CN1724689A - Strain specificity PCR detection method of heredity modified corn strain MON863 - Google Patents
Strain specificity PCR detection method of heredity modified corn strain MON863 Download PDFInfo
- Publication number
- CN1724689A CN1724689A CN 200510027942 CN200510027942A CN1724689A CN 1724689 A CN1724689 A CN 1724689A CN 200510027942 CN200510027942 CN 200510027942 CN 200510027942 A CN200510027942 A CN 200510027942A CN 1724689 A CN1724689 A CN 1724689A
- Authority
- CN
- China
- Prior art keywords
- corn
- strain
- mon863
- pcr
- strain specificity
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to strain specificity PCR testing method of improved corn strain MON863 that includes 5'end strain specificity testing method and 3'end strain specificity testing method. The process includes: analyzing external inserting carrier neighbor gene sequence of MON863 corn, designing primer of strain specificity PCR and ration PCR, and probe; building and optimizing strain specificity and ration PCR system; verifying the strain specificity and ration PCR testing method to build the testing platform of strain specificity PCR of improved corn strain MON863.
Description
Technical field
What the present invention relates to is a kind of detection method of technical field of bioengineering.Specifically, relate to the strain specificity PCR detection method of a kind of heredity modified corn strain MON863.
Background technology
Along with developing rapidly of modern biotechnology, genetic engineering technique has been widely used in agricultural production, and the extensively plantation in the world of hundreds of routine gene genetic improvement farm crop is for the mankind provide abundant food and medical product.To the end of the year 2004, global transgenosis cultivated area has reached 8,100 ten thousand hectares, has increased by 20% than 2003.The Chinese government has ratified the safety in production that multiple genetically engineered soybean, corn, rape and cotton product tie up to Chinese market, comprising the MON863 corn strain.Along with the extensive plantation of transgenic plant, the safety issue of genetically modified food has caused the public's attention, and many countries and regions come into effect the transgenosis labeling system one after another, comprise China.
The enforcement of transgenosis labeling system depends on the composition detection to transgenic plant and converted products thereof.Ahmed FE was published in the article of TRENDS in Biotechnology and points out in 2002, was used for transgenic detection method and mainly contained two kinds: the nucleic acid detection method of a kind of DNA of being based on a kind ofly is based on proteinic immunological detection method.Wherein, based on the nucleic acid detection method of DNA detection because its highly sensitive and high-throughout advantage have become main, the most suitable transgenic detection method.The detection of transgenic plant and converted products thereof mainly is to realize by detecting the dna sequence dna that inserts in the Plant Genome.Therefore, in the actual detected process, must understand the sequence information of the DNA of external source insertion.Jensen HA etc. was published in the segmental character of purpose of pointing out to detect according to PCR amplification in the article of Anal Bioanal Chem in 2003, and transgenic plant and converted products thereof detect and can be divided into screening, gene specific, structure specificity and strain specificity PCR and detect four kinds of methods.It is by detecting the joining region sequence realization of exogenous insertion vector and Plant Genome that strain specificity detects, because each transgenic plant strain, the joining region sequence that all has special exogenous insertion vector and Plant Genome, and the joining region sequence is single copy, so the strain specificity detection method has specificity and the accuracy high than screening, gene specific and structure PCR method for detecting specificity.In view of the high specific that strain specificity detects, strain specificity detects has become the emphasis that present transgenosis detects research, and is adopted by international examination criteria and international each test experience chamber step by step.Up to the present, the report of the strain specificity detection method of the transgenic plant strain of existing considerable part, for example Roundup Ready soybean, MON810 corn, NK603 corn, T25 corn, Bt11 corn etc. still also do not have the report about MON863 corn strain PCR method for detecting specificity.
Summary of the invention
The objective of the invention is to overcome deficiency of the prior art, the strain specificity PCR detection method of a kind of heredity modified corn strain MON863 is provided.The adjacent sequence in side according to MON863 corn exogenous insertion vector, design specific qualitative, quantification PCR primer and probe, optimize system and condition qualitative, the quantitative PCR reaction, set up qualitative, the quantitative PCR detecting method of 5 ' and 3 ' end strain specificity of MON863 corn strain, the transgenic strain method for detecting specificity of being set up is than transgenosis screening PCR detection, gene specific PCR detection and makes up the more special PCR detection method of PCR method for detecting specificity.
The present invention is achieved by the following technical solutions, the strain specificity PCR that the present invention is suitable for MON863 corn and converted products thereof detects, and is 5 ' end strain specificity detection method of purpose amplified fragments comprising the adjoining region dna sequence dna with the CaMV35S promotor of corn gene group and exogenous insertion vector 5 ' end; With the tahsp 17 3 ' terminator of exogenous insertion vector 3 ' end and the adjoining region dna sequence dna of corn gene group is 3 ' end strain specificity detection method of purpose amplified fragments.Specifically comprise the steps:
The strain specificity PCR that is suitable for MON863 corn and converted products thereof detects, and is 5 ' end strain specificity detection method of purpose amplified fragments comprising the adjoining region dna sequence dna with the CaMV35S promotor of corn gene group and exogenous insertion vector 5 ' end; With the tahsp 17 3 ' terminator of exogenous insertion vector 3 ' end and the adjoining region dna sequence dna of corn gene group is 3 ' end strain specificity detection method of purpose amplified fragments.
