridization spot is carried out according to Roche company digoxin dna marker and detection kit explanation.
* interpretation as a result
Probe site 21 on the interpretation results of hybridization nylon membrane (Pseudomonas fluorescens probe 1Pflup1) 22 (Pseudomonas fluorescens probe 2Pflup2) shows and contains Pseudomonas fluorescens in the sample, sees Figure 15.
After 5 days, conventional microbe culture contains the Pseudomonas fluorescens bacterium in the use bio-chemical detector is reached a conclusion sample.The positive findings in this explanation oligonucleotide probe site 21,22 is effective.
Embodiment 15
Sample: certain batch of import live fish.Conventional microbe culture and biochemistry detection go out the doubtful bacterium colony of comma bacillus.
1.DNA extracting: with embodiment 1
2.PCR amplification 23S genetic fragment: with embodiment 1
3. the hybridization of probe on target gene amplified production and the nylon membrane: with embodiment 1
4. the enzyme linked immunological colour developing of hybridization positive spots
The enzyme linked immunological colour developing of hybridization spot is carried out according to Roche company digoxin dna marker and detection kit explanation.
*Interpretation as a result
Probe site 23 on the interpretation results of hybridization nylon membrane (comma bacillus and vibrio mimicus probe 1Vchmip11) probe site 24 (comma bacillus and vibrio mimicus probe 2Vchmip12) probe site 25 (comma bacillus and vibrio mimicus probe 3Vchmip13) shows and contains comma bacillus in the sample, sees Figure 16.
After 5 days, conventional microbe culture contains comma bacillus in the use bio-chemical detector is reached a conclusion sample.This explanation oligonucleotide probe site 23,24,25 positive findings is effective.
Embodiment 16
Sample: certain batch of import live fish.Conventional microbe culture and biochemistry detection go out the doubtful bacterium colony of vibrio mimicus.
1.DNA extracting: with embodiment 1
2.PCR amplification 23S genetic fragment: with embodiment 1
3. the hybridization of probe on target gene amplified production and the nylon membrane: with embodiment 1
4. the enzyme linked immunological colour developing of hybridization positive spots
The enzyme linked immunological colour developing of hybridization spot is carried out according to Roche company digoxin dna marker and detection kit explanation.
*Interpretation as a result
Probe site 23 on the interpretation results of hybridization nylon membrane (comma bacillus and vibrio mimicus probe 1Vchmip11) probe site 24 (comma bacillus and vibrio mimicus probe 2Vchmip12) probe site 25 (comma bacillus and vibrio mimicus probe 3Vchmip13) shows and contains vibrio mimicus in the sample, sees Figure 17.
After 5 days, conventional microbe culture contains vibrio mimicus in the use bio-chemical detector is reached a conclusion sample.This explanation oligonucleotide probe site 23,24,25 positive findings is effective.
Embodiment 17
Sample: certain batch of import live fish.Conventional microbe culture and biochemistry detection go out to breathe out the doubtful bacterium colony of arc maintenance bacterium.
1.DNA extracting: with embodiment 1
2.PCR amplification 23S genetic fragment: with embodiment 1
3. the hybridization of probe on target gene amplified production and the nylon membrane: with embodiment 1
4. the enzyme linked immunological colour developing of hybridization positive spots
The enzyme linked immunological colour developing of hybridization spot is carried out according to Roche company digoxin dna marker and detection kit explanation.
*Interpretation as a result
Probe site 27 on the interpretation results of hybridization nylon membrane (breathing out arc maintenance bacterium probe 1Vharp11) probe site 28 (breathing out arc maintenance bacterium probe 2Vharp12) probe site 29 (breathing out arc maintenance bacterium probe 3Vharp13) shows and contains vibrio mimicus in the sample, sees Figure 18.
After 5 days, conventional microbe culture contains in the use bio-chemical detector is reached a conclusion sample breathes out the arc maintenance bacterium.This explanation oligonucleotide probe site, 27,28,29 positive findings is effective.
Embodiment 18
Sample: certain batch of import live fish.Conventional microbe culture and biochemistry detection go out the doubtful bacterium colony of Vibrio vulnificus.
