CN102382879B - Pseudomonas fluorescens LAMP (loop-mediated isothermal amplification) detection agent and kit - Google Patents
Pseudomonas fluorescens LAMP (loop-mediated isothermal amplification) detection agent and kit Download PDFInfo
- Publication number
- CN102382879B CN102382879B CN 201110321179 CN201110321179A CN102382879B CN 102382879 B CN102382879 B CN 102382879B CN 201110321179 CN201110321179 CN 201110321179 CN 201110321179 A CN201110321179 A CN 201110321179A CN 102382879 B CN102382879 B CN 102382879B
- Authority
- CN
- China
- Prior art keywords
- primer
- solution
- pseudomonas fluorescens
- lamp
- concentration
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a pseudomonas fluorescens LAMP (loop-mediated isothermal amplification) detection agent and kit. The pseudomonas fluorescens LAMP detection agent is characterized by constructing five primers having good amplification efficiency and specificity: F3:GCGCGAATACTTCAAGTCCA, B3:GTACAGCTGCGAAGTCTGC, Y-LB:TCAACCACGGGGAGCAT, FIP:AGGTGGGGTTGCTGCTGTAGAGGTCAACCTGCTGTATGTGA and BIP:TGCCCAAGACCATCCTTTCCAAACAGTTCGTTGGTGTCCG. Compared with the conventional PCR (polymerase chain reaction), the pseudomonas fluorescens LAMP detection reagent and kit can overcome the disadvantages of high time consumption, high requirements for equipment and the like. The agent and kit composed of the five specific primers can carry out quick and accurate qualitative detection on pseudomonas fluorescens in a sample, and have the advantages of good specificity, simple operation process, visual result, low cost and the like.
Description
Technical field
The present invention relates to the detection technique of Pseudomonas fluorescens, be specifically related to Pseudomonas fluorescens LAMP detection reagent and test kit.
Background technology
Pseudomonas fluorescens (
Pseudomonas fluorescensMigula) be Rhodopseudomonas, reproduction speed is fast in the time of 4 ℃, is the easiest pollution and cause one of microorganism of corruption even human diseases in fishery products production, storage and the sales process, also is the dominant bacteria of March, May ocean Lu Yuan sewage draining exit.The detection method of pseudomonas comprises that mainly serology detects (DAS-ELISA), reverse transcription-polymerase chain reaction (PCR) technology and loop-mediated isothermal amplification technique (LAMP).Be the patent of invention of CN101403001 as notification number, disclose the test kit of being formed by reaction solution, Bst archaeal dna polymerase, stable liquid, sample pretreatment liquid, colour developing liquid and positive control solution, detect Pseudomonas aeruginosa with the LAMP method, wherein reaction solution contains 2 pairs of primers of outer primer and inner primer, it depends on 2 pairs of primers and a kind of tool de-rotation function can identifying 6 special zones on the target sequence and is the Bst archaeal dna polymerase of waterfall type amplification, amplified target sequence that can be efficient, quick and special under isothermal condition.Because LAMP is the waterfall type amplification, so its amplification efficiency is very high; Simultaneously, 6～8 specificity sites on the LAMP identification target sequence, its specificity is also very strong; LAMP only carries out constant-temperature amplification at 60 ℃～65 ℃, as long as water-bath need not special instrument, operates very simple; And the whole detection reaction of LAMP only needs 1.5 h～2.5 h, and sense cycle is very short.Also do not study at present and set up special, sensitive and Pseudomonas fluorescens LAMP detection reagent and test kit simple to operate.
Summary of the invention
Technical problem to be solved by this invention provides a kind ofly has specificity height, sense cycle RT-LAMP detection reagent short, with low cost and simple to operate and and test kit to Pseudomonas fluorescens.
