CN103045742B - Method for detecting Pseudomonas syringae causing kiwi canker by loop-mediated isothermal amplification - Google Patents

Method for detecting Pseudomonas syringae causing kiwi canker by loop-mediated isothermal amplification Download PDF

Info

Publication number
CN103045742B
CN103045742B CN201210579896.4A CN201210579896A CN103045742B CN 103045742 B CN103045742 B CN 103045742B CN 201210579896 A CN201210579896 A CN 201210579896A CN 103045742 B CN103045742 B CN 103045742B
Authority
CN
China
Prior art keywords
seq
primer
prospect
lamp reaction
bacterial canker
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201210579896.4A
Other languages
Chinese (zh)
Other versions
CN103045742A (en
Inventor
赵磊
郝兴安
樊红科
吴云锋
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Northwest A&F University
Original Assignee
Northwest A&F University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Northwest A&F University filed Critical Northwest A&F University
Priority to CN201210579896.4A priority Critical patent/CN103045742B/en
Publication of CN103045742A publication Critical patent/CN103045742A/en
Application granted granted Critical
Publication of CN103045742B publication Critical patent/CN103045742B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a method for detecting Pseudomonas syringae causing kiwi canker by loop-mediated isothermal amplification (LAMP), wherein the method comprises the following steps: extracting DNA of Pseudomonas syringae and performing LAMP and real-time turbidity detection. In the LAMP, six primers shown as SEQ ID NO.1-6 are used, and the screening and detection of Pseudomonas syringae causing kiwi canker is at the molecular level, wherein Pseudomonas syringae causing kiwi canker is derived from the Shaanxi Province. The LAMP primers are designed according to the ITS gene of Pseudomonas syringae causing kiwi canker, and the method of detecting Pseudomonas syringae causing kiwi canker is rapid, sensitive and highly-specific by use of the LAMP techniques. The method provides a new approach to rapid detection of Pseudomonas syringae causing kiwi canker.