1.DNA extracting: with embodiment 1
2.PCR amplification 23S genetic fragment: with embodiment 1
3. the hybridization of probe on target gene amplified production and the nylon membrane: with embodiment 1
4. the enzyme linked immunological colour developing of hybridization positive spots
The enzyme linked immunological colour developing of hybridization spot is carried out according to Roche company digoxin dna marker and detection kit explanation.
*Interpretation as a result
Probe site 30 on the interpretation results of hybridization nylon membrane (Vibrio vulnificus probe 1Vvulp11) probe site 31 (Vibrio vulnificus probe 2Vvulp 21) shows and contains Vibrio vulnificus in the sample, sees Figure 19.
After 5 days, conventional microbe culture contains Vibrio vulnificus in the use bio-chemical detector is reached a conclusion sample.This explanation oligonucleotide probe site, 30,31 positive findings is effective.
Embodiment 19
Sample: certain batch of import live fish.Conventional microbe culture and biochemistry detection go out the doubtful bacterium colony of vibrio parahaemolytious.
1.DNA extracting: with embodiment 1
2.PCR amplification 23S genetic fragment: with embodiment 1
3. the hybridization of probe on target gene amplified production and the nylon membrane: with embodiment 1
4. the enzyme linked immunological colour developing of hybridization positive spots
The enzyme linked immunological colour developing of hybridization spot is carried out according to Roche company digoxin dna marker and detection kit explanation.
*Interpretation as a result
Probe site 32 on the interpretation results of hybridization nylon membrane (vibrio parahaemolytious probe Vparp 21) shows and contains vibrio parahaemolytious in the sample, sees Figure 20.
After 5 days, conventional microbe culture contains vibrio parahaemolytious in the use bio-chemical detector is reached a conclusion sample.This explanation oligonucleotide probe site, 32 positive findings is effective.
Embodiment 20
Sample: certain batch of import live fish.Conventional microbe culture and biochemistry detection go out the doubtful bacterium colony of vibrio fluvialis.
1.DNA extracting: with embodiment 1
2.PCR amplification 23S genetic fragment: with embodiment 1
3. the hybridization of probe on target gene amplified production and the nylon membrane: with embodiment 1
4. the enzyme linked immunological colour developing of hybridization positive spots
The enzyme linked immunological colour developing of hybridization spot is carried out according to Roche company digoxin dna marker and detection kit explanation.
*Interpretation as a result
Probe site 33 on the interpretation results of hybridization nylon membrane (river Fu Shi vibrios probe 1Vflfup11) probe site 34 (river Fu Shi vibrios probe 2Vflfup12) shows and contains vibrio fluvialis in the sample, sees Figure 21.
After 5 days, conventional microbe culture is vibrio fluvialis in the use bio-chemical detector is reached a conclusion sample.This explanation oligonucleotide probe site, 33,34 positive findings is effective.
Embodiment 21
Sample: certain batch of import live fish.Conventional microbe culture and biochemistry detection go out the doubtful bacterium colony of Fu Shi vibrios.
1.DNA extracting: with embodiment 1
2.PCR amplification 23S genetic fragment: with embodiment 1
3. the hybridization of probe on target gene amplified production and the nylon membrane: with embodiment 1
4. the enzyme linked immunological colour developing of hybridization positive spots
The enzyme linked immunological colour developing of hybridization spot is carried out according to Roche company digoxin dna marker and detection kit explanation.
*Interpretation as a result
Probe site 33 on the interpretation results of hybridization nylon membrane (river Fu Shi vibrios probe 1Vflfup11) probe site 34 (river Fu Shi vibrios probe 2Vflfup12) shows and contains the Fu Shi vibrios in the sample, sees Figure 22.
After 5 days, conventional microbe culture is the Fu Shi vibrios in the use bio-chemical detector is reached a conclusion sample.This explanation oligonucleotide probe site, 33,34 positive findings is effective.
Embodiment 22
Sample: certain batch of import live fish.Conventional microbe culture and biochemistry detection go out the doubtful bacterium colony of vibrio alginolyticus.
1.DNA extracting: with embodiment 1
2.PCR amplification 23S genetic fragment: with embodiment 1
3. the hybridization of probe on target gene amplified production and the nylon membrane: with embodiment 1
4. the enzyme linked immunological colour developing of hybridization positive spots
The enzyme linked immunological colour developing of hybridization spot is carried out according to Roche company digoxin dna marker and detection kit explanation.
