CN1772922A - Method of identifying invasion of south American glim ant and its nucleic acid sequence, probe and reagent kit - Google Patents
Method of identifying invasion of south American glim ant and its nucleic acid sequence, probe and reagent kit Download PDFInfo
- Publication number
- CN1772922A CN1772922A CN 200510100520 CN200510100520A CN1772922A CN 1772922 A CN1772922 A CN 1772922A CN 200510100520 CN200510100520 CN 200510100520 CN 200510100520 A CN200510100520 A CN 200510100520A CN 1772922 A CN1772922 A CN 1772922A
- Authority
- CN
- China
- Prior art keywords
- south america
- red fire
- fire ant
- invasion
- ant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The present invention discloses method of identifying invading South American glim ant and its nucleic acid sequence, probe and reagent kit. The present invention provides full length nucleic acid sequence of rDNA transcription spacer of South American glim ant and several specific DNA molecular probes originating from the sequence. Using the serial specific molecular probes can detect and identify invading South American glim ant quickly and accurately. The present invention may be used in custom quarantine, imported flower detection, early warning, control, etc. on South American glim ant.
Description
Technical field
The present invention relates to biology field, relate to a kind of method of molecular biology method rapid detection exotic invasive South America red fire ant and specific nucleic acid sequence, probe and test kit of using thereof of utilizing specifically.
Background technology
On January 17th, 2005, the Ministry of Agriculture will invade the South America red fire ant and classify inward Plant Quarantine harmful organism of China and national Plant Quarantine harmful organism as.At present, this epidemic situation all has generation in some areas such as Wuchuan, China Guangdong Province, Shenzhen.For preventing that epidemic situation from spreading out of, State General Administration for Quality Supervision pays much attention to, and sends urgent message, requires each inspection and quarantine mechanism to strengthen quarantine.
According to the agricultural plants sanitary authority, invasion South America red fire ant (Red Imported Fire Ant, RIFA, Solenopsis invicta) is a kind of hazardness insect, belongs to Hymenoptera, Formicidae, Myrmicinae, Solenopsis.The some areas in the U.S., Puerto Rico, New Zealand, Australia and China Taiwan Province since nineteen thirty, have been imported in countries such as former Brazil that is distributed in South America Parana basin, Paraguay, Argentina.Invasion South America red fire ant is a kind of polyphagous pest-insect, harm agriculture production, soil such as the insect of predation generating area and the earthworm biology of dwelling, destroy the eubiosis, the installations and facilities such as destroying power supply, telecommunications, on-farm facilities, dykes and dams of nesting when being interfered, also can being stung and bite people, animal.
Owing to lack reliably objective molecular biology index, domestic each import-export ports inspection and quarantine department mainly is to judge according to its morphological feature to the detection of invasion South America red fire ant at present.But the red fire ant of invasion and the form of its sibling species are quite similar, easily change with environment again.And morphology identifies the experience relatively depend on the testing staff, for fear of its subjectivity, often will could finally determine through multidigit expert's repetitive identified.Except accuracy is difficult to abundant assurance, and consuming time of a specified duration.Further strengthen invading epidemic situation check and the control work of South America red fire ant in view of China Ministry of Agriculture requires inspection and quarantine departments at different levels, develop a kind of novel method new technology in time, the accurate evaluation to the red fire ant invasive species fast is very necessary.
Summary of the invention
The objective of the invention is at the existing deficiency that exists on the red fire ant detection method of South America of invading, the method for accurate Rapid identification invasion South America red fire ant is provided.
Another object of the present invention provides the used nucleotide sequence of above-mentioned authentication method.
Another object of the present invention provides the used nucleic acid molecular probe of above-mentioned authentication method.
Further purpose of the present invention provides the used test kit of above-mentioned authentication method.
The present inventor finds in the research to invasion South America red fire ant and other relevant approximate species, the rDNA transcribed spacer (ITS district) of invasion South America red fire ant has the nucleotide sequence that is different from other ant species, can be used as the characteristic nucleotide sequence of invasion South America red fire ant, be used to identify exotic invasive South America red fire ant.According to this characteristic sequence, can design the specificity molecular probe of preparation invasion South America red fire ant rDNA intergenic region.And set up the molecular biology method of fast, accurately identifying invasion South America red fire ant.