Specifically comprise the steps:
1. the other adjacent gene sequencing of the exogenous insertion vector of .MON863 corn, the other adjacent gene order of 5 ' end comprises 5 ' end parts sequence of corn gene group sequence and exogenous insertion vector CaMV35S promotor; The other adjacent gene order of 3 ' end comprises 3 ' end parts sequence of corn gene group sequence and exogenous insertion vector tahsp 17 3 ' terminator;
2.. strain specificity qualitative PCR primer and quantification PCR primer and probe design
Described strain specificity qualitative PCR primer refers to: length is the oligonucleotide chain of 22 ± 4Nt, and it is complementary or identical fully with the other adjacent gene order of MON863 corn.The purpose clip size of 5 ' end strain specificity qualitative PCR primer amplification of MON863 corn strain is 411bp; The purpose clip size of 3 ' end strain specificity qualitative PCR primer amplification of MON863 corn strain is 200bp.
Described strain specificity quantification PCR primer refers to: length is the oligonucleotide chain of 25 ± 5Nt, and it is complementary or identical fully with the other adjacent gene order of MON863 corn.The purpose clip size of 5 ' end strain specificity qualitative PCR primer amplification of MON863 corn strain is 90bp; The purpose clip size of 3 ' end strain specificity qualitative PCR primer amplification of MON863 corn strain is 150bp.
Described strain specificity quantitative PCR probe refers to: length is the oligonucleotide chain of 30 ± 5Nt, and its 5 ' end mark FAM fluorescence excitation group, and 3 ' end or oligonucleotide chain central marker TAMRA fluorescent quenching group; It is complementary or identical fully with the other adjacent gene order of MON863 corn; It combines with quantification PCR primer forms a cover quantitative PCR reaction system.
3.. strain specificity is qualitative, the foundation of quantitative PCR system and optimization, strain specificity qualitative PCR system, be: length is the oligonucleotide chain of 22 ± 4Nt, it is complementary or identical fully with the other adjacent gene order of MON863 corn, strain specificity quantitative PCR system, be: length is the oligonucleotide chain of 25 ± 5Nt, and it is complementary or identical fully with the other adjacent gene order of MON863 corn;
4.. strain specificity is qualitative, the quantitative PCR detecting method checking, qualitative PCR detection method checking comprises: the acquisition of can only increasing in MON863 corn gene group of the specific fragment of the strain specificity qualitative PCR amplification of foundation, quantitative PCR detecting method checking comprises: the strain specificity quantitative PCR system of foundation, can only increase in MON863 corn gene group and detect fluorescent signal.
The other adjacent gene order of the exogenous insertion vector of described MON863 corn refers to: the sequence of exogenous insertion vector and corn gene group adjoining region in the MON863 corn.
The foundation and the optimization of described strain specificity qualitative PCR system refer to, and by the combination of the primer of each concentration in the 100-1000nM scope, seek the reaction system of desired reaction efficiency and curve.
The foundation and the optimization of described strain specificity qualitative PCR system refer to, and by the primer of each concentration in the 100-1000nM scope and the combination of probe, seek the reaction system of desired reaction efficiency and curve.
Described strain specificity qualitative PCR detection method checking comprises two parts.Wherein, first part refers to: the acquisition of can only increasing in MON863 corn gene group of the specific fragment of the strain specificity qualitative PCR of foundation amplification, obtain and can not in other heredity modified corn strains (MON810, Bt11, Bt176, GA21, NK603, TC1507 etc.) and other gene genetics improvement plant (kind of No. one tomato of Roundup Ready soybean, GT73 rape, China and MON531 cotton etc.) genome, increase; Second section refers to: the sensitivity of the strain specificity qualitative PCR system of foundation detects.The PCR system of setting up must have very high sensitivity, can detect that to be low to moderate transgenosis content be 0.1% the limit.
Described strain specificity quantitative PCR detecting method checking comprises two parts.Wherein, first part refers to: the strain specificity quantitative PCR system of foundation, can only in MON863 corn gene group, increase and detect fluorescent signal, and can not be in other heredity modified corn strains (MON810, Bt11, Bt176, GA21, NK603, TC1507 etc.) and other gene genetics improvement plant (kind of No. one tomato of Roundup Ready soybean, GT73 rape, China and MON531 cotton etc.) genome amplification and detect fluorescent signal; Second section refers to: the limit of detection test of the strain specificity quantitative PCR system of foundation and the structure of typical curve.The limit of detection test of quantitative PCR system and the construction process of typical curve are, with one group with the gradient dilution method it is diluted respectively be 200,20,2,0.2,0.02, the MON863 corn gene group DNA solution that isozygotys of 0.002ng/ μ L, the dna solution of getting the above-mentioned dilution of 1 μ L respectively carries out quantitative pcr amplification, each reacts triplicate, determines limit of detection and typical curve according to the cycle number of quantitative pcr amplification and the linear relationship of amplification fluorescent signal.