*Interpretation as a result
Probe site 35 on the interpretation results of hybridization nylon membrane (vibrio alginolyticus probe Vflfup 21) probe site 36 (vibrio alginolyticus probe Valgp21) shows and contains vibrio alginolyticus in the sample, sees Figure 23.
After 5 days, conventional microbe culture is vibrio alginolyticus in the use bio-chemical detector is reached a conclusion sample.This explanation oligonucleotide probe site, 35,36 positive findings is effective.
SEQUENCE?LISTING
＜110〉Nankai University
＜120〉use the 23S ribosome gene probe array to detect the method for aquatic animal pathogenic bacteria
<130>20060716
<160>36
<170>PatentIn?version?3.3
<210>1
<211>21
<212>DNA
＜213〉Aeromonas
<220>
<221>misc_feature
<222>(1)..(21)
<400>1
ctcagtagcg?gcgagcgaac?g 21
<210>2
<211>30
<212>DNA
＜213〉aeromonas salmonicida
<220>
<221>misc_feature
<222>(1)..(30)
<400>2
tatcgttaca?tgaatacata?gtgtaacgag 30
<210>3
<211>28
<212>DNA
＜213〉Aeromonas hydrophila
<220>
<221>misc_feature
<222>(1)..(28)
<400>3
taagtgaata?catagcttaa?cgaggcga 28
<210>4
<211>28
<212>DNA
＜213〉Aeromonas caviae
<220>
<221>misc_feature
<222>(1)..(28)
<400>4
ttactgaata?cataggtaat?agaggcga 28
<210>5
<211>25
<212>DNA
＜213〉clostridium
<220>
<221>misc_feature
<222>(1)..(25)
<400>5
ccagagtacc?acgagacacg?tgaaa 25
<210>6
<211>28
<212>DNA
＜213〉C.perfringens
<220>
<221>misc_feature
<222>(1)..(28)
<400>6
aagtggaggc?tattgtaact?gaagagaa 28
<210>7
<211>27
<212>DNA
＜213〉clostridium botulinum
<220>
<221>misc_feature
<222>(1)..(27)
<400>7
gagaaattat?ggttaaccga?acacaac 27
<210>8
<211>23
<212>DNA
＜213〉Channel-catfish fish tardas
<220>
<221>misc_feature
<222>(1)..(23)
<400>8
acgaaggtgc?acagctgtga?gtt 23
<210>9
<211>30
<212>DNA
＜213〉kill the fish enterococcus
<220>
<221>misc_feature
<222>(1)..(30)
<400>9
actatgttat?gcatagtatc?cgtaagtgaa 30
<210>10
<211>28
<212>DNA
＜213〉streptococcus
<220>
<221>misc_feature
<222>(1)..(28)
<400>10
tatagaagaa?ttacctggga?aggtaagc 28
<210>11
<211>24
<212>DNA
＜213〉have a liking for the cold bacillus of subduing
<220>
<221>misc_feature
<222>(1)..(24)
<400>11
tagcccaaac?cdawgttgtt?acgg 24
<210>12
<211>29
<212>DNA
＜213〉Flexibacter columnaris
<220>
<221>misc_feature
<222>(1)..(29)
<400>12
actttccagt?aaattctaat?tctatccgc 29
<210>13
<211>32
<212>DNA
＜213〉Flexibacter columnaris
<220>
<221>misc_feature
<222>(1)..(32)
<400>13
ataagtaata?gaagataacg?atagtggtat?cc 32
<210>14
<211>32
<212>DNA
＜213〉multocida
<220>
<221>misc_feature
<222>(1)..(32)
<400>14
agtaagtttt?agctagcata?ttagaggaat?tg 32
<210>15
<211>30
<212>DNA
＜213〉multocida
<220>
<221>misc_feature
<222>(1)..(30)
<400>15
gtactcgaaa?gtatgttagt?ggaactaagc 30
<210>16
<211>27
<212>DNA
＜213〉kill the fish pasteurella
<220>
<221>misc_feature
<222>(1)..(27)
<400>16
cttaagctaa?tcttgcgtta?ggtgaac 27
<210>17
<211>26
<212>DNA
＜213〉pseudomonas putida
<220>
<221>misc_feature
<222>(1)..(26)
<400>17
gaccagccct?taagttgatt?tgagat 26
<210>18
<211>26
<212>DNA
＜213〉pseudomonas putida
<220>
<221>misc_feature
<222>(1)..(26)
<400>18
ccgtacacga?aaatctcttg?tcaatg 26
<210>19
<211>26
<212>DNA
＜213〉Pseudomonas fluorescens