The present invention specifically comprises:
One, the invention provides the nucleotide sequence that gene examination standard is used to identify invasion South America red fire ant; Provided by the inventionly be used to identify that the nucleotide sequence of invasion South America red fire ant derives from rDNA transcribed spacer (promptly the invading South America red fire ant rrna rRNA internal gene transcribed spacers) sequence of invasion South America red fire ant, its nucleotide sequence is shown in SEQ ID NO:1.This nucleotide sequence can obtain by the following method:
Get the invasion South America red fire ant sample of 1 alcohol-pickled preservation and put into the 1.5ml centrifuge tube.A small amount of cooled with liquid nitrogen is frozen crisp.Grind slightly, pulverize sample.Adding 500ul extraction damping fluid (20mM Tris-Cl pH 8.0,20mM EDTA pH 8.0,400mM NaCl, 1%SDS), Proteinase K (20mg/ml) 10ul.55 ℃ of incubations, concussion (750rpm) digestion is more than 5 hours.Phenol: chloroform: primary isoamyl alcohol (25: 24: 1) extracting.Ethanol sedimentation spends the night.Return moltenly with an amount of TE, obtain total DNA of invasion South America red fire ant.Carry out the PCR in ITS district then, the primer is respectively LH2 (5 ' CGTAGGTGAACCTGCGGAAGGATC 3 ') and Sm73 (5 ' TFCGCTCGCCGTTACTAGGGGAATC 3 ').Get the PCR pipe of a 200ul, add the 20ulPCR reaction solution and (wherein contain 2.0mM MgCl
2, 200uM dNTP, 10 * Taq DNA damping fluid 2ul, 1UTaq archaeal dna polymerase, each 10pmol of each primer).The total DNA 0.1ul that adds red fire ant then.By follow procedure carry out PCR:94 ℃ 5 minutes, 94 ℃ 1 minute, 50 ℃ 1 minute and 72 ℃ 2.5 minutes, 30 circulations, then 72 ℃ 10 minutes, finish reaction.Reaction product is the invasion South America red fire ant rDNA intergenic region (ITS) of the about 2500bp of length.
Two, the present invention also provides the molecular probe of the invasion South America red fire ant that derives from above-mentioned nucleotide sequence; Described molecular probe derive from the complete sequence of above-mentioned nucleotide sequence or wherein one section be no less than 18 oligonucleotide sequences, perhaps above-mentioned sequence is modified, variation and Nucleotide variable quantity are no more than 5% sequence.The particularly preferred invasion of described nucleic acid molecular probe South America red fire ant specificity nucleic acid molecular probe is 5 sequences shown in SEQ ID NO:2～6, is called In244F, In862R, In434F, In756F and In1567R.
These 5 specificity nucleic acid molecular probes of In244F, In862R, In434F, In756F and In1567R can obtain by the DNA chemical synthesis process of routine.These probes can be incorporated into row labels by radio isotope, enzyme, vitamin H, fluorescent agent or chemiluminescence element.
In addition, because these 5 specific molecular probes have extremely strong species specificity, can the specificity reaction take place with invasion South America red fire ant, and do not react with the DNA of the close species of other red fire ant.Therefore, the 3 pairs of specific PCR primers (In244F and In862R, In434F and In862R, In756F and In1567R) that utilize these 5 kinds of probes to form, the method by PCR can realize also identifying fast and accurately whether the target ant is to invade the South America red fire ant.
Three, the present invention also provides a kind of and extracts the invasion South America red fire ant identification kit that reagent and PCR relevant primer and reagent are formed by above-mentioned invasion South America red fire ant specific molecular probe, sample total DNA.Can be widely used in the Rapid identification work of customs, agricultural and import and export sanitary authority for invasion South America red fire ant.This test kit specifically comprises:
1,5 invasion narrow spectrum nucleic acid molecular probes of South America red fire ant (isotropic substance or fluorescent mark) are respectively In244F, In862R, In434F, In756F and In1567R.
2,3 pairs of PCR primers are respectively: In244F and In862R, In434F and In862R, In756F and In1567R.
3, the related reagent for preparing the total DNA of invasion South America red fire ant fast.Total DNA prepares reagent and mainly comprises total DNA extraction damping fluid at ant.Consisting of of this extraction damping fluid: 20mM Tris-Cl (pH 8.0), 20mM EDTA (pH 8.0), 400mM NaCl and 1% (M/V) SDS.