Description

Adopt loop-mediated isothermal amplification technique to detect the method for Prospect on Kiwifruit Bacterial Canker bacterium
Technical field
The invention belongs to phytobacteriology technical field, particularly relate to a kind of method of employing loop-mediated isothermal amplification technique detection Prospect on Kiwifruit Bacterial Canker bacterium.
Background technology
China is the major production areas of Kiwifruit, first of its cultivated area and the output Jun Ju world.The Kiwifruit output in Shaanxi Province especially position ranks first in the whole country.Prospect on Kiwifruit Bacterial Canker has generation in various degree in the each large producing region of China's Kiwifruit, and the production of serious threat Kiwifruit is listed in Forest Plant Quarantine object.This disease breaks with tremendous force, and is a kind of destructive disease, not only lowers output when generation, and causes pericarp thickening, fruity souring, and fruit diminishes, and fruit shape is differed, and quality declines, and commodity value reduces, and causes serious financial loss.
Serious and the control difficulty of the harm of Prospect on Kiwifruit Bacterial Canker is that Kiwifruit is produced and a theoretic major issue always.Be difficult at present find a kind of effectively preventing medicine.The method of the detection Prospect on Kiwifruit Bacterial Canker bacterium generally adopting at present mainly contains serological method, electron microscopy and molecular Biological Detection etc.But aforesaid method all exists different shortcomings, for example, length, complex operation, sensitivity were not high, specificity is not strong, accuracy is lower the required test period, be subject to test material restriction etc.
Ring mediated isothermal nucleic acid amplification (Loop-mediated i sothermalmplification, LAMP) technology is a kind of novel nucleic acids amplification technique of being invented by T.Notomi, this technology relies on four special primers and a kind of archaeal dna polymerase with strand displacement characteristic, under isothermal condition fast, efficient, high special, amplified target sequence (Notomietal, 2000) with sensitivity.Set up so far the LAMP detection method for multiple pathogenic bacteria, virus, fungi, parasite etc., also had relevant report at aspects such as drug resistance gene detection, the judgements of domestic animal early embryo sex.The method has wide range of applications, and is suitable for laboratories and carries out rapid detection.The present invention according to Prospect on Kiwifruit Bacterial Canker bacterium 16S gene design LAMP primer, adopt loop-mediated isothermal amplification technique (LAMP) to set up a kind of method of detection Prospect on Kiwifruit Bacterial Canker bacterium of quick, sensitive, high special.For the rapid detection of Prospect on Kiwifruit Bacterial Canker provides new means.
Summary of the invention
For solving the problems of the technologies described above, the invention provides a kind of method that adopts loop-mediated isothermal amplification technique to detect Prospect on Kiwifruit Bacterial Canker bacterium, wherein the method comprises the extraction of Prospect on Kiwifruit Bacterial Canker bacterium DNA, LAMP reaction and in real time turbidity detect, from molecular level, Prospect on Kiwifruit Bacterial Canker bacterium is carried out to examination and detection, described LAMP reaction adopts any pair of primers group in following three pairs of primers:
Outer primer (F3 and B3):
SEQID?NO.1：5’-CCGATTTTGGGTCTGTAGCT-3’；
SEQID?NO.2：5’-GTAAGTGGTGGAGCCAAGC-3’；
Inner primer (FIP and BIP):
SEQID NO.3:5 '-CGCGCTCTGACCAACTTCACCACCCCTGATAAGGGTGAGG-3 '; SEQID NO.4:5 '-TACGACACCCGGATACGGGGATCGAACCGCTGACCTCC-3 '; Ring primer (LF and LB):
SEQID?NO.5：5’-GGCAGATTCGAACTGCCGA-3’；
SEQID?NO.6：5’-CCATAGCTCAGCTGGGAGA-3’。
Preferably, in aforesaid method, described LAMP reaction adopts above-mentioned whole 3 pairs of primer sets, i.e. six primers, SEQID NO.1-6.
In a specific embodiment, employing loop-mediated isothermal amplification technique of the present invention detects the method for Prospect on Kiwifruit Bacterial Canker bacterium, and it comprises the steps:
1) extraction of the total DNA of ulcer bacteria:
Extract total DNA of Prospect on Kiwifruit Bacterial Canker bacterium;
2) LAMP reaction:
Use outer primer SEQ ID NO.1-2, inner primer SEQ ID NO.3-4 and ring primer SEQ IDNO.5-6 to carry out LAMP reaction to the total DNA of ulcer bacteria, obtain amplified production;
3) turbidity detects:
Amplified production is carried out to turbidity observation, determine whether Kiwifruit infects described ulcer bacteria.
In a specific embodiment, employing loop-mediated isothermal amplification technique of the present invention detects the method for Prospect on Kiwifruit Bacterial Canker bacterium, and it comprises the steps:
1) cultivation of ulcer bacteria:
Prospect on Kiwifruit Bacterial Canker bacterium, in liquid LB substratum, is cultivated 12 hours under 26 ℃ of conditions, gets this liquid of 0.5 microlitre and is directly used in detection;
2) LAMP reaction:
Use outer primer SEQ ID NO.1-2, inner primer SEQ ID NO.3-4 and ring primer SEQ IDNO.5-6 to carry out LAMP reaction to the DNA of ulcer bacteria, obtain amplified production;
3) turbidity detects:
Amplified production is carried out to turbidity observation, determine whether Kiwifruit infects described ulcer bacteria.
In a specific embodiment, in the above-mentioned method of the present invention, the primer concentration ratio using in LAMP reaction is: outer primer SEQ ID NO.1-2: inner primer SEQ ID NO.3-4: ring primer SEQ ID NO.5-6=1: 8: 4;
In a specific embodiment, in the above-mentioned method of the present invention, the temperature of reaction in LAMP reaction is preferably 64 ℃;
In a specific embodiment, in the above-mentioned method of the present invention, the Mg in LAMP reaction 2+concentration is preferably 6mM.
The harm of Prospect on Kiwifruit Bacterial Canker bacterium is serious, and the present invention, through optimizing and groping experiment condition and set up the method that detects Prospect on Kiwifruit Bacterial Canker bacterium, greatly improves detection efficiency, reduces testing cost.The features such as that method of the present invention has is quick, sensitive, high degree of specificity.Method of the present invention has successfully been applied to indoor and detection field Prospect on Kiwifruit Bacterial Canker fungus diseases.The present invention has proved that LAMP is a kind of effective means that detects plant ulcer bacteria.
Accompanying drawing explanation
Fig. 1: LAMP result turbidity is observed, 1: the positive, 2: feminine gender;
Fig. 2 A:LAMP reaction optimum temps is 64 ℃;
It is 6mM that Fig. 2 B:LAMP reacts best Mg2+ concentration;
It is 0.8mM that Fig. 2 C:LAMP reacts best DNTPS concentration;
It is 0mM that Fig. 2 D:LAMP reacts best betaine concentration;
Embodiment
In order to understand the present invention, further illustrate the present invention with embodiment below, but do not limit the present invention.
In order to understand the present invention, further illustrate the present invention with embodiment below, but following embodiment does not limit the present invention.
material and reagent
Chinese goosebeery healthy branch, infects the branch of ulcer bacteria and picks up from respectively the ground such as Shaanxi, China Yang Ling, thoughtful, Mei County, Qishan, gathers branch and is stored in 4 ℃ of refrigerators.
Main agents:
Bst DNApolymerase is purchased from NEB company;
Betaine, MgSO4 is purchased from Sigma company;
Taq archaeal dna polymerase is purchased from TaKaRa company;
Intestinal bacteria (Escherichia.coli) JM109, DNA standard Marker1 is purchased from Voson company;
Glue reclaims test kit purchased from Bioteke company.
embodiment 1
1. design of primers
First the inventor has downloaded the ITS gene order of Prospect on Kiwifruit Bacterial Canker bacterium from NCBI, use Primer4.0 (http://primerexplorer.jp/e/v4_manual/index.html) to design many groups primer, then selected every kind of viral primer according to composite factors such as the hairpin structure of the conservative property of primer place sequence area, primer, dimer GC content and Tm values.Finally select 6 primers for Prospect on Kiwifruit Bacterial Canker bacterium, comprised 2 outer primers (F3 and B3), 2 inner primers (FIP and BIP) and two ring primers (LF and LB).Described primer is referring to SEQ IDNO.1-6.The information of primer is in table 1.
The information of table 1 primer sequence SEQ IDNO.1-6:
Primer title Sequence number Sequence 5 '-3 '
Psa-F3 SEQ?ID?NO.1 CCGATTTTGGGTCTGTAGCT
Psa-B3 SEQ?ID?NO.2 GTAAGTGGTGGAGCCAAGC
Psa-FIP SEQ?ID?NO.3 CGCGCTCTGACCAACTTCACCACCCCTGATAAGGGTGAGG