<220>
<221>misc_feature
<222>(1)..(26)
<400>19
gactagccct?taagtggctt?tgagat 26
<210>20
<211>27
<212>DNA
＜213〉Pseudomonas fluorescens
<220>
<221>misc_feature
<222>(1)..(27)
<400>20
cctgtacgcg?aaaatctctt?agtcatg 27
<210>21
<211>24
<212>DNA
＜213〉cloves group pseudomonad
<220>
<221>misc_feature
<222>(1)..(24)
<400>21
acgcgaaaat?ccctttgcaa?tgaa 24
<210>22
<211>27
<212>DNA
＜213〉comma bacillus and vibrio mimicus
<220>
<221>misc_feature
<222>(1)..(27)
<400>22
actcggtgaa?gtaggtgaac?aagctgg 27
<210>23
<211>26
<212>DNA
＜213〉comma bacillus and vibrio mimicus
<220>
<221>misc_feature
<222>(1)..(26)
<400>23
gaagyaggtg?aacaagctgg?aaagct 26
<210>24
<211>22
<212>DNA
＜213〉comma bacillus and vibrio mimicus
<220>
<221>misc_feature
<222>(1)..(22)
<400>24
gctggaaagc?ttggcgatac?ag 22
<210>25
<211>27
<212>DNA
＜213〉breathe out the arc maintenance bacterium
<220>
<221>misc_feature
<222>(1)..(27)
<400>25
ctttttatgc?gtcaggtgaa?acttctg 27
<210>26
<211>27
<212>DNA
＜213〉breathe out the arc maintenance bacterium
<220>
<221>misc_feature
<222>(1)..(27)
<400>26
gtgaaacttc?tggaaagttg?tgcgata 27
<210>27
<211>25
<212>DNA
＜213〉breathe out the arc maintenance bacterium
<220>
<221>misc_feature
<222>(1)..(25)
<400>27
taaccggcaa?cgcatataaa?gtgaa 25
<210>28
<211>26
<212>DNA
＜213〉Vibrio vulnificus
<220>
<221>misc_feature
<222>(1)..(26)
<400>28
aagctttaca?tgtgttagac?gaacgg 26
<210>29
<211>26
<212>DNA
＜213〉Vibrio vulnificus
<220>
<221>misc_feature
<222>(1)..(26)
<400>29
ttgtagatgc?atgttcagtg?aaatcg 26
<210>30
<211>25
<212>DNA
＜213〉vibrio parahaemolytious
<220>
<221>misc_feature
<222>(1)..(25)
<400>30
ttgacgacgt?gtgttcagtg?aaatc 25
<210>31
<211>25
<212>DNA
＜213〉vibrio fluvialis and Fu Shi vibrios
<220>
<221>misc_feature
<222>(1)..(25)
<400>31
tttacatgcg?tcaggtgaag?gttct 25
<210>32
<211>22
<212>DNA
＜213〉vibrio fluvialis and Fu Shi vibrios
<220>
<221>misc_feature
<222>(1)..(22)
<400>32
tctggaaagg?accgcgaaac?ag 22
<210>33
<211>22
<212>DNA
＜213〉vibrio alginolyticus
<220>
<221>misc_feature
<222>(1)..(22)
<400>33
agccgacagc?gcatgttcag?tg 22
<210>34
<211>26
<212>DNA
＜213〉vibrio alginolyticus
<220>
<221>misc_feature
<222>(1)..(26)
<400>34
aactgacgac?gcatattcag?tgaaat 26
<210>35
<211>23
<212>DNA
＜213〉synthetic
<220>
<221>primer_bind
<222>(1)..(23)
<400>35
gcgatttcyg?aayggggraa?ccc 23
<210>36
<211>22
<212>DNA
＜213〉synthetic
<220>
<221>primer_bind
<222>(1)..(22)
<400>36
ttcgcctttc?cctcacggta?ct 22
Claims (2)
1. one kind is detected the method for aquatic animal pathogenic bacteria with the 23S ribosome gene probe array, it is characterized in that this method may further comprise the steps:
(1) design specific oligonucleotide probe is used for oligonucleotide microarray and detects, and designed specific oligonucleotide probe sequence is as follows:
Sequence one: (Aeromonas general probe AFp1) CTCAGTAGCGGCGAGCGAACG
Sequence two: (aeromonas salmonicida probe Asal1) TATCGTTACATGAATACATAGTGTAACGAG
Sequence three: (Aeromonas hydrophila probe Ahyr1) TAAGTGAATACATAGCTTAACGAGGCGA
Sequence four: (Aeromonas caviae probe Acav1) TTACTGAATACATAGGTAATAGAGGCGA