Four, final purpose of the present invention provides the method for utilizing above-mentioned Nucleotide, nucleic acid molecular probe or test kit Rapid identification invasion South America red fire ant.
Utilize the mentioned reagent box, can be easily and fast and identify invasion South America red fire ant accurately according to the PCR method of routine.The method of evaluation invasion provided by the present invention South America red fire ant can adopt making nucleic acid molecular hybridization method or PCR method.Division is as follows:
The making nucleic acid molecular hybridization method: adopt foregoing 5 kinds of molecular probes, in general making nucleic acid molecular hybridization mode to total DNA of invasion South America red fire ant evaluation of testing.Concrete steps and process (comprising the pre-treatment of the mark and the testing sample of probe) all molecular biology method according to routine are carried out.
PCR method: with 3 pairs of invasion South America red fire ant specific PCR primers (In244F and In862R, In434F and In862R, In756F and In1567R) total DNA of sample is carried out PCR and test.Reactions steps and process are all carried out according to conventional PCR method.Adopt PCR method, can identify invasion South America red fire ant fast and accurately, and required sample size is little, total DNA of an ant sample to be measured detects needs with regard to the conventional PCR that enough carries out more than 10 times.
Compared with prior art, the present invention has following beneficial effect:
1, the rDNA intergenic region (ITS) between each species of Formicidae is the hypervariable region, and there is very big-difference in ant class ITS district not of the same race, even all differences to some extent on length.Not only there is the length specificity in the ITS district of invasion South America red fire ant, and a large amount of insertion/deficient phenomena in its sequence, and the sequence signatures such as repeatedly tumor-necrosis factor glycoproteins of the weak point of a large amount of similar little satellites, all help carrying out the objective analysis of computerize, instrumentation, and can be accurate to the design of the specific probe of planting.
2, required sample size is few, and the DNA that the ant total DNA extraction method that utilizing provides among the present invention obtains enough carries out the detection of tens conventional PCR method.If adopt other method, the isotropic substance/fluorescent mark of probe for example, nest-type PRC, or technology such as capillary electrophoresis can also further reduce the consumption of test sample.
3, simple and fast.Only, just can judge accurately whether tested ant kind is invasion South America red fire ant by simple DNA extraction and conventional PCR experiment.
4, be fit to general molecular biology reviewer and use, do not require abundant morphologic knowledge.Whole experimental implementation is not high for the requirement of laboratory apparatus and reagent.And got rid of subjectivity, do not require that the reviewer has the experience that ant morphology is identified yet.
5, inspecting standard is tight.Because the present invention includes three pairs of Auele Specific Primer combinations, can simultaneously parallelly independently check, can get rid of the experimental implementation error to greatest extent.Make the result more tight, accurate.
6, do not relate to poisonous, deleterious reagent.
7, the present invention can directly apply to customs quarantine control, the detection of flowers foreign trade of exotic invasive South America red fire ant, and aspects such as the early warning of invasion South America red fire ant epidemic situation and control, has advantages such as rapidity, objectivity and accuracy.
Description of drawings
Fig. 1 is a rrna rRNA gene structure synoptic diagram;
Fig. 2 is that invasion South America red fire ant specific molecular probe and PCR special primer are combined in mutual alignment, the direction relations synoptic diagram on its ITS district dna sequence dna;
Fig. 3 concerns synoptic diagram for ITS district and the specific molecular probe position of invasion South America red fire ant rDNA;
Fig. 4 is the amplification of invasion South America red fire ant specific PCR primer for 4 kinds of total dna profilings of ant;
Fig. 5 is the amplification of invasion South America red fire ant specific PCR primer (In756F/In1567R) for 4 kinds of total dna profilings of ant;
Wherein, among Fig. 4, M is the 2kb molecular criteria, and 1 is invasion South America red fire ant, and 2 is tropical red fire ant, and 3 is the huge first ant of nearly edge, and 4 is bitooth multi-ant, and N is a blank; Among the figure, the left side is the product that Auele Specific Primer combination In244F/In862R carries out pcr amplification; Right-hand part is the result that Auele Specific Primer combination In434F/In862R carries out pcr amplification;
Among Fig. 5, M is the 2kb molecular criteria, and 1 is invasion South America red fire ant, and 2 is tropical red fire ant, and 3 is the huge first ant of nearly edge, and 4 is bitooth multi-ant, and N is a blank.