Psa-BIP SEQ?ID?NO.4 TACGACACCCGGATACGGGGATCGAACCGCTGACCTCC
Psa-LF SEQ?ID?NO.5 GGCAGATTCGAACTGCCGA
Psa-LB SEQ?ID?NO.6 CCATAGCTCAGCTGGGAGA
2, DNA extracting
Use DNA rapid extraction test kit (centrifugal cylindricality) (Bioteke), according to operation instructions, extract respectively total DNA of diseased plant sample and healthy sample, be finally dissolved in 40 μ l elution buffers, be stored in-80 ℃ of refrigerators.
3, LAMP reaction system
(25 μ are l) as follows: 10 × ThermoPol damping fluid, 2.5 μ l (20mMTris-HCl, 10mM KCl, 2mM MgSO for reaction system 4, 10mM (NH 4) 2sO 4, 0.1%Triton X-100), primer (F3 and B3) 0.2 μ M, primer (FIP and BIP) 1.6 μ M, dNTPs1.75mM, MgSO 46mM, betaine1M, Bst DNApolymerase (NEB) 8u, template DNA 1 μ l.Reaction conditions is: 64 ℃ of constant temperature 1h.
Reaction result is analyzed by the method directly detecting by an unaided eye, positive findings muddiness, negative clarification.Result is referring to Fig. 1.
By the condition in embodiment 1 is changed, obtain best temperature of reaction, Mg2+ concentration, DNTPS concentration, betaine concentration etc., result is referring to Fig. 2 A to Fig. 2 D.
embodiment 2, PCR and LAMP method detect field sample:
The molecular detecting method of Prospect on Kiwifruit Bacterial Canker bacterium is also less at present, three pairs of primers with reference to Rees-George etc. have detected multiple fields sample by method and two kinds of methods of LAMP of PCR order-checking, the detected result difference of two kinds of methods of result is very large, and LAMP method is significantly high more a lot of than the specificity of PCR method and accuracy.
LAMP detection method does not need expensive plant and instrument, schedule of operation simple, and have rapidly and efficiently, the feature of high specific, high sensitivity, its range of application is more and more extensive, in the pathogenic microorganism examination, give play to great advantage, and be successfully applied in the correlative study of oncogene.Detected multiple fields diseased plant sample by the method for LAMP method and the PCR order-checking of describing in this experiment, it is much high that the specificity of LAMP method and accuracy are wanted simultaneously.
In a word, the present invention has set up the method for a set of quick, easy, special, sensitive detection Prospect on Kiwifruit Bacterial Canker bacterium.Therefore, have reason to believe that LAMP, as the molecular biological method for quick of one, will have more wide application prospect.
Method of the present invention is described by specific embodiment.Those skilled in the art can use for reference the links such as content appropriate change raw material of the present invention, processing condition and realize corresponding other object, its relevant change does not all depart from content of the present invention, within all similar replacements and change will become apparent to those skilled in the art that and be all deemed to be included in scope of the present invention.
Reference
1B.Bekelea，J.Hodgettsb，J.Tomlinsonb，N.Boonhamb，P.Nikolic，P.Swarbrick?and?M.Dickinsond，Use?of?a?real-time?LAMP?isothermal?assay?for?detecting16SrII?and?XII?phytoplasmas?in?fruit?and?weeds?of?the?Ethiopian?Rift?Valley，Plant?Pathology，2011，60，345-355
2J.Rees-Georgea，J.L.Vannesteb，D.A.Cornishb，I.P.S.Pushparajaha，?J.Yub，M.D.Templetona?and?K.R.Everett.Detection?ofPseudomonas?syringae?pv.actinidiae?using?polymerase?chain?reaction(PCR)primers?based?on?the16S-23S?rDNA?intertranscribed?spacer?region?and?comparison?with?PCR?primers?based?on?other?gene?regions.Plant?Pathology，2010，59，453-464；
3Notomi?T，Okayama?H，Masubuchi?H，et?al.Loop-mediated?isothermal?amplification?of?DNA[J].Nucl?Acids?Res，2000，28(12)：63；
4 hold river unit, Li Yao, and Wan Sisi, Zhang Jian, Pang Qing, Lee fruit, Xing Jiahua, Anhui Province claims monkey peach ulcer bacteria to identify.Agricultural University Of Anhui's journal, 1995,22 (3): 219-223;
5 Song block Wei, Wang Xingyun, Zhang Rongyi, the application of PCR correlation technique in plant pathogenetic bacteria detects and identifies, Guangxi tropical agriculture, the 4th phase in 2006 (total the 105th phase)
6 Yin Yan girls, Huang Yanxia, Ge Yunying, Guo Jian, several conventional plant pathogenetic bacteria molecular detecting methods of China, plant protection, 2006, the 32 the 6th phases of volume
Figure IDA00002796675400011
Figure IDA00002796675400031