The present invention solves the problems of the technologies described above the technical scheme that adopts: Pseudomonas fluorescens LAMP detection reagent,
Comprise Auele Specific Primer solution, Auele Specific Primer solution is F3/B3 primer solution, FIP/BIP primer solution and Y-LB primer solution, and described F3/B3 primer solution contains the Auele Specific Primer that sequence is F3:5 '-GCGCGAATAC TTCAAGTCCA-3 ', B3:5 '-GTACAGCTGC GAAGTCTGC-3 '; Described FIP/BIP primer solution contains the Auele Specific Primer that sequence is FIP:5 '-AGGTGGGGTT GCTGCTGTAG AGGTCAACCT GCTGTATGTG A-3 ', BIP:5 '-TGCCCAAGAC CATCCTTTCC AAACAGTTCG TTGGTGTCCG-3 '; Described Y-LB primer solution contains sequence: 5 '-Auele Specific Primer of TCAACCACGG GGAGCAT-3 '.
Above-mentioned primer is that the cDNA sequence of selection Pseudomonas fluorescens is target, use PRIMEREXPLORER V4(http: //primerexplorer.jp/eLAMP4.0.0/index.htmL) software design is synthetic, the many of design are carried out the reaction times and temperature of reaction is optimized test to primer, obtain only reaction conditions.The cDNA sequence of this Pseudomonas fluorescens nucleotides sequence classify as:
ATGTCAAAAG TAAAAGACAA AGCTGGAAGC GGCGAAATAC CAGCGACTTT AAGGATCGTC CTATCCCGGA TTAAGGAGGG TTTATTTAGA GTGGGTCCAT GAGATTAAGG ACCTACCTTC ATCAGATCAG TCCCGTATTT TCCAGTCCTG AAGCCGCCAG CAGGTTGCTG CGTCTGTTCG CGCTCATTCT TTTGGTTGGT ATCCTCGGAG CCGTCTACAA CTTCCTCAAC TCCACCCTCA GCAACGACAT TTCCCGGCGC CGCGGCTACA TGAGCAGCGC CATCGCCGAA GCCCAGACCT TCTTCACCAG CCGCGAGGCC TTGCTGGAAA GCCTCAGCCT GTCCGCGGTA CGCCGCTCCA AGCAGGCCCA GGCCCTGGTG TACCTGCCCT CCACCGAAGA
ACTGCACCTG CAACTGGGCG ACCTCGATGA CCCGTGGAGC ATCTGGCTAA GTGTACGCAT GCGCGAATAC TTCAAGTCCA AGCAGGTCAA CCTGCTGTAT GTGAGCCCCG GTCCCGAGGC CCGGGTCATG CGCCTCTACA GCAGCAACCC CACCTCCCCC AACCTGCCCA AGACCATCCT TTCCAAGCTT GAGGCGCTCA ACCACGGGGA GCATCCGGAC ACCAACGAAC TGTGGCTCAC CGACCCGTCC ACGCAGACTT CGCAGCTGTA CATTTTCACC CGGCTCGACG AGCGCACCGA TGACTCCGGC TGGCTGGGCC TGGAAATGGA TGGGCGGGAA GTGCTCAAGG CCCTCAGCGA CCAGAGCGCC GGCGAGTTCA TGATGTTCAA CTCCGAAGGC GCGCTGCTGT TCACCAACAC CCCGGCCGGG CGCCTAGGGC AGGCCCTGCA ACAACTGCAA GGCAGCAACT TCTTCGGTTT CGTCGGCAGC CGCTGGTGGC CCGATCACCT GGTGATCCGC AAGCAACTGA TGACCTCCGA CTGGCAACTG GTCTACTCCT TCAGCCTGCA GTCGCTGCTG ATCGCGCTCT GGCCCCAGCT GGCCGGCGCG CTGGTGTTCT GCCTGTTCAG CATCAGCCTG ATCTGCCTGC TGACCCGCCG CATCGAGCAC CGCTTCATCA CTCCTGCGCT GAGCCGTATC CAGGCGCTGG TCGAGAGCGA GCTGTTCAGC CGCGACGTGA TCCAGACCGC GCCCGTAGCC TTGTGCGTGC TGCGGCGTAC CGATGGCCAG GTGGTCCTGG AAAACACCCT GGCGCAGCAG TGGCTGGGCG ACGGCATCGA ACGGGAAATA CTCTGCGCCG GCTGGATCCA GCAAGCCTTC AAGAGCCACG AGCCGAACCG TTTCGACTAC TTCGAGACCG CCGACGGGCG TCACCTTTAT CTGAGCTCCG TGCCCACCCG CTACAAGGGT GAAGACGTGT TGTTCTGCGC CTTCAGTGAC ATCGTAACCT GA 1412。
The concentration of F3 primer and B3 primer all is 5 μ M in described F3/B3 primer solution; The concentration of FIP primer and BIP primer all is 10 μ M in described FIP/BIP primer solution; The concentration of Y-LB primer is 10 μ M in the described Y-LB primer solution.