Embodiment
The preparation of embodiment 1 invasion South America red fire ant rDNA transcribed spacer (ITS district) nucleotide sequence
Get the invasion South America red fire ant sample of 1 alcohol-pickled preservation and put into the 1.5ml centrifuge tube.A small amount of cooled with liquid nitrogen is frozen crisp.Grind slightly, pulverize sample.Adding 500ul extraction damping fluid (20mM Tris-Cl pH 8.0,20mM EDTA pH 8.0,400mM NaCl, 1%SDS), Proteinase K (20mg/ml) 10ul.55 ℃ of incubations, concussion (750rpm) digestion is more than 5 hours.Phenol: chloroform: primary isoamyl alcohol (25: 24: 1) extracting.Ethanol sedimentation spends the night.Return moltenly with an amount of TE, obtain total DNA of invasion South America red fire ant.
Carry out the PCR in ITS district then, the primer is respectively LH2 (5 ' CGTAGGTGAACCTGCGGAAGGATC 3 ') and Sm73 (5 ' TTCGCTCGCCGTTACTAGGGGAATC 3 ').Get the PCR pipe of a 200ul, add the 20ulPCR reaction solution and (wherein contain 2.0mM MgCl
2, 200uM dNTP, 10 * Taq DNA damping fluid 2ul, 1U Taq archaeal dna polymerase, each primer 10pmol).The total DNA0.1ul that adds red fire ant then.By follow procedure carry out PCR:94 ℃ 4 minutes, 94 ℃ 1 minute, 50 ℃ 1 minute and 72 ℃ 2.5 minutes, 30 circulations, then 72 ℃ 10 minutes, finish reaction.Reaction product is the rDNA intergenic region (ITS) of the red fire ant of the about 2500bp of length.PCR product behind the purifying is measured on the commercialization automatic dna sequencer, obtains sequence shown in SEQ ID No:1.Position and constitutional features as shown in Figure 1, among Fig. 1, the ITS district comprises ITS1,5.8S rRNA gene and three parts of ITS2, just the transcribed spacer part between 18S rRNA gene and the 28S rRNA gene.
The design and the preparation of embodiment 2 specific molecular probes
On the basis that obtains invasion South America red fire ant rDNA transcribed spacer nucleotide sequence, the homologous sequence of itself and close other ant kind is arranged comparison, be different from the exclusive sequence signature of other ant kind at invasion South America red fire ant, design the good probe of specificity (oligonucleotide fragment).According to the sequence of oligonucleotide fragment, on business-like dna synthesizer, carry out chemosynthesis.Five kinds of synthetic nucleic acid molecule probes, as follows:
In244F：5’ATCTTGGTGGAATTGACGAC 3’
In434F：5’GACGGGAGGGAAGAAAAGAC 3’
In756F：5’TGCTTAGCACGCTGGGAT 3’
In862R：5’AGAGACCGCCGAGAAGTGC 3’
In1567R：5’ACAACCGCGAGAGGGACTAT 3’。Invasion South America red fire ant specific molecular probe and PCR special primer are combined in mutual alignment on its ITS district dna sequence dna, direction relations synoptic diagram as shown in Figure 2, among Fig. 2, indicated 5 the rivet positions of specific molecular probe on ITS district gene, the 3 pairs of PCR special primers are combined into the performing PCR amplification and obtain expecting the synoptic diagram of product.
ITS district and the specific molecular probe position of invasion South America red fire ant rDNA concern that synoptic diagram as shown in Figure 3.Among Fig. 3, the boldface type partial sequence of shade is respectively 5 specific molecular probe bonded exact positions, and the direction of arrow on sequence top is represented the amplification direction of PCR primer.
The discriminating (conventional PCR method) of embodiment 3 invasion South America red fire ants
One, the extraction of sample total DNA.
Get each 1 in every kind of ant sample to be measured, put into the 1.5ml centrifuge tube respectively.Add a small amount of cooled with liquid nitrogen, freeze crisp.Grind slightly, pulverize sample.Adding 500ul extraction damping fluid (20mM Tris-Cl pH 8.0,20mM EDTApH 8.0,400mM NaCl, 1%SDS), Proteinase K (20mg/ml) 10ul.55 ℃ of incubations, concussion (750rpm) digestion is more than 5 hours.Phenol: chloroform: primary isoamyl alcohol (25: 24: 1) extracting.Ethanol sedimentation spends the night.Return moltenly with an amount of TE, obtain total DNA of testing sample.