Sequence five: (fusobacterium general probe CloFp) CCAGAGTACCACGAGACACGTGAAA
Sequence six: (C.perfringens probe Cper1) AAGTGGAGGCTATTGTAACTGAAGAGAA
Sequence seven: (clostridium botulinum probe Cbot1) GAGAAATTATGGTTAACCGAACACAAC
Sequence eight: (the silver xenocypris fish is liked Dehua Salmonella probe Eict1) ACGAAGGTGCACAGCTGTGAGTT
Sequence nine: (killing fish enterococcus probe Eserp1) ACTATGTTATGCATAGTATCCGTAAGTGAA
Sequence ten: (streptococcus general probe Strp1) TATAGAAGAATTACCTGGGAAGGTAAGC
Sequence 11: (having a liking for the cold bacillus probe FleFp that subdues) TAGCCCAAACCDAWGTTGTTACGG
Sequence 12: (Flexibacter columnaris probe 1 Fclup1) ACTTTCCAGTAAATTCTAATTCTATCCGC
Sequence 13: (Flexibacter columnaris probe 2 Fclup2) ATAAGTAATAGAAGATAACGATAGTGGTATCC
Sequence 14: (multocida probe 1 Pmulp1)
AGTAAGTTTTAGCTAGCATATTAGAGGAATTG
Sequence 15: (multocida probe 2 Pmulp2) GTACTCGAAAGTATGTTAGTGGAACTAAGC
Sequence 16: (killing fish pasteurella probe Ppisp) CTTAAGCTAATCTTGCGTTAGGTGAAC
Sequence 17: (pseudomonas putida probe 1 Pputp1) GACCAGCCCTTAAGTTGATTTGAGAT
Sequence 18: (pseudomonas putida probe 2 Pputp2) CCGTACACGAAAATCTCTTGTCAATG
Sequence 19: (Pseudomonas fluorescens probe 1 Pflup1) GACTAGCCCTTAAGTGGCTTTGAGAT
Sequence 20: (Pseudomonas fluorescens probe 2 Pflup2) CCTGTACGCGAAAATCTCTTAGTCATG
Sequence 21: (cloves group pseudomonad probe Psyrp2) ACGCGAAAATCCCTTTGCAATGAA
Sequence 22: (comma bacillus and vibrio mimicus probe 1 Vchmip11)
ACTCGGTGAAGTAGGTGAACAAGCTGG
Sequence 23: (comma bacillus and vibrio mimicus probe 2 Vchmip12)
GAAGTAGGTGAACAAGCTGGAAAGCT
Sequence 24: (comma bacillus and vibrio mimicus probe 3 Vcmap13) GCTGGAAAGCTTGGCGATACAG
Sequence 25: (breathing out arc maintenance bacterium probe 1 Vharp11) CTTTTTATGCGTCAGGTGAAACTTCTG
Sequence 26: (breathing out arc maintenance bacterium probe 2 Vharp12) GTGAAACTTCTGGAAAGTTGTGCGATA
Sequence 27: (breathing out arc maintenance bacterium probe 3 Vharp21) TAACCGGCAACGCATATAAAGTGAA
Sequence 28: (Vibrio vulnificus probe 1 Vvulp11) AAGCTTTACATGTGTTAGACGAACGG
Sequence 29: (Vibrio vulnificus probe 2 Vvulp 21) TTGTAGATGCATGTTCAGTGAAATCG
Sequence 30: (vibrio parahaemolytious probe V.parp 21) TTGACGACGTGTGTTCAGTGAAATC
Sequence 31: (vibrio fluvialis and Fu Shi vibrios probe 1 Vflfup11) TTTACATGCGTCAGGTGAAGGTTCT
Sequence 32: (vibrio fluvialis and Fu Shi vibrios probe 2 Vflfup12) TCTGGAAAGGACCGCGAAACAG
Sequence 33: (vibrio alginolyticus probe Vflfup 21) AGCCGACAGCGCATGTTCAGTG
Sequence 34: (vibrio alginolyticus probe Valgp21) AACTGACGACGCATATTCAGTGAAAT
(2) the intragenic dna fragmentation of 23s rRNA of whole prokaryotic micro-organisms, simultaneously Gaoxin mark in the pcr amplification testing sample;
(3) the PCR product with oligonucleotide microarray and digoxigenin labeled carries out molecular hyridization;
(4) results of hybridization is by the colour developing of enzyme linked immunological developing technology;
(5) the colour developing result detects by an unaided eye, and can find the specific probe site colour developing of hybridizing.