By the test kit that described Pseudomonas fluorescens LAMP detection reagent is formed, be made up of following component: positive control solution, negative controls, 10 * ThermoPol reaction buffer, concentration are that the MgCl2 solution of 25 mM, dNTP liquid, concentration that concentration is 10 mM are that the Bst DNA polysaccharase liquid of 8 U/μ L, F3/B3 primer solution that primer concentration all is 5 μ M, FIP/BIP primer solution, the primer concentration that primer concentration all is 10 μ M are Y-LB primer solution and the distilled water of 10 μ M.
In the test kit that above-mentioned Pseudomonas fluorescens LAMP detection reagent is formed, described 10 * ThermoPol reaction buffer is 250 μ L, described MgCl2 solution is 200 μ L, described dNTP liquid is 200 μ L, described Bst DNA polysaccharase liquid is 100 μ L, and described F3/B3 primer solution is 80 μ L, and described FIP/BIP primer solution is 160 μ L, described Y-LB primer solution is 80 μ L, and described distilled water is 1.5mL.
Compared with prior art, the invention has the advantages that Pseudomonas fluorescens LAMP detection reagent of the present invention is to construct above-mentioned amplification efficiency and good 5 F3, B3, Y-LB, FIP, the BIP primer of specificity, it is time-consuming to have overcome conventional PCR, to shortcomings such as equipment requirements height, reagent and the test kit be made up of these 5 Auele Specific Primers can carry out qualitative detection fast and accurately to the Pseudomonas fluorescens in the sample, have that specificity is good, simple to operation, visual result and an advantage such as with low cost.Concrete advantage is as follows:
1, the present invention compares with the detection reagent of conventional PCR, has special, responsive advantage; The key of LAMP technology is 5 special primers of 6～8 zone design at target gene, identifies fully under the situation of also mating the target sequence land when primer and could carry out smoothly, and this point has realized the high degree of specificity of this technology.
2, the present invention compares with the detection reagent of conventional PCR, and is simple to operate, need not expensive device.LAMP reaction only needs a simple thermostat water bath, does not need expensive PCR instrument, and is simple to operate, with low cost, is easy to operate at the scene or basic unit applies.
3, the present invention compares with the detection reagent of conventional PCR, has the short advantage of sense cycle.This method adopts a kind of Bst archaeal dna polymerase that has de-rotation function and be the waterfall type amplification, is constant-temperature amplification, does not need the time of PCR instrument heating and cooling, also need not the dna gel electrophoresis observation, so detection time is very short, amplification efficiency is very high.The sample detection time of conventional PCR is general more than 4 hours, and detection time of the present invention is about 1.5 h～2.5 h.
4, the present invention compares with the detection reagent of conventional PCR, the result need not complicated finishing sequences such as PCR electrophoresis, deposited phenomenon whether occurs according to reaction system, with the naked eye just can judge LAMP result by fast qualitative, have visual result, judge the little advantage of difficulty.
Embodiment
Describe in further detail below in conjunction with the present invention of embodiment.
1, design primer: selecting the cDNA of Pseudomonas fluorescens is target, uses PRIMEREXPLORER V4 software, design primer (comprising described 5 F3, B3, Y-LB, FIP, BIP), and the synthetic of primer finished by the living worker's biotechnology in Shanghai company limited.With the comparison of primer and target, conventional shaker test and analysis obtain 5 primers of special, responsive, stable above-mentioned F3, B3, Y-LB, FIP, BIP; 5 primers that design is synthetic are determined the reaction conditions that amplification efficiency and specificity are best after carrying out reaction times and temperature optimization experiment.