Two, PCR detects
(1) PCR response procedures:
Be general general response procedures, but at each to different primers, adopt the suitableeest annealing temperature accordingly.The corresponding relation of the suitableeest annealing temperature and combination of primers sees Table 1.
Table 1 three pairs of invasions South America red fire ant specific PCR combination of primers and optimum reaction condition
| Combination of primers | Tm(℃) | The suitableeest annealing temperature (℃) | Expection product length (bp) |
| In244F/In862R In434F/In862R In756F/In1567R | 53.4/59.5 57.4/59.5 54.9/57.4 | 56.5 59 55.5 | 637 447 831 |
(2) PCR reaction system:
| 10×PCR buffer(without Mg 2+TAKARA company) MgCl 2(25mM TAKARA company) dNTP (10mM each TAKARA company) DMSO Primerl (0.2r/ μ l) Primer2 (0.2r/ μ l) dna profiling (diluting 10 times) Taq (5U/ μ l TAKARA company) 3dH2O | 2.0μl 1.2μl 1.25μl 1.0μl 0.5μl 0.5μl 2.0μl 0.2μl up to 20μl |
(3) detection of PCR product and interpretation of result:
Agarose electrophoresis with 1% detects the PCR product.Fig. 4 has shown the result who four kinds of different ant kinds that comprise invasion South America red fire ant is carried out the PCR detection with 3 pairs of different invasion South America red fire ant specificity primers respectively with Fig. 5.
(4) from Fig. 4 and Fig. 5 as can be seen, the combination of the three pairs of Auele Specific Primers is to all positive result of invasion South America red fire ant, and other ant kind is negative findings.The close ant kind with other of differentiation invasion South America red fire ant that these three pairs of combination of primers all can be good is described, has specificity at invasion South America red fire ant.
Identify method of invasion South America red fire ant and used nucleotide sequence, probe and test kit sequence table
＜110〉Zhongshan University
＜120〉identify method of invasion South America red fire ant and used nucleotide sequence, probe and test kit
<160>6
<210>1
<211>2499
<212>DNA
＜213〉South America red fire ant (Solenopsis invicta)
<220>
<221>rRNA
<222>(25)...(2474)
＜223〉rrna rRNA internal gene transcribed spacers
<400>1
cgtaggtgaa cctgcggaag gatcattaac gttccggagg ctgcgctctg ctccgcgcgc 60
gcgcactcgt gtgtgctgcg gcagtgtgag acggcggcga ctggaagagg acgacgcgcg 120
cctttttctc agaaaaggcg atgcgcgtcg cagacagaaa gaacgcaccg tggcgagcgc 180
gacagcgcga gccaacgcgt gcgagatctc gcgtggaatt gacggataga gagagcaagc 240
gagatcttgg tggaattgac gactgtttga acgaggagag cgtcgcggtg ttcggtcgcc 300
ccgcgagggg cggctctcac ctccgagcgc gcactgcctc tcgactctcg ccgtcgcgtc 360
gcccgtcccc gcgcgtcgcc ggcgcgcgct ctcgtcagcg cgcgccgccg ccggggaatt 420
ggtgagcgat gtcgacggga gggaagaaaa gacccaaaga tattcggact aaccgagtgg 480
ttgtcgatgc gcgacccgca ccacgcacca ccgaacgtgt gcgccgatcc gtccgtccga 540
tcggtccgcg cgcgccacaa cgcgtcgtcg cgacgcgttg cgtctggctc gcacccgcgg 600
atcggaggag attgagaacg gagaggaccg cgccgtcgtt gtgtgccgtg cgtctgccgt 660
tggtcgcgcg tcgacgcgtt ccgcgcgtcc ggtgccgtcg cgcaccgcgc gttggatcgc 720
gggcgatgga ggagcgaggc gccgcgcccc gcgcgtgctt agcacgctgg gataagcgcg 780
cgcttaccgg tggtaacctg agagccgcgt tttcgcacgc gtgtcgtgtg cgttacgcgc 840
gctgcagggg cgagagcagc cgcacttctc ggcggtctct cgcgcccgat ggtttttcaa 900
agacttccgc cccggctctc gcgctcgtgc cccgtgctcg cgtgctctcc gcgagacggg 960
cgatgagccg agagacgctc cgttcgctcg accaagtggc accgccaccg cggaccgcgt 1020
agtcggtccg cgcgcgttgc ggtgccaccg gtgtcccgtt gtgccgtagc ccccgtaaac 1080