The present invention utilizes the adjacent sequence in side of the exogenous insertion vector of MON863 corn strain first, design specific qualitative, quantification PCR primer and probe, set up qualitative, the quantitative PCR detecting method of strain specificity highly sensitive, specific modified corn MON 863.The transgenic strain method for detecting specificity that the present invention set up is than transgenosis screening detection, gene specific detection and makes up the more special efficient detection method of method for detecting specificity, the trend that meets transgenic plant in the world and the research of converted products detection method thereof has promoted the process that MON863 Standard for Maize detection method is set up.The present invention utilizes the adjoining region dna sequence dna of the CaMV35S promotor of corn gene group and exogenous insertion vector 5 ' end, and the tahsp17 3 ' terminator of exogenous insertion vector 3 ' end and the adjoining region dna sequence dna of corn gene group, design specific qualitative PCR primer, quantitative TaqMan PCR primer and probe, optimize reaction system and reaction conditions qualitative accordingly, the quantitative PCR reaction, set up the strain specificity PCR detection method of MON863 corn.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.These embodiment only are used to the present invention is described and are not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, for example the Sambrook equimolecular is cloned: laboratory manual (New York:Cold SpringHarbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Embodiment 1
One. experiment material
1, vegetable material
Gene genetic improvement corn strain: MON863 corn, MON810 corn, Bt11 corn, Bt176 corn, TC1507 corn, 6A21 corn etc.
Ordinary maize
Other transgenic plant: Roundup Ready soybean, GT73 rape, MON531 cotton, " China kind No. one " tomato etc.
2, enzyme and reagent
It is the food DNA extraction agent box of Academy of Agricultural Sciences, Shanghai City and Shanghai Entry-Exit Inspection and Quarantine bureau's joint research and development that plant genome DNA extracts test kit.
DNTPs, Taq archaeal dna polymerase and damping fluid thereof, DL2000 Marker are available from the precious biotechnology in Dalian company limited.Random primer, TaqMan probe and primer are synthetic by the rich inferior biotechnology in Shanghai company limited.
Other biochemical reagents are import packing or homemade analytical pure.
3. laboratory apparatus
DY-501 type nucleic acid electrophoresis apparatus (Shanghai Precision Scientific Apparatus Co., Ltd)
PTC-100 type pcr amplification instrument (MJ Research Inc.)
Rotor-Gene 2000 quantitative PCR instrument (Corbett Research, Australia)
DUR 640 nucleic acid and the protein analyzer of BECKMAN company
Dna sequencing instrument (the full-automatic fluorescence sequenator of Applied Biosystem377 type)
DNA electrophoretic analysis system comprises camera bellows, digital camera, computer, scanner, ink-jet printer, photosensitive printer, Tanon UV-2000 uv analyzer, Gis gel images analysis software (sky, Shanghai energy company)
Other instruments comprise: whizzer, thermostat water bath, incubator, day equality.
Two, experimental technique and process
1, plant genome DNA extracts and detects
1) DNA of plants is extracted
Get an amount of corn sample and be placed in the mortar, add liquid nitrogen, take by weighing about 70mg-100mg ground sample and change in the Eppendorf pipe of 1.5ml the sample grind into powder;
Look what of quantity of material, add the 600-700 μ l Buffer A of preheating, gently behind the mixing, 65 ℃ of water bath heat preservations 1 hour, during between or the vibration mixing;
Add equal-volume phenol/chloroform (600-700 μ l) in pipe, the abundant mixing that turns upside down leaves standstill extracting 10min;
Centrifugal 10 minutes of 12000rpm draws in the new Eppendorf pipe of supernatant to;
Add and the isopyknic Virahol of supernatant (about 600 μ l), mixing, after normal temperature was placed 10min, the centrifugal 10min of 12000rpm removed supernatant, kept precipitation;
In precipitation, add 60 μ l TER, 37 ℃ place behind the 2min with the rifle head with its abundant mixing after, placed about 1 hour in 37 ℃;
Add 140 μ l TE after the taking-up, add 200 μ l phenol/chloroforms again, mixing leaves standstill a moment;
The centrifugal 5min of 12000rpm gets supernatant (about 180 μ l), adds 1/10 volume 3M NaAc and 2 times of volume dehydrated alcohols, places 30min for-20 ℃;
The centrifugal 10min of 12000rpm removes supernatant, adds 75% ethanol, 200 μ l, and the centrifugal 5min of 12000rpm abandons supernatant, and room temperature is dried, and is dissolved among the aseptic ddH2O of 50 μ l.
2) DNA detection
Get the dna solution that 3ul extracts, the agarose gel electrophoresis with 1% is judged the quality of DNA according to its brightness and diffusion.