2, temperature of reaction optimization: design gradient LAMP response procedures, temperature of reaction is followed successively by: 61 ℃, 63 ℃, 65 ℃, optimization is optimal reaction temperature for 63 ℃ in this several temperature.
3, suitable Mg
2+Concentration is selected: the Mg in the reaction system
2+The addition of (2.5 mM) is followed successively by: 0 μ L, 2.0 μ L, 4.0 μ L, 6.0 μ L, optimization Mg in these several gradient concentrations
2+Addition is 2.0 μ L.
4, time gradient: design reaction times gradient LAMP response procedures, every pipe adds the LAMP system according to above-mentioned optimization system, and the reaction times is got 30 min respectively, 45 min, 60 min, 75 min, optimization optimum reacting time 60min.
5, reaction volume gradient: design reaction volume gradient LAMP response procedures is followed successively by: 12.5 μ L, 15.0 μ L, 17.5 μ L, 20.0 μ L, 22.5 μ L, 25 μ L, optimization 25 μ L reaction volumes in these several gradient volumes.
, specific detection: choose Pseudomonas fluorescens, bacillus pumilus, Bacillus licheniformis, subtilis, bacillus thuringiensis, other 6 kinds of common putrefactive bacteriums such as Wei Ershi listeria bacteria are used for the checking of LAMP specificity, and reaction system and condition are the same, the result has only Pseudomonas fluorescens positive, and blank and all the other 5 strains all are negative.
, sensitivity test: with Pseudomonas fluorescens reference culture GIM 1.209 with contain 10 times of doubling dilutions of plasmid of this bacterium specific fragment, get each extent of dilution and carry out LAMP and pcr amplification reaction, 2% agarose gel electrophoresis, the detection of LAMP method is limited to 3.47 copies/reaction, and the detection of PCR method is limited to 3.47 * 10
2Copy/reaction.The detection of bacterium LAMP method is limited to 4.3 bacterium/reactions, and the detection of PCR method is limited to 4.3 * 10
2Individual bacterium/reaction.
8, stability and replica test: in assessment LAMP detects group in the Pseudomonas fluorescens method and when the circulation ratio of test between group, stability, with positive and negative sample, under same reaction conditions, carrying out LAMP repeatedly detects, each sample of each test is done 6 parallel reaction tubess, repeat the result 12 times: the amplification sample parallel test positive findings of above-mentioned 5 primers is stable, good reproducibility.
9, to detection, simultaneous test and the proof test of sample: to aseptic large yellow croaker sample, infect large yellow croaker sample and the spoiling attack Shiva Salmonella of Pseudomonas fluorescens, bacillus pumilus, Bacillus licheniformis, subtilis, the fish sample of bacillus thuringiensis, extract dna profiling (concrete conventional extracting method is not described herein at this) and carry out the LAMP detection, the result shows that the large yellow croaker sample that infects Pseudomonas fluorescens is positive.
10, Pseudomonas fluorescens LAMP stdn reagent and trace routine:
10.1 stdn detection kit component
| Solution I | 80μL |
| Solution II | 80μL |
| Solution III | 250μL |
| Solution IV | 200μL |
| Solution V | 200μL |
| Solution VI | 160μL |
| Solution VII | 80μL |
| Solution VIII | 80μL |
| The solution IX | 100μL |
| The solution X | 1.5mL |
Note, solution I: positive control; Solution II: negative control: solution III: 10 * ThermoPol reaction buffer; Solution IV: MgCl2(concentration 25 mM); Solution V:dNTP(concentration 10 mM); Solution VI: primers F IP/BIP(concentration 10 μ M); Solution VII: primers F 3/B3(concentration 5 μ M); Solution VIII: primer Y-LB(concentration 10 μ M); Solution IX: Bst DNA polysaccharase (concentration 8 U/μ L); Solution X: distilled water 1.5mL; Primers F 3/B3, primers F IP/BIP and primer Y-LB are just for detecting the specific reagent of Pseudomonas fluorescens.ThermoPol reaction buffer, dNTP liquid, Bst DNA polysaccharase liquid are purchased the company in TaKaRa.