Claims (2)

1. a method that adopts loop-mediated isothermal amplification technique to detect Prospect on Kiwifruit Bacterial Canker bacterium, wherein the method comprises the extraction of Prospect on Kiwifruit Bacterial Canker bacterium DNA, LAMP reaction and in real time turbidity detect, from molecular level, Prospect on Kiwifruit Bacterial Canker bacterium is carried out to examination and detection, described LAMP reaction adopts following six primer SEQ ID NO.1-6:
Outer primer (F3 and B3):
SEQ?ID?NO.1：5’-CCGATTTTGGGTCTGTAGCT-3’；
SEQ?ID?NO.2：5’-GTAAGTGGTGGAGCCAAGC-3’；
Inner primer (FIP and BIP):
SEQ?ID?NO.3：5’-CGCGCTCTGACCAACTTCACCACCCCTGATAAGGGTGAGG-3’；
SEQ?ID?NO.4：5’-TACGACACCCGGATACGGGGATCGAACCGCTGACCTCC-3’；
Ring primer (LF and LB):
SEQ?ID?NO.5：5’-GGCAGATTCGAACTGCCGA-3’；
SEQ?ID?NO.6：5’-CCATAGCTCAGCTGGGAGA-3’；
The method that described employing loop-mediated isothermal amplification technique detects Prospect on Kiwifruit Bacterial Canker bacterium comprises the steps:
1) extraction of the total DNA of ulcer bacteria:
Extract total DNA of Prospect on Kiwifruit Bacterial Canker bacterium;
2) LAMP reaction:
Use outer primer SEQ ID NO.1-2, inner primer SEQ ID NO.3-4 and ring primer SEQ IDNO.5-6 to carry out LAMP reaction to the total DNA of ulcer bacteria, obtain amplified production;
3) turbidity detects:
Amplified production is carried out to turbidity observation, determine whether Kiwifruit infects described ulcer bacteria;
The primer concentration ratio wherein using in LAMP reaction is: outer primer SEQ ID NO.1-2: inner primer SEQ ID NO.3-4: ring primer SEQ ID NO.5-6=1: 8: 4;
Wherein the temperature of reaction in LAMP reaction is 64 ℃;
The wherein Mg in LAMP reaction 2+concentration is 6mM.
2. a method that adopts loop-mediated isothermal amplification technique to detect Prospect on Kiwifruit Bacterial Canker bacterium, wherein the method comprises the extraction of Prospect on Kiwifruit Bacterial Canker bacterium DNA, LAMP reaction and in real time turbidity detect, from molecular level, Prospect on Kiwifruit Bacterial Canker bacterium is carried out to examination and detection, described LAMP reaction adopts following six primer SEQ ID NO.1-6:
Outer primer (F3 and B3):
SEQ?ID?NO.1：5’-CCGATTTTGGGTCTGTAGCT-3’；
SEQ?ID?NO.2：5’-GTAAGTGGTGGAGCCAAGC-3’；
Inner primer (FIP and BIP):
SEQ?ID?NO.3：5’-CGCGCTCTGACCAACTTCACCACCCCTGATAAGGGTGAGG-3’；
SEQ?ID?NO.4：5’-TACGACACCCGGATACGGGGATCGAACCGCTGACCTCC-3’；
Ring primer (LF and LB):
SEQ?ID?NO.5：5’-GGCAGATTCGAACTGCCGA-3’；
SEQ?ID?NO.6：5’-CCATAGCTCAGCTGGGAGA-3’；
1) cultivation of ulcer bacteria:
Prospect on Kiwifruit Bacterial Canker bacterium, in liquid LB substratum, is cultivated 12 hours under 26 ℃ of conditions, gets this liquid of 0.5 microlitre and is directly used in detection;
2) LAMP reaction:
Use outer primer SEQ ID NO.1-2, inner primer SEQ ID NO.3-4 and ring primer SEQ IDNO.5-6 to carry out LAMP reaction to the DNA of ulcer bacteria, obtain amplified production;
3) turbidity detects:
Amplified production is carried out to turbidity observation, determine whether Kiwifruit infects described ulcer bacteria;
The primer concentration ratio wherein using in LAMP reaction is: outer primer SEQ ID NO.1-2: inner primer SEQ ID NO.3-4: ring primer SEQ ID NO.5-6=1: 8: 4;
Wherein the temperature of reaction in LAMP reaction is 64 ℃;
The wherein Mg in LAMP reaction 2+concentration is 6mM.
CN201210579896.4A 2012-12-27 2012-12-27 Method for detecting Pseudomonas syringae causing kiwi canker by loop-mediated isothermal amplification Expired - Fee Related CN103045742B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201210579896.4A CN103045742B (en) 2012-12-27 2012-12-27 Method for detecting Pseudomonas syringae causing kiwi canker by loop-mediated isothermal amplification

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201210579896.4A CN103045742B (en) 2012-12-27 2012-12-27 Method for detecting Pseudomonas syringae causing kiwi canker by loop-mediated isothermal amplification

Publications (2)

Publication Number Publication Date
CN103045742A CN103045742A (en) 2013-04-17
CN103045742B true CN103045742B (en) 2014-05-28

Family

ID=48058602

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201210579896.4A Expired - Fee Related CN103045742B (en) 2012-12-27 2012-12-27 Method for detecting Pseudomonas syringae causing kiwi canker by loop-mediated isothermal amplification

Country Status (1)

Country Link
CN (1) CN103045742B (en)

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104513853B (en) * 2014-07-02 2016-09-28 华中农业大学 The Fields detection test kit of Fructus Persicae brown rot fungus anti-DMI series bactericidal agent
CN104762409A (en) * 2015-04-30 2015-07-08 四川农业大学 Method for detecting pseudomonas syringaepv altinidia through recombinase-mediated isothermal amplification technology
CN105296393A (en) * 2015-11-03 2016-02-03 中国科学院武汉植物园 Method for rapidly identifying kiwi fruit canker susceptible sample
CN105779608A (en) * 2016-04-13 2016-07-20 重庆三峡学院 Living pseudomonas syringae pv.actinidiae detection method
CN107326081B (en) * 2017-07-26 2020-12-04 中国农业科学院特产研究所 Identification method of kiwi fruit germplasm resources and application thereof
CN107828905A (en) * 2017-12-18 2018-03-23 福建省农业科学院植物保护研究所 Tobacco smoke pollution LAMP detection primer and detection method
CN113832255B (en) * 2020-06-08 2023-07-14 西北农林科技大学 Primer group and kit for RT-PCR detection of 4 novel kiwi fruit viruses
CN114752700A (en) * 2022-04-24 2022-07-15 西北农林科技大学 LAMP primer for visual detection of black spot pathogen of kiwi fruit and detection method thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102382879A (en) * 2011-10-21 2012-03-21 宁波大学 Pseudomonas fluorescens LAMP (loop-mediated isothermal amplification) detection agent and kit

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP4701407B2 (en) * 2007-03-10 2011-06-15 石川県 Detection Method of Rice Seedling Bacterial Bacterial Bacteria and Rice Blast Bacteria Bacteria Using LAMP Method

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102382879A (en) * 2011-10-21 2012-03-21 宁波大学 Pseudomonas fluorescens LAMP (loop-mediated isothermal amplification) detection agent and kit

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Detection of Pseudomonas syringae pv. actinidiae using polymerase chain reaction (PCR) primers based on the 16S-23S rDNA intertranscribed spacer region and comparison with PCR primers based on other gene regions.;REES-GEORGE J.等;《Plant pathology》;20101231;第59卷(第3期);摘要 *
JP特开2008-220228A 2006.09.25
REES-GEORGE J.等.Detection of Pseudomonas syringae pv. actinidiae using polymerase chain reaction (PCR) primers based on the 16S-23S rDNA intertranscribed spacer region and comparison with PCR primers based on other gene regions..《Plant pathology》.2010,第59卷(第3期),第453页.