Utilize ultraviolet spectrophotometer to measure concentration and the purity of the DNA that puies forward.
2, the design of primers of MON863 corn strain specificity qualitative PCR detection
The adjacent sequence in side according to the exogenous insertion vector of the MON863 corn strain that obtains, utilize two pairs of qualitative PCR primers of primer-design software primer 5.0 designs, the exogenous insertion vector of MON863 corn and 5 ' and 3 ' adjoining region sequence of corn gene group increase respectively, wherein, in every pair of primer, article one, be positioned on the corn gene group, another is positioned on the exogenous insertion vector.Concrete primer sequence sees Table 1.
The qualitative strain specificity of table 1.MON863 corn detects primer sequence
Detection architecture title sequence (5 '-3 ') amplification length
(bp)
Special primer 1 GCACTCAAAGACCTGGCGAATGA of 5 ' end strain
411
Opposite sex primer 2 CCATCTTTGGGACCACTGTCG
Special primer 6 GGCGATGAATAAATGAGAAATA of 3 ' end strain
200
Opposite sex primer 7 TAGCCAGTTCATTGCGAGTA
3, the primer and the probe design of MON863 corn strain specificity quantitative PCR detection
The adjacent sequence in side according to the exogenous insertion vector of the MON863 corn strain that obtains, utilize two pairs of TaqMan quantification PCR primers of primer-design software Primer Express2.0 design and probe, the exogenous insertion vector 5 ' of MON863 corn and the adjoining region sequence of 3 ' end and corn gene group increase respectively, wherein, in every group of primer, article one, be positioned on the corn gene group, another is positioned on the exogenous insertion vector, and probe is positioned on corn gene group and the critical sequence of exogenous insertion vector.Concrete primer sequence sees Table 2.
The quantitative strain specificity of table 2.MON863 corn detects primer and probe sequence
Inspection
Survey name
Amplification is long
Sequence (5 '-3 ')
Body degree of title (bp)
System
Draw
5 ' thing CCTACTTGTTCGGATGGGTGTT
End 3
Product draw
Be thing CTTCCTTTTCTACTGTCCTTTTGATGA 90
Special 4
Different spy
FAM
The property pin
AGTGTACCAAGCT(TAMARA)TTCCGATCCTACCTGTCA
5
3 ' draws
End thing GAAATAAATTGTTCTGATTTTGAGTGCAA 150
Product 8
System draws
Special thing ATATGATACAACCATATCTAAATGGAACTTT
Different 9
The property spy
FAM?TCACTATGCTCTGCTCTATAGGGAGACCGAATT
Pin
TAMRA
10
4, the specificity analyses of MON863 corn strain specificity qualitative PCR detection method
Optimize MON863 corn qualitative strain specificity PCR detection architecture and reaction conditions, serve as the purpose fragment that detects the qualitative amplification strain specificity of template with multiple different transgenic corns strain and other transgenic plant respectively, determine the specificity of the MON863 corn strain method for detecting specificity of foundation.
5, the sensitivity analysis of MON863 corn strain specificity qualitative PCR detection method
The MON863 corn gene group DNA solution that isozygotys of purifying is mixed with the non-transgenic corn gene group DNA, hybrid dna solution final concentration is 100ng/ μ L, contain 10%, 5.0%, 3.0% respectively, 1.0%, 0.5%, 0.1%, 0.01% transgenosis MON863 corn composition, the dna solution of getting the above-mentioned dilution of 1 μ L respectively carries out the qualitative PCR amplification, determines the detection sensitivity of MON863 corn strain specificity qualitative PCR detection method.
6, the specificity analyses of MON863 corn strain specificity quantitative PCR detecting method
Optimize MON863 corn strain specificity quantitative PCR detection system and reaction conditions, serve as the purpose fragment that detects template quantitative amplification strain specificity with multiple different transgenic corns strain and other transgenic plant respectively, determine the specificity of the MON863 corn strain specificity quantitative detecting method of foundation.
7, the sensitivity analysis of MON863 corn strain specificity quantitative PCR detecting method
The MON863 corn gene group DNA solution that isozygotys with purifying, with the gradient dilution method it is diluted respectively be 200,20,2,0.2,0.02, the dna solution of 0.002ng/ μ L, the dna solution of getting the above-mentioned dilution of 1 μ L respectively carries out quantitative pcr amplification, each reacts triplicate, determines the sensitivity of MON863 corn strain specificity quantitative PCR detecting method according to the linear relationship of the typical curve of quantitative pcr amplification and amplification fluorescent signal.
Three, experimental result
1,5 ' of MON863 corn strain end strain specificity qualitative PCR detection architecture and condition
Through optimizing, the system that 5 ' end strain specificity qualitative PCR of MON863 corn strain detects sees Table 3; The pcr amplification condition sees Table 6.