2. utilization 23S ribosome gene probe array detects the application of method aspect the detection aquatic animal pathogenic bacteria of multiple aquatic animal pathogenic bacteria.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200610014764 CN1877328A (en) | 2006-07-12 | 2006-07-12 | Method for detecting aquatic animal pathogenic bacteria by using 23S ribosome gene probe array |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200610014764 CN1877328A (en) | 2006-07-12 | 2006-07-12 | Method for detecting aquatic animal pathogenic bacteria by using 23S ribosome gene probe array |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1877328A true CN1877328A (en) | 2006-12-13 |
Family
ID=37509819
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200610014764 Pending CN1877328A (en) | 2006-07-12 | 2006-07-12 | Method for detecting aquatic animal pathogenic bacteria by using 23S ribosome gene probe array |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1877328A (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102134597A (en) * | 2010-12-28 | 2011-07-27 | 浙江海洋学院 | Kit for detecting aeromonas hydrophila and aeromonas sobria through fluorescence quantitive polymerase chain reaction (FQ-PCR) |
| ES2371976A1 (en) * | 2009-07-10 | 2012-01-12 | Instituto Andaluz De Investigación Y Formación Agraria, Pesquera, Alimentaria Y Producción Ecológica | Method of identification of fish pathogens: photobacterium damsela, tenacibaculum soleae, tenacibaculum maritimum and vibrio harveyi. (Machine-translation by Google Translate, not legally binding) |
| CN102382879A (en) * | 2011-10-21 | 2012-03-21 | 宁波大学 | Pseudomonas fluorescens LAMP (loop-mediated isothermal amplification) detection agent and kit |
| CN102605075A (en) * | 2012-03-22 | 2012-07-25 | 集美大学 | A group of oligonucleotide sequences capable of identifying Vibrio harveyi and Vibrio alginolyticus synchronously and preparation method of the oligonucleotide sequences |
| CN101382542B (en) * | 2008-06-27 | 2012-11-07 | 江南大学 | Immunofluorescence PCR detecting method for microcystin-LR |
| CN103276093A (en) * | 2013-06-06 | 2013-09-04 | 宁波大学 | Fluorescent quantitative PCR detection kit of Pseudomonas plecoglossicida, and detection method thereof |
| CN108504755A (en) * | 2018-04-03 | 2018-09-07 | 四川大学 | Clostridium microorganism belonging to genus specific probe and application thereof |
-
2006
- 2006-07-12 CN CN 200610014764 patent/CN1877328A/en active Pending
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101382542B (en) * | 2008-06-27 | 2012-11-07 | 江南大学 | Immunofluorescence PCR detecting method for microcystin-LR |
| ES2371976A1 (en) * | 2009-07-10 | 2012-01-12 | Instituto Andaluz De Investigación Y Formación Agraria, Pesquera, Alimentaria Y Producción Ecológica | Method of identification of fish pathogens: photobacterium damsela, tenacibaculum soleae, tenacibaculum maritimum and vibrio harveyi. (Machine-translation by Google Translate, not legally binding) |
| CN102134597A (en) * | 2010-12-28 | 2011-07-27 | 浙江海洋学院 | Kit for detecting aeromonas hydrophila and aeromonas sobria through fluorescence quantitive polymerase chain reaction (FQ-PCR) |
| CN102134597B (en) * | 2010-12-28 | 2012-09-12 | 浙江海洋学院 | Kit for detecting aeromonas hydrophila and aeromonas sobria through fluorescence quantitive polymerase chain reaction (FQ-PCR) |
| CN102382879A (en) * | 2011-10-21 | 2012-03-21 | 宁波大学 | Pseudomonas fluorescens LAMP (loop-mediated isothermal amplification) detection agent and kit |