Also Published As

Publication number Publication date
CN103045742A (en) 2013-04-17

Similar Documents

Publication Publication Date Title
CN103045742B (en) Method for detecting Pseudomonas syringae causing kiwi canker by loop-mediated isothermal amplification
Rees‐George et al. Detection of Pseudomonas syringae pv. actinidiae using polymerase chain reaction (PCR) primers based on the 16S–23S rDNA intertranscribed spacer region and comparison with PCR primers based on other gene regions
CN102286637B (en) Method for detecting tobacco viruses by reverse transcriptase loop-mediated isothermal amplification (RT-LAMP) technology
Sagar et al. Potato bacterial wilt in India caused by strains of phylotype I, II and IV of Ralstonia solanacearum
Hansen et al. Loop‐mediated isothermal amplification for detection of the tomato and potato late blight pathogen, Phytophthora infestans
Araújo et al. Simultaneous detection and identification of the Xanthomonas species complex associated with tomato bacterial spot using species‐specific primers and multiplex PCR
Chen et al. Development of a loop-mediated isothermal amplification (LAMP) assay for rapid detection of Pseudomonas syringae pv. tomato in planta
Chen et al. Development and evaluation of specific PCR and LAMP assays for the rapid detection of Phytophthora melonis
Fulbright et al. Molecular diagnostics for monitoring contaminants in algal cultivation
Huang et al. Loop-mediated isothermal amplification method for the rapid detection of Ralstonia solanacearum phylotype I mulberry strains in China
Li et al. Specific and sensitive detection of Phytophthora nicotianae by nested PCR and loop‐mediated isothermal amplification assays
Fasusi et al. Propagation and characterization of viable arbuscular mycorrhizal fungal spores within maize plant (Zea mays L.)
Dobhal et al. Development of a loop‐mediated isothermal amplification assay for specific detection of all known subspecies of Clavibacter michiganensis
Rohini et al. Isolation and characterization of Ralstonia solanacearum causing bacterial wilt of solanaceae crops
Nie et al. Application of hyper-branched rolling circle amplification (HRCA) and HRCA-based strip test for the detection of Chattonella marina
Shen et al. Development of a loop‐mediated isothermal amplification assay for rapid and sensitive detection of Sporisorium scitamineum in sugarcane
Robene-Soustrade et al. Multiplex nested PCR for detection of Xanthomonas axonopodis pv. allii from onion seeds
Bhat et al. Specific detection of Phytophthora cactorum in diseased strawberry plants using nested polymerase chain reaction
Andersen et al. Highly specific assays to detect isolates of Pseudomonas syringae pv. actinidiae biovar 3 and Pseudomonas syringae pv. actinidifoliorum directly from plant material
Li et al. A comprehensive comparison of assays for detection and identification of Ralstonia solanacearum race 3 biovar 2
CN104946754A (en) Method and detection kit for quantitatively detecting ralstonia solanacearum in soil
CN107988330A (en) The dual-PCR method of Listeria monocytogenes and listeria ivanovii is detected at the same time
Eichmeier et al. High-throughput sequencing analysis of the bacterial community in stone fruit phloem tissues infected by “Candidatus Phytoplasma prunorum”
CN109897912A (en) A kind of LAMP primer and the method for detecting Plasmopara viticola
CN105018631A (en) Method for detecting pectobacterium carotovorum based on loop-mediated isothermal amplification technology, primer combination of method and detection kit

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20140528

Termination date: 20141227

EXPY Termination of patent right or utility model