ggggcggcgg tccgcgcgtg ctcggacgcg cggccaggct gatcgaaggg ccccacaaag 1140
cacacatgag acgcacaagg gaggatgaaa gctcgctcgc acaagttgtc gagatggagc 1200
tcccgcgtag cgggaagaat gtacaaacga ttaccctgaa cggtggatca cttggctcgt 1260
gggtcgatga agaacgcagc taattgcgcg tcaacttgtg aactgcagga cacatgaaca 1320
tcgacatttc gaacgcacat tgcggtccac ggatacaatt cccggaccac gcctggctga 1380
gggtcgtttt aacgaaagca cactgcttgc gccgtcgcgc gcacgcggct cggcgtcgcg 1440
cctcgacacg cacgtgtcga gcgcgcgcgc gcgcagggcc gcgttacgcg cgcgcacacg 1500
gcgtacgagc gatcgttgga cgctcgcccc gaaaaacgac gaagacgcaa acgccgcaga 1560
ggacggatag tccctctcgc ggttgtcgac tcgttggagc gcgcgcgagc gcacagggca 1620
ccacgggacc gctcctcgca tcctcgcttc ttcccgtagg gaaggaggag atataggcga 1680
gcgattgccg gtctcgcgcc gctgtttagc gccgcgtcgt ccgcaccaca aatcggggcg 1740
tcgtccgaaa tgacggaagg gaaacgtgac gagagcgaag cgcgcgcgcc tcttctctcg 1800
gtgcgcgcat attcgcgcgc gcgtgcgccg cgaggtgtcg gtgccgccgt cgccgcccgg 1860
ggacccaccc gcgcccgccc gtaataaggg tataggcgca ggcagtaggg tctcgcggag 1920
ctgcgtgcga gcgcgcccag caacacccgg cgtatcgtcg tacgcgcgaa gcgtgtcatc 1980
ttcgagcgag agagagcgcg cgaggagagc tcgtattgga actcgcggcg agccggccgc 2040
gtgtccgagt ccacgaaaga gtcttcttct ctttcctctt ccccggttcg cccggcgcgc 2100
gctaccgcgc gccgaggttg taaacccgcg agtgggagga taacggaaag aagagagact 2160
tgggaccggc gcgcacggtc gcgtgtactc gtcgcgcgaa gagtgtccga ttcgtcgtcg 2220
tcgttgagcc ctttcagcac gcgcacacgc gcggtgcccg gttgcgagcg tcgccgtccg 2280
cccgttctac ctactcgatt atatctataa gatatagaga gaaggtggga ggtgtttgcg 2340
cgcggtacgg agcgacgcgc agcctacgcg ccgtcgtcgt cgtcgtcgtc gcacaatttc 2400
gacgacctca gagcaggcga gatcacccgc tgaatttaag catattatta agcggaggaa 2460
aagaaactaa ccaggattcc cctagtaacg gcgagcgaa 2499
<210>2
<211>20
<212>DNA
＜213〉South America red fire ant (Solenopsis invicta)
<220>
<221>rRNA
<222>(1)...(20)
＜223〉specific molecular probe that designs according to rrna rRNA internal gene transcribed spacers correlated series
Identify method of invasion South America red fire ant and used nucleotide sequence, probe and test kit sequence table
<400>2
atcttggtgg aattgacgac 20
<210>3
<211>20
<212>DNA
＜213〉South America red fire ant (Solenopsis invicta)
<220>
<221>rRNA
<222>(1)...(20)
＜223〉specific molecular probe that designs according to rrna rRNA internal gene transcribed spacers correlated series
<400>3
gacgggaggg aagaaaagac 20
<210>4
<211>18
<212>DNA
＜213〉South America red fire ant (Solenopsis invicta)
<220>
<221>rRNA
<222>(1)...(18)
＜223〉specific molecular probe that designs according to rrna rRNA internal gene transcribed spacers correlated series
<400>4
tgcttagcac gctgggat 18
<210>5
<211>19
<212>DNA
＜213〉South America red fire ant (Solenopsis invicta)
<220>
<221>rRNA
<222>(1)...(19)
＜223〉specific molecular probe that designs according to rrna rRNA internal gene transcribed spacers correlated series
<400>5
agagaccgcc gagaagtgc 19
<210>6
<211>20
<212>DNA
＜213〉South America red fire ant (solenopsis invicta)
<220>
<221>rRNA
<222>(1)...(20)
＜223〉specific molecular probe that designs according to rrna rRNA internal gene transcribed spacers correlated series
<400>6
acaaccgcga gagggactat 20
Claims (10)
1, a kind of nucleotide sequence that is used to identify invasion South America red fire ant is characterized in that this nucleotide sequence derives from invasion South America, Wuchuan, Guangdong red fire ant rDNA transcribed spacer, and its nucleotide sequence is shown in SEQ ID NO:1.
2, one group of nucleic acid molecular probe that is used to identify invasion South America red fire ant, its derive from the complete sequence of the described nucleotide sequence of claim 1 or wherein one section be no less than 18 oligonucleotide sequences, perhaps above-mentioned sequence is modified, variation and Nucleotide variable quantity are no more than 5% sequence.
3, nucleic acid molecular probe according to claim 2, it is characterized in that described nucleic acid molecular probe is following five kinds: In244F, In434F, In756F, In862R, In1567R, its nucleotide sequence are respectively shown in SEQ IDNO:2～6.
4, a kind of test kit that is used to identify invasion South America red fire ant is characterized in that this test kit comprises claim 2 or 3 described nucleic acid molecular probes, three pairs of PCR primers and is used to prepare the related reagent of invading the total DNA of South America red fire ant.
5, test kit according to claim 4 is characterized in that described three pairs of PCR primers are respectively: In244F and In862R, In434F and In862R, In756F and In1567R.
6, test kit according to claim 4, it is characterized in that the described related reagent that is used to prepare the total DNA of invasion South America red fire ant is the total DNA extraction damping fluid at ant, it consists of: 20mM Tris-Cl (pH8.0), 20mM EDTA (pH8.0), 400mM NaCl and 1% (M/V) SDS.
7, a kind of method of identifying invasion South America red fire ant is characterized in that adopting PCR method or making nucleic acid molecular hybridization method or the described test kit of claim 4.
8, method according to claim 7, it is characterized in that described PCR method is: invade South America red fire ant specific PCR primers with 3 pairs: In244F and In862R, In434F and In862R, In756F and In1567R, total DNA to sample carries out the PCR experiment, and reactions steps and process are all carried out according to conventional PCR method.
9, method according to claim 7, it is characterized in that described making nucleic acid molecular hybridization method is: adopt claim 2 or 3 described molecular probes, to total DNA of invasion South America red fire ant evaluation of testing, concrete steps and process are all carried out according to the molecular biology method of routine in general making nucleic acid molecular hybridization mode.
10, method according to claim 7 is characterized in that described employing test kit for utilizing described test kit, identifies according to the PCR method of routine and invades the South America red fire ant.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005101005200A CN100402666C (en) | 2005-10-21 | 2005-10-21 | Method of identifying invasion of south American glim ant and its nucleic acid sequence, probe and reagent kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005101005200A CN100402666C (en) | 2005-10-21 | 2005-10-21 | Method of identifying invasion of south American glim ant and its nucleic acid sequence, probe and reagent kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1772922A true CN1772922A (en) | 2006-05-17 |
| CN100402666C CN100402666C (en) | 2008-07-16 |
Family
ID=36760060
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2005101005200A Expired - Fee Related CN100402666C (en) | 2005-10-21 | 2005-10-21 | Method of identifying invasion of south American glim ant and its nucleic acid sequence, probe and reagent kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100402666C (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101096708B (en) * | 2007-07-03 | 2011-07-27 | 浙江大学 | Nucleic acid sequence for identifying zhejiang source scrophularia root, nucleic acid molecule probe and method |
| CN117089631A (en) * | 2023-10-13 | 2023-11-21 | 中国热带农业科学院三亚研究院 | Sequence combination for rapidly detecting solenopsis invicta based on CRISPR/Cas12a-RPA and application thereof |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR102143094B1 (en) * | 2019-05-30 | 2020-08-10 | 한림대학교 산학협력단 | Molecular diagnostic method using venom gland-specific gene of Red imported fire ant, Solenopsis invicta 11108 |
| KR102143095B1 (en) * | 2019-05-30 | 2020-08-10 | 한림대학교 산학협력단 | Molecular diagnostic method using venom gland-specific gene of Red imported fire ant, Solenopsis invicta 11977 |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| TW585921B (en) * | 1997-07-10 | 2004-05-01 | Res Dev Foundation | Species specific monoclonal antibodies and phage displayed Fab and scFV fragments for fragments for targeted destruction of imported fire ants |
| US6551800B1 (en) * | 1999-10-26 | 2003-04-22 | The Board Of Regents, The University Texas System | Recombinant materials for production of a protein toxic to fire ants |
-
2005
- 2005-10-21 CN CNB2005101005200A patent/CN100402666C/en not_active Expired - Fee Related
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101096708B (en) * | 2007-07-03 | 2011-07-27 | 浙江大学 | Nucleic acid sequence for identifying zhejiang source scrophularia root, nucleic acid molecule probe and method |
| CN117089631A (en) * | 2023-10-13 | 2023-11-21 | 中国热带农业科学院三亚研究院 | Sequence combination for rapidly detecting solenopsis invicta based on CRISPR/Cas12a-RPA and application thereof |
| CN117089631B (en) * | 2023-10-13 | 2024-02-06 | 中国热带农业科学院三亚研究院 | Sequence combination for rapidly detecting solenopsis invicta based on CRISPR/Cas12a-RPA and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN100402666C (en) | 2008-07-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1814805A (en) | H5, H7, H9 subtype auian flu virus real-time fluo rescent quantixative PCR detecting method | |
| CN1526022A (en) | Testing endosymbiont cellular organelles and compounds identifiable therewith | |
| CN1696311A (en) | Biochip for detecting pathogenesis fungus | |
| CN1518603A (en) | Method of determining dihydropyrimidine dehyolrogenase gene expression | |
| CN1274846C (en) | Assay systems, kits and methods for detecting microorganisms | |
| CN101045943A (en) | Process of PCR detecting salmonella with added amplifying internal standard | |
| CN1772922A (en) | Method of identifying invasion of south American glim ant and its nucleic acid sequence, probe and reagent kit | |
| CN1873019A (en) | Quick method for testing chain reaction of multiple reverse transcription polymerase of lily virus | |
| CN1724689A (en) | Strain specificity PCR detection method of heredity modified corn strain MON863 | |
| CN1824801A (en) | Real-time fluorescent PCR testing primer, probe and immobilized kit for citrus ulcer bacteria and testing process thereof | |
| CN1900314A (en) | Fluorescence labelling ABO gene typing method and its reagent kit | |
| CN1724686A (en) | Target sequence used for detecting mycoplasma pnoumoniae and reagent box | |
| CN1215177C (en) | Gene chip used for identifying pathogenic bacteria in blood and its making method | |
| CN1303223C (en) | Idiocratic amplification primer in medicolegal insect flies and authentication method | |
| CN101045942A (en) | Transgenic papaya and detection of transgenic component in transgenic papaya product | |
| CN101041854A (en) | Polymorphism sites of primary liver cancer correlative coding small molecule RNA and usage thereof | |
| CN1661112A (en) | Detection reagent for shiga toxin family gene of entero-hemorrhagic escherichia coli | |
| CN1188530C (en) | Gene detection reagent kit for SARS virus and its detection method | |
| CN100351395C (en) | Norwalk virus expression detecting kit and its special primer and probe | |
| CN1710097A (en) | Insitu method for rapid qualitative identification of red tide micro algae | |
| CN1810988A (en) | Method and kit for detecting ox and sheep components in feed | |
| CN1904064A (en) | Star shaped nocardia multiple PCR fast detection kit and detection method | |
| CN1696309A (en) | Kit for testing transgene cottonseed and products produced, and testing method | |
| CN1900315A (en) | Method for screening high quality spirulina princeps strain for large scale production | |
| CN1730662A (en) | Method of qualitative and quantitative analysis for algae |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20080716 Termination date: 20091123 |