Table 3.MON863 corn 5 ' end strain specificity qualitative PCR detection architecture
Reaction reagent volume (μ L) final concentration
10×PCR 1×(50mM?KCl,10mM?Tris-HCl,PH8.3,1.5mM
3
Buffer MgCl
2)
dNTPs 3 200μM
Primer 11 100nM
Primer 21 100nM
Taq enzyme 1.5 1.5unit/reaction
Dna profiling 1
DdH2O complements to 30 μ l
Table 4.MON863 corn strain specificity qualitative PCR detects amplification condition
The cycle number temperature (℃) time
1 94 10min
94 30sec
35 60 30sec
72 30sec
1 72 7min
2,3 ' of MON863 corn strain end strain specificity qualitative PCR detection architecture and reaction conditions
Through optimizing, the system that 3 ' end strain specificity qualitative PCR of MON863 corn strain detects sees Table 5; The pcr amplification condition sees Table 4.
Table 5.MON863 corn 3 ' end strain specificity qualitative PCR detection architecture
Reaction reagent volume (μ l) final concentration
10×PCR 1×(50mM?KCl,10mM?Tris-HCl,PH8.3,1.5mM
3
Buffer MgCl
2)
dNTPs 3 200μM
Primer 61 100nM
Primer 71 100nM
Taq enzyme 1.5 1.5unit/reaction
Dna profiling 1
DdH
2O complements to 30 μ l
3, the specific detection of 5 ' of MON863 corn strain end strain specificity qualitative PCR detection method
Show with Auele Specific Primer 1 and the 2 qualitative PCR amplifications of setting up, amplification has obtained the band (411bp) of purpose clip size in MON863 corn gene group, does not have amplification to obtain the band of purpose clip size in MON810, GA21, T25, Bt11 and Event176 corn, Roundup Ready soybean and ordinary maize genome.By sequencing analysis show in the MON863 genome that amplification obtains sequence consistent with purpose amplified fragments sequence.The above results shows that primer 1 and the 2 MON863 corns of setting up, 5 ' end strain specificity PCR detection architecture have high degree of specificity.
4, the sensitivity of 5 ' of MON863 corn strain end strain specificity qualitative PCR detection method detects
With Auele Specific Primer 1 and 2 set up qualitative PCR sensitivity amplification show, MON863 corn composition is 10%, 5.0%, 3.0%, all amplified the band of purpose clip size in 1.0%, 0.5%, 0.1% the PCR reaction, and MON863 corn content is not amplify the band of purpose clip size at 0.01% o'clock, illustrates that the detection sensitivity of 5 ' end strain specificity qualitative PCR detection architecture of MON863 corn strain is 0.1%.
5, the specific detection of 3 ' of MON863 corn strain end strain specificity qualitative PCR detection method
Show with Auele Specific Primer 6 and the 7 qualitative PCR amplifications of setting up, amplification has obtained the band (200bp) of purpose clip size in MON863 corn gene group, does not have amplification to obtain the band of purpose clip size in MON810, GA21, T25, Bt11 and Event176 corn, Roundup Ready soybean and ordinary maize genome.The sequence that shows the band of the purpose clip size of amplification acquisition in the transgenosis MON863 genome by sequencing analysis is consistent with purpose amplified fragments sequence.Has excellent specificity with Auele Specific Primer 6 and the 7 MON863 corns of setting up, 3 ' end strain specificity PCR detection architecture.
6, the sensitivity of 3 ' of MON863 corn strain end strain specificity qualitative PCR detection method detects
Show with Auele Specific Primer 6 and the 7 qualitative PCR sensitivity amplifications of setting up, at MON863 corn composition is 10%, 5.0%, 3.0%, all amplified the band of purpose clip size in 1.0%, 0.5%, 0.1% the PCR reaction, and MON863 corn content is not amplify the band of purpose clip size at 0.01% o'clock, illustrates that the detection sensitivity of 3 ' end strain specificity qualitative PCR detection architecture of MON863 corn strain is 0.1%.
7,5 ' of MON863 corn strain end strain specificity quantitative PCR detection system and reaction conditions
Through optimizing, the system of 5 ' end strain specificity quantitative PCR detection of MON863 corn strain sees Table 6; The pcr amplification condition sees Table 7.
Table 6.MON863 corn 5 ' end strain specificity quantitative PCR detection system
Reaction reagent volume (μ l) final concentration
5×PCR?Buffer 5 1×(50mM?KCl,10mM?Tris-HCl,PH8.3)
MgCl
2 6 6mM
400μM?dATP,dGTP,dCTP;800μM
dNTPs 3
dUTP
Primer 3 0.6 600nM
Primer 4 0.6 600nM
Probe 5 0.9 450nM
Hotstar Taq enzyme 1.5 1.5unit/reaction
UNG enzyme 0.2 0.2unit/reaction
Dna profiling 1
DdH
2O complements to 25 μ l
Table 7.MON863 corn strain specificity quantitative PCR detection amplification condition
The cycle number temperature (℃) time
1 50 2min
1 95 10min
94 30sec
45 60 30sec
72 30sec
1 72 7min
8,3 ' of MON863 corn strain end strain specificity quantitative PCR detection system and reaction conditions
Through optimizing, the system that the quantitative strain specificity PCR of 3 ' end of MON863 corn strain detects sees Table 8; The pcr amplification condition sees Table 7.
