KR102143095B1 - Molecular diagnostic method using venom gland-specific gene of Red imported fire ant, Solenopsis invicta 11977 - Google Patents

Abstract

The present invention relates to a composition for diagnosis of Solenopsis invicta for detecting a Sinv11977 gene, a kit for diagnosis of Solenopsis invicta including the composition, and a method of providing information for diagnosis of Solenopsis invicta using the composition or kit. According to the composition for diagnosis of Solenopsis invicta, the kit for diagnosis of Solenopsis invicta, the method of providing information for diagnosis of Solenopsis invicta, and a primer set for diagnosis of Solenopsis invicta of the present invention, it is possible to detect the Sinv11977 gene and use the same for diagnosis of Solenopsis invicta.

Description

Molecular diagnostic