10.2 detection architecture:
| System is formed | Usage quantity (μ L) |
| Template | 1 |
| 10 * ThermoPol reaction buffer | 2.5 |
| MgCl 2（25 mM） | 2 |
| dNTP（10 mM） | 2 |
| FIP / BIP（10μM） | 1.6 |
| F3 / B3（5μM） | 0.8 |
| Y-LB（10μM） | 0.8 |
| Bst DNA polysaccharase (8 U/μ L) | 1 |
| Distilled water | 13.3 |
Template can be unknown DNA, positive control and negative control; Positive control: the plasmid that contains the special segment of Pseudomonas fluorescens; Negative control is distilled water; Examination criteria: have or not precipitation to generate.
10.3 working method
(1) gets 0.1～10 gram tissue sample, press the 1:10(gram: mL) add distilled water, fully grind homogenate, 2000 r/min, centrifugal 10 min.
(2) supernatant liquor 12000 r/min, centrifugal 20 min, precipitation adds 100 μ L distilled waters boils, 12000 r/min, 4 ℃, centrifugal 10 min, supernatant liquor is standby, is unknown dna profiling.
(3) get 200 μ L PCR reaction tubess, add following reactants in the reaction tubes:
| Detector tube (μ L) | Positive control (μ L) | Negative control (μ L) | |
| Positive control | / | 1 | / |
| Negative control | / | / | 1 |
| Unknown DNA | 1 | / | / |
| Solution III | 2.5 | 2.5 | 2.5 |
| Solution IV | 2 | 2 | 2 |
| Solution V | 2 | 2 | 2 |
| Solution VI | 1.6 | 1.6 | 1.6 |
| Solution VII | 0.8 | 0.8 | 0.8 |
| Solution VIII | 0.8 | 0.8 | 0.8 |
| The solution IX | 1 | 1 | 1 |
| The solution X | 13.3 | 13.3 | 13.3 |
Temperature of reaction is 63 ℃, reaction times 60min, and reaction finishes, and as if the same precipitation that produces with positive control, there is Pseudomonas fluorescens the place in this tissue sample so in the detector tube.
＜110〉University Of Ningbo
＜120〉Pseudomonas fluorescens LAMP detection reagent and test kit
<160> 6
<170> PatentIn version 3.1
<210>1
<211> 20
<212> DNA
＜213〉artificial sequence
<220>
＜223〉according to the Auele Specific Primer of the cDNA of Pseudomonas fluorescens design
<400>1
GCGCGAATAC TTCAAGTCCA 20
<210>2
<211> 19
<212> DNA
＜213〉artificial sequence
<220>
＜223〉according to the Auele Specific Primer of the cDNA of Pseudomonas fluorescens design
<400>2
GTACAGCTGC GAAGTCTGC 19
<210> 3
<211> 41
<212> DNA
＜213〉artificial sequence
<220>
＜223〉according to the Auele Specific Primer of the cDNA of Pseudomonas fluorescens design
<400>3
AGGTGGGGTT GCTGCTGTAG AGGTCAACCT GCTGTATGTG A 41
<210>4
<211> 40
<212> DNA
＜213〉artificial sequence
<220>
＜223〉according to the Auele Specific Primer of the cDNA of Pseudomonas fluorescens design
<400>4
TGCCCAAGAC CATCCTTTCC AAACAGTTCG TTGGTGTCCG 40
<210>5
<211> 17
<212> DNA
＜213〉artificial sequence
<220>
＜223〉according to the Auele Specific Primer of the cDNA of Pseudomonas fluorescens design
<400>5
TCAACCACGG GGAGCAT 17
<210>6
<211>1412
<212> DNA
＜213〉Pseudomonas fluorescens
<400>6
atgtcaaaag taaaagacaa agctggaagc ggcgaaatac cagcgacttt aaggatcgtc 60
ctatcccgga ttaaggaggg tttatttaga gtgggtccat gagattaagg acctaccttc 120
atcagatcag tcccgtattt tccagtcctg aagccgccag caggttgctg cgtctgttcg 180
cgctcattct tttggttggt atcctcggag ccgtctacaa cttcctcaac tccaccctca 240
gcaacgacat ttcccggcgc cgcggctaca tgagcagcgc catcgccgaa gcccagacct 300
tcttcaccag ccgcgaggcc ttgctggaaa gcctcagcct gtccgcggta cgccgctcca 360
agcaggccca ggccctggtg tacctgccct ccaccgaaga actgcacctg caactgggcg 420
acctcgatga cccgtggagc atctggctaa gtgtacgcat gcgcgaatac ttcaagtcca 480
agcaggtcaa cctgctgtat gtgagccccg gtcccgaggc ccgggtcatg cgcctctaca 540
gcagcaaccc cacctccccc aacctgccca agaccatcct ttccaagctt gaggcgctca 600
accacgggga gcatccggac accaacgaac tgtggctcac cgacccgtcc acgcagactt 660
cgcagctgta cattttcacc cggctcgacg agcgcaccga tgactccggc tggctgggcc 720
tggaaatgga tgggcgggaa gtgctcaagg ccctcagcga ccagagcgcc ggcgagttca 780
tgatgttcaa ctccgaaggc gcgctgctgt tcaccaacac cccggccggg cgcctagggc 840
aggccctgca acaactgcaa ggcagcaact tcttcggttt cgtcggcagc cgctggtggc 900
ccgatcacct ggtgatccgc aagcaactga tgacctccga ctggcaactg gtctactcct 960
tcagcctgca gtcgctgctg atcgcgctct ggccccagct ggccggcgcg ctggtgttct 1020
gcctgttcag catcagcctg atctgcctgc tgacccgccg catcgagcac cgcttcatca 1080
ctcctgcgct gagccgtatc caggcgctgg tcgagagcga gctgttcagc cgcgacgtga 1140
tccagaccgc gcccgtagcc ttgtgcgtgc tgcggcgtac cgatggccag gtggtcctgg 1200
aaaacaccct ggcgcagcag tggctgggcg acggcatcga acgggaaata ctctgcgccg 1260
gctggatcca gcaagccttc aagagccacg agccgaaccg tttcgactac ttcgagaccg 1320
ccgacgggcg tcacctttat ctgagctccg tgcccacccg ctacaagggt gaagacgtgt 1380
tgttctgcgc cttcagtgac atcgtaacct ga 1412
Claims (4)
1. Pseudomonas fluorescens LAMP detection reagent, comprise Auele Specific Primer solution, described Auele Specific Primer solution is F3/B3 primer solution, FIP/BIP primer solution and Y-LB primer solution, it is characterized in that described F3/ B3 primer solution contains the Auele Specific Primer that sequence is F3:GCGCGAATAC TTCAAGTCCA, B3:GTACAGCTGC GAAGTCTGC; FIP/BIP primer solution contains the Auele Specific Primer that sequence is FIP:AGGTGGGGTT GCTGCTGTAG AGGTCAACCT GCTGTATGTG A, BIP:TGCCCAAGAC CATCCTTTCC AAACAGTTCG TTGGTGTCCG; The Y-LB primer solution contains sequence: the Auele Specific Primer of TCAACCACGG GGAGCAT.
2. Pseudomonas fluorescens LAMP detection reagent as claimed in claim 1 is characterized in that the concentration of F3 primer and B3 primer all is 5 μ M in the described F3/B3 primer solution; The concentration of FIP primer and BIP primer all is 10 μ M in the described FIP/BIP primer solution; The concentration of Y-LB primer is 10 μ M in the described Y-LB primer solution.
3. the test kit of being made up of the described Pseudomonas fluorescens LAMP of claim 1 detection reagent, it is characterized in that being made up of following component: positive control solution, negative controls, 10 * ThermoPol reaction buffer, concentration are the MgCl of 25 mM
2Solution, concentration are that dNTP liquid, the concentration of 10mM is that the Bst DNA polysaccharase liquid of 8U/μ L, F3/B3 primer solution that primer concentration all is 5 μ M, FIP/BIP primer solution, the primer concentration that primer concentration all is 10 μ M are Y-LB primer solution and the distilled water of 10 μ M.
4. the test kit of Pseudomonas fluorescens LAMP detection reagent composition as claimed in claim 3 is characterized in that described 10 * ThermoPol reaction buffer is 250 μ L, described MgCl
2Solution is 200 μ L, and described dNTP liquid is 200 μ L, and described Bst DNA polysaccharase liquid is 100 μ L, described F3/B3 primer solution is 80 μ L, described FIP/BIP primer solution is 160 μ L, and described Y-LB primer solution is 80 μ L, and described distilled water is 1.5mL.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110321179 CN102382879B (en) | 2011-10-21 | 2011-10-21 | Pseudomonas fluorescens LAMP (loop-mediated isothermal amplification) detection agent and kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110321179 CN102382879B (en) | 2011-10-21 | 2011-10-21 | Pseudomonas fluorescens LAMP (loop-mediated isothermal amplification) detection agent and kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102382879A CN102382879A (en) | 2012-03-21 |
| CN102382879B true CN102382879B (en) | 2013-09-04 |
Family
ID=45822708
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110321179 Expired - Fee Related CN102382879B (en) | 2011-10-21 | 2011-10-21 | Pseudomonas fluorescens LAMP (loop-mediated isothermal amplification) detection agent and kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102382879B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106498046A (en) * | 2016-10-19 | 2017-03-15 | 光明乳业股份有限公司 | For the PCR primer of amplification fluorescent pseudomonass gene, the detection method of pseudomonas fluorescens and test kit |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103045742B (en) * | 2012-12-27 | 2014-05-28 | 西北农林科技大学 | Method for detecting Pseudomonas syringae causing kiwi canker by loop-mediated isothermal amplification |
| CN105385773B (en) * | 2015-12-24 | 2019-01-29 | 光明乳业股份有限公司 | A kind of method detecting Pseudomonas fluorescens and its kit and primer |
| CN106086207A (en) * | 2016-07-26 | 2016-11-09 | 广东省农业科学院植物保护研究所 | A kind of primer sets utilizing LAMP technology detection Pseudomonas cichorii and test kit and method |
| CN107746898A (en) * | 2017-11-06 | 2018-03-02 | 北京市水产技术推广站 | A kind of detection kit and detection method for detecting carp edema virus |
| CN108048582A (en) * | 2017-11-29 | 2018-05-18 | 中国海洋大学 | The Pseudomonas fluorescens method of thermophilic protease is produced in a kind of quantitative quick detection raw milk using LAMP primer group |
| CN110923341B (en) * | 2019-12-10 | 2022-09-09 | 天津农学院 | LAMP (loop-mediated isothermal amplification) detection method for Shewanella alga pathogenic bacteria of cultured fishes and application |
| CN113234843A (en) * | 2021-06-30 | 2021-08-10 | 中国海洋大学 | LAMP primer group for detecting pseudomonas fluorescens producing heat-resistant protease in raw milk and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1877328A (en) * | 2006-07-12 | 2006-12-13 | 南开大学 | Method for detecting aquatic animal pathogenic bacteria by using 23S ribosome gene probe array |
| CN102080127A (en) * | 2010-09-06 | 2011-06-01 | 广州阳普医疗科技股份有限公司 | Gene chip for detecting 15 clinical common pathogenic microorganisms |
| CN102134601A (en) * | 2010-12-30 | 2011-07-27 | 广东省微生物研究所 | Loop-mediated isothermal amplification detection primer pair of Pseudomonas aeruginosa, detection method and detection kit |
-
2011
- 2011-10-21 CN CN 201110321179 patent/CN102382879B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1877328A (en) * | 2006-07-12 | 2006-12-13 | 南开大学 | Method for detecting aquatic animal pathogenic bacteria by using 23S ribosome gene probe array |
| CN102080127A (en) * | 2010-09-06 | 2011-06-01 | 广州阳普医疗科技股份有限公司 | Gene chip for detecting 15 clinical common pathogenic microorganisms |
| CN102134601A (en) * | 2010-12-30 | 2011-07-27 | 广东省微生物研究所 | Loop-mediated isothermal amplification detection primer pair of Pseudomonas aeruginosa, detection method and detection kit |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106498046A (en) * | 2016-10-19 | 2017-03-15 | 光明乳业股份有限公司 | For the PCR primer of amplification fluorescent pseudomonass gene, the detection method of pseudomonas fluorescens and test kit |
| CN106498046B (en) * | 2016-10-19 | 2019-07-02 | 光明乳业股份有限公司 | For the PCR primer of amplification fluorescent pseudomonad gene, the detection method of Pseudomonas fluorescens and kit |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102382879A (en) | 2012-03-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102382879B (en) | Pseudomonas fluorescens LAMP (loop-mediated isothermal amplification) detection agent and kit | |
| CN111041116B (en) | Nucleic acid rapid constant temperature detection method and kit for vibrio vulnificus | |
| CN102605055B (en) | Multiplex quantitative PCR (polymerase chain reaction) detection kit for vibrio parahaemolyticus and detection method | |
| CN103320434A (en) | Salmonella LAMP (loop-mediated isothermal amplification) primer group and kit and detection method | |
| CN106434917A (en) | LAMP primer group and detection kit for staphylococcus aureus and use method of detection kit | |
| CN102586438A (en) | LAMP-based (loop-mediated isothermal amplification-based) visual fluorogenic and chromogenic genetic testing method for microorganisms | |
| CN102134590A (en) | Fast detection method for clostridium perfringens, detection primer group and detection kit | |
| Šimenc et al. | Rapid differentiation of bacterial species by high resolution melting curve analysis | |
| CN102094090B (en) | Cholera toxin virulence gene detection kit and detection method thereof | |
| CN110734994A (en) | Specific primer pair, probe and detection kit for detecting aeromonas hydrophila | |
| CN111154900B (en) | Pseudomonas aeruginosa specific new molecular target and rapid detection method thereof | |
| CN113462798A (en) | LAMP primer and method for rapidly detecting staphylococcus aureus, salmonella or/and shigella | |
| CN101368203A (en) | Primer, reagent kit and detection method for monotonic increasing Listeria hymenial veil mediated isothermality amplification technique fast detection | |
| CN102827928B (en) | Rapid diagnosis method for plesimonas shigelloides | |
| CN108004334B (en) | Quadruple fluorescent PCR primer group, probe group, kit and method for detecting four pathogenic bacteria in drinking water | |
| CN101875967B (en) | Method for quickly testing food-borne pathogenic bacteria | |
| CN111088377B (en) | Rapid constant temperature detection method for staphylococcus aureus, primer set and application | |
| CN110257541B (en) | CAMP detection primer group and kit for enterotoxin gene of bacillus cereus | |
| CN110951904B (en) | LAMP primer group, kit and detection method for IMP drug resistance gene of carbapenem antibiotics | |
| CN102719431A (en) | Primer sequence for detecting tetracycline resistant gene tetB in sludge and method | |
| CN106434900A (en) | Method for conducting rapid constant-temperature detection on vibrio vulnificus and vibrio cholerae simultaneously, primer and kit | |
| CN108018365A (en) | A kind of absolute quantitation detects the kit and detection method of total comma bacillus and pathogenic comma bacillus | |
| KR102009326B1 (en) | DEVELOPMENT OF SINGLEPLEX REAL-TIME PCR KIT FOR RAPID DETECTION OF CLOSTRIDIUM PERFRINGENS USING cpa, cpe TARGET GENE | |
| CN101979660A (en) | Brucella detection kit and using method thereof | |
| Lin et al. | Development and use of a chromogenic macroarray system for the detection of Staphylococcus aureus with enterotoxin A, B, C, D, E, and G genes in food and milk samples |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C41 | Transfer of patent application or patent right or utility model | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20170116 Address after: 315336 Ningbo Binhai New Area, Hangzhou, Binhai Road, No. four, No. 499, No. Patentee after: Zhejiang Power Technology Co., Ltd. Address before: 315211 Zhejiang Province, Ningbo Jiangbei District Fenghua Road No. 818 Patentee before: Ningbo Univ. |
|
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130904 Termination date: 20191021 |