The quantitative strain specificity PCR detection architecture of table 8.MON863 corn 3 ' end
Reaction reagent volume (μ l) final concentration
5×PCR?Buffer 5 1×(50mM?KCl,10mM?Tris-HCl,PH8.3)
MgCl
2 6 6mM
400μM?dATP,dGTP,dCTP;
dNTPs 3
800μM?dUTP
Primer 8 0.6 600nM
Primer 9 0.6 600nM
Probe 10 0.6 600nM
Hotstar Taq enzyme 1.5 1.5unit/reaction
UNG enzyme 0.2 0.2unit/reaction
Dna profiling 1
DdH
2O complements to 25 μ l
9, the specific detection of 5 ' of MON863 corn strain end strain specificity quantitative PCR detecting method
With Auele Specific Primer 3,4 and the quantitative pcr amplification result that sets up of probe 5 show, in transgenosis MON863 corn gene group is the amplified reaction of template, detect tangible fluorescent signal, and in MON810, GA21, T25, Bt11 and Event176 corn, transgenosis Roundup Ready soybean and the genomic amplified reaction of ordinary maize, do not detected tangible fluorescent signal.The above results show utilize that Auele Specific Primer 3,4 and probe 5 set up the quantitative PCR detection system of MON863 corn 5 ' end strain specificity have excellent specificity.
10, the specific detection of 3 ' of MON863 corn strain end strain specificity quantitative PCR detecting method
With Auele Specific Primer 8,9 and the quantitative pcr amplification result that sets up of probe 10 show, in transgenosis MON863 corn gene group is the amplified reaction of template, detect tangible fluorescent signal, and in MON810, GA21, T25, Bt11 and Event176 corn, transgenosis Roundup Ready soybean and the genomic amplified reaction of ordinary maize, do not detected tangible fluorescent signal.The above results shows that the quantitative PCR detection system of MON863 corn 3 ' the end strain specificity that utilizes Auele Specific Primer 8,9 and probe 10 foundation has excellent specificity.
11, the sensitivity of 5 ' of MON863 corn strain end strain specificity quantitative PCR detecting method detects
Utilize MON863 corn 5 ' the end strain specificity quantitative PCR detection system of optimizing, one group of concentration is respectively 200,20,2,0.2,0.02, the MON863 corn gene group DNA solution of 0.002ng/ μ L is used for making up the quantitative criterion curve of this quantitative PCR detection system, and the detection by quantitative sensitivity of determining this system, the typical curve that makes up and the linear relationship of amplification fluorescent signal and cycle number, the detection by quantitative sensitivity of this system is the 20pg corn gene group DNA, is equivalent to the corn monoploid genome of 7 copies.Can think from the result of quantitative criterion curve and detection sensitivity, MON863 corn 5 ' the end strain specificity quantitative PCR detection system that this research is set up has very high accuracy and sensitivity, can be used for the actual detected of MON863 corn and converted products thereof fully.
12, the sensitivity of 3 ' of MON863 corn strain end strain specificity quantitative PCR detecting method detects
Utilize MON863 corn 3 ' the end strain specificity quantitative PCR detection system of optimizing, one group of concentration is respectively 200,20,2,0.2,0.02, the MON863 corn gene group DNA solution of 0.002ng/ μ L is used for making up the quantitative criterion curve of this quantitative PCR detection system, and the detection by quantitative sensitivity of determining this system, the typical curve that makes up and the linear relationship of amplification fluorescent signal and cycle number, the detection by quantitative sensitivity of this system is the 20pg corn gene group DNA, is equivalent to the corn monoploid genome of 7 copies.Can think from the result of quantitative criterion curve and detection sensitivity, MON863 corn 3 ' the end strain specificity quantitative PCR detection system that this research is set up has very high accuracy and sensitivity, can be used for the actual detected of MON863 corn and converted products thereof fully.
Claims (7)
1, the strain specificity PCR detection method of a kind of heredity modified corn strain MON863, it is characterized in that, the strain specificity PCR that is suitable for MON863 corn and converted products thereof detects, and is 5 ' end strain specificity detection method of purpose amplified fragments comprising the adjoining region dna sequence dna with the CaMV35S promotor of corn gene group and exogenous insertion vector 5 ' end; With the tahsp 17 3 ' terminator of exogenous insertion vector 3 ' end and the adjoining region dna sequence dna of corn gene group is 3 ' end strain specificity detection method of purpose amplified fragments.
2, the strain specificity PCR detection method of heredity modified corn strain MON863 according to claim 1 is characterized in that, specifically comprises the steps:
1. the other adjacent gene sequencing of the exogenous insertion vector of .MON863 corn, the other adjacent gene order of 5 ' end comprises 5 ' end parts sequence of corn gene group sequence and exogenous insertion vector CaMV35S promotor; The other adjacent gene order of 3 ' end comprises 3 ' end parts sequence of corn gene group sequence and exogenous insertion vector tahsp 17 3 ' terminator;
2.. strain specificity qualitative PCR primer and quantification PCR primer and probe design, described strain specificity qualitative PCR primer, refer to: length is the oligonucleotide chain of 22 ± 4Nt, it is complementary or identical fully with the other adjacent gene order of MON863 corn, described strain specificity quantification PCR primer, refer to: length is the oligonucleotide chain of 25 ± 5Nt, it is complementary or identical fully with the other adjacent gene order of MON863 corn, described strain specificity quantitative PCR probe, refer to: length is the oligonucleotide chain of 30 ± 5Nt, its 5 ' end mark FAM fluorescence excitation group, and 3 ' end or oligonucleotide chain central marker TAMRA fluorescent quenching group;
3.. strain specificity is qualitative, the foundation of quantitative PCR system and optimization, strain specificity qualitative PCR system, be: length is the oligonucleotide chain of 22 ± 4Nt, it is complementary or identical fully with the other adjacent gene order of MON863 corn, strain specificity quantitative PCR system, be: length is the oligonucleotide chain of 25 ± 5Nt, and it is complementary or identical fully with the other adjacent gene order of MON863 corn;
4.. strain specificity is qualitative, the quantitative PCR detecting method checking, qualitative PCR detection method checking comprises: the acquisition of can only increasing in MON863 corn gene group of the specific fragment of the strain specificity qualitative PCR amplification of foundation, quantitative PCR detecting method checking comprises: the strain specificity quantitative PCR system of foundation, can only increase in MON863 corn gene group and detect fluorescent signal.
3, the strain specificity PCR detection method of heredity modified corn strain MON863 according to claim 1, it is characterized in that, the other adjacent gene order of the exogenous insertion vector of described MON863 corn refers to: the sequence of exogenous insertion vector and corn gene group adjoining region in the MON863 corn.
4, the strain specificity PCR detection method of heredity modified corn strain MON863 according to claim 1, it is characterized in that, the foundation and the optimization of described strain specificity qualitative PCR system, refer to, by the combination of the primer of each concentration in the 100-1000nM scope, seek the reaction system of desired reaction efficiency and curve.
5, the strain specificity PCR detection method of heredity modified corn strain MON863 according to claim 1, it is characterized in that, the foundation and the optimization of described strain specificity qualitative PCR system, refer to, by the primer of each concentration in the 100-1000nM scope and the combination of probe, seek the reaction system of desired reaction efficiency and curve.
6, the strain specificity PCR detection method of heredity modified corn strain MON863 according to claim 1 is characterized in that, the checking of described strain specificity qualitative PCR detection method can detect that to be low to moderate transgenosis content be 0.1% the limit.
7, the strain specificity PCR detection method of heredity modified corn strain MON863 according to claim 1, it is characterized in that, described strain specificity quantitative PCR detecting method checking, the construction process of setting up its limit test and typical curve is, it being diluted respectively with the gradient dilution method with one group is 200,20,2,0.2,0.02,0.002ng/ the MON863 corn gene group DNA solution that isozygotys of μ L, the dna solution of getting the above-mentioned dilution of 1 μ L respectively carries out quantitative pcr amplification, each reacts triplicate, determines limit of detection and typical curve according to the cycle number of quantitative pcr amplification and the linear relationship of amplification fluorescent signal.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 200510027942 CN1724689A (en) | 2005-07-21 | 2005-07-21 | Strain specificity PCR detection method of heredity modified corn strain MON863 |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 200510027942 CN1724689A (en) | 2005-07-21 | 2005-07-21 | Strain specificity PCR detection method of heredity modified corn strain MON863 |
Publications (1)
Publication Number | Publication Date |
---|---|
CN1724689A true CN1724689A (en) | 2006-01-25 |
Family
ID=35924320
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN 200510027942 Pending CN1724689A (en) | 2005-07-21 | 2005-07-21 | Strain specificity PCR detection method of heredity modified corn strain MON863 |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN1724689A (en) |
Cited By (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101240279B (en) * | 2007-02-09 | 2010-06-23 | 中国农业科学院植物保护研究所 | Side sequence of exogenous insert of transgene paddy strain Kefeng 6 |
CN101935694A (en) * | 2010-03-15 | 2011-01-05 | 山东省农业科学院植物保护研究所 | Genetic chip for detecting transgenic plants and products containing screening gene CaMV35S and application thereof |
CN101240278B (en) * | 2007-02-09 | 2011-07-06 | 中国农业科学院植物保护研究所 | Side sequence of exogenous insert of transgene paddy strain Kemingdao 1 |
CN101240277B (en) * | 2007-02-09 | 2011-07-20 | 中国农业科学院植物保护研究所 | PCR detection method of transgene paddy strain Bt Shanyou 63 |
CN102286624A (en) * | 2011-08-26 | 2011-12-21 | 上海市农业科学院 | Qualitative and quantitative PCR (polymerase chain reaction) detection method for strain specificity of transgenic carnation Moonlite |
CN102409093A (en) * | 2011-11-17 | 2012-04-11 | 四川省农业科学院分析测试中心 | Specific quantitative polymerase chain reaction (PCR) detection method for transgenic corn MON863 strain |
CN102676671A (en) * | 2012-05-08 | 2012-09-19 | 清华大学 | Method for detecting transgenic corn and special kit thereof |
-
2005
- 2005-07-21 CN CN 200510027942 patent/CN1724689A/en active Pending
Cited By (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101240279B (en) * | 2007-02-09 | 2010-06-23 | 中国农业科学院植物保护研究所 | Side sequence of exogenous insert of transgene paddy strain Kefeng 6 |
CN101240278B (en) * | 2007-02-09 | 2011-07-06 | 中国农业科学院植物保护研究所 | Side sequence of exogenous insert of transgene paddy strain Kemingdao 1 |
CN101240277B (en) * | 2007-02-09 | 2011-07-20 | 中国农业科学院植物保护研究所 | PCR detection method of transgene paddy strain Bt Shanyou 63 |
CN101935694A (en) * | 2010-03-15 | 2011-01-05 | 山东省农业科学院植物保护研究所 | Genetic chip for detecting transgenic plants and products containing screening gene CaMV35S and application thereof |
CN101935694B (en) * | 2010-03-15 | 2012-06-20 | 山东省农业科学院植物保护研究所 | Genetic chip for detecting transgenic plants and products containing screening gene CaMV35S and application thereof |
CN102286624A (en) * | 2011-08-26 | 2011-12-21 | 上海市农业科学院 | Qualitative and quantitative PCR (polymerase chain reaction) detection method for strain specificity of transgenic carnation Moonlite |
CN102286624B (en) * | 2011-08-26 | 2013-03-27 | 上海市农业科学院 | Qualitative and quantitative PCR (polymerase chain reaction) detection method for strain specificity of transgenic carnation Moonlite |
CN102409093A (en) * | 2011-11-17 | 2012-04-11 | 四川省农业科学院分析测试中心 | Specific quantitative polymerase chain reaction (PCR) detection method for transgenic corn MON863 strain |
CN102676671A (en) * | 2012-05-08 | 2012-09-19 | 清华大学 | Method for detecting transgenic corn and special kit thereof |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN1896284A (en) | Method for identifying allelic gene type | |
CN1814805A (en) | H5, H7, H9 subtype auian flu virus real-time fluo rescent quantixative PCR detecting method | |
CN1724689A (en) | Strain specificity PCR detection method of heredity modified corn strain MON863 | |
CN1873019A (en) | Quick method for testing chain reaction of multiple reverse transcription polymerase of lily virus | |
CN1724686A (en) | Target sequence used for detecting mycoplasma pnoumoniae and reagent box | |
CN101045942A (en) | Transgenic papaya and detection of transgenic component in transgenic papaya product | |
CN100351395C (en) | Norwalk virus expression detecting kit and its special primer and probe | |
CN1289669C (en) | Design process for compound amplifying primer | |
CN1904048A (en) | Zebra fish egg yolk protein origin 1 gene regulating and controlling sequence | |
CN1772922A (en) | Method of identifying invasion of south American glim ant and its nucleic acid sequence, probe and reagent kit | |
CN1904064A (en) | Star shaped nocardia multiple PCR fast detection kit and detection method | |
CN1300340C (en) | Kit for testing transgene cottonseed and products produced, and testing method | |
CN1557966A (en) | Internal standard gene suitable to exogenous gene detection such as transgene cotton and application thereof | |
CN1247796C (en) | Quantitative measuring transgene component in transgene rapeseed and processed product | |
CN1280429C (en) | Process for detecting Enterobacter sakazakii by employing molecular hybridization and enzyme-link coloration technology | |
CN1810988A (en) | Method and kit for detecting ox and sheep components in feed | |
CN1809638A (en) | Method of detecting beta 3 adrenaline receptor mutant gene and nucleic acid probe and kit therefor | |
CN1218048C (en) | Multicolour fluorescent substance composit amplification STR primer designing method | |
CN1243106C (en) | Y chromosome multi colour fluorescence combined amplification reagent box | |
CN100335651C (en) | Probe sequence for qualitatively detecting transgenic crop containing Pat gene using fluorescence PCR and reagent case | |
CN1485442A (en) | Probe sequence for quantitatively detecting transgenic soybean containing cauliflower mosaic virus 35S promotor using fluorescence PCR and reagent case | |
CN100351378C (en) | Aldehyde-alcohol dehydrogenase gene | |
CN1664112A (en) | Method for detecting Enterobacter sakazakii by using polymerase chain reaction technology | |
CN100335653C (en) | Probe sequence for qualitatively detecting transgenic crop containing figwort mosaic virus FMV35S promotor using fluorescence PCR and reagent case | |
CN1590563A (en) | Detecting method of biological noneuploid |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C12 | Rejection of a patent application after its publication | ||
RJ01 | Rejection of invention patent application after publication |