| CN102382879B (en) * | 2011-10-21 | 2013-09-04 | 宁波大学 | Pseudomonas fluorescens LAMP (loop-mediated isothermal amplification) detection agent and kit |
| CN102605075A (en) * | 2012-03-22 | 2012-07-25 | 集美大学 | A group of oligonucleotide sequences capable of identifying Vibrio harveyi and Vibrio alginolyticus synchronously and preparation method of the oligonucleotide sequences |
| CN103276093A (en) * | 2013-06-06 | 2013-09-04 | 宁波大学 | Fluorescent quantitative PCR detection kit of Pseudomonas plecoglossicida, and detection method thereof |
| CN108504755A (en) * | 2018-04-03 | 2018-09-07 | 四川大学 | Clostridium microorganism belonging to genus specific probe and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101056883A (en) | Amplification blocker for imbedibility nucleic acid (ina) containing imbedibility pseudo nucleic acid (IPN) | |
| CN1711357A (en) | One step real-time RT PCR kits for the universal detection of organisms in industrial products | |
| CN1683565A (en) | Oligonucleotide probe kit for detecting common intestine trac kpathogenic bacteria and its use | |
| CN1687454A (en) | Method for sceening viral nucleic acid of blood through isothermal amplification based on loop mediated technique | |
| CN101058833A (en) | Primer system and method for detecting and analyzing avian influenza virus | |
| CN1876844A (en) | Identification and/or quantification method of nucleotide sequence(s) elements specific of genetically modified plants on arrays | |
| CN1877328A (en) | Method for detecting aquatic animal pathogenic bacteria by using 23S ribosome gene probe array | |
| CN101074450A (en) | Diagnostic probe detection system | |
| CN1156587C (en) | Chinese dendrobe plant and its medicinal materials DNA molecular diagnosis method | |
| CN100345980C (en) | PCR primer set for detecting hepatitis b virus, method for detecting hepatitis b using the primer set, and hepatitis b virus detection kit including the primer set | |
| CN1646705A (en) | Amplification-hybridisation method for detecting and typing human papillomavirus | |
| CN1748028A (en) | Signal amplification method for detecting mutant gene | |
| CN101067149A (en) | CYP3A detecting chip and its application | |
| CN1633500A (en) | Primers for nucleic acid amplification in detecting housekeeping gene mRNA and test method using these primers | |
| CN1697883A (en) | Method of detecting target nucleotide sequence, detection target structure to be used in embodying the method, process for producing the same and assay kit for detecting target nucleotide sequence | |
| CN1635150A (en) | Medicine and bacterium resistant detection chip, method for preparation and application thereof | |
| CN1877327A (en) | Method for detecting aquatic animal pathogenic bacteria by using ribosome interoperonic region probe | |
| CN1160459C (en) | Cytochrome BD type quinol oxidase gene of brevibacterium lactofermentum | |
| CN1202264C (en) | Quantitative character gene site locating method based genomic exon chip | |
| CN1186457C (en) | Homogeneous genetic matrix | |
| CN1173989C (en) | DNA sequence of dendrobium and method for discriminating its veriety and judging if it is true or false | |
| CN1508546A (en) | Method for detecting antiacid bacteria using ribosome RNA as target | |
| CN100351374C (en) | Oligonucleotides for detecting tubercle bacillus and method therefor | |
| CN1166947C (en) | Duplicating, detecting and quantizing of taget analyte of nucleotide series in sample by using sterically defined taget analyte | |
| CN1152139C (en) | Method of genetic varietal differentiation of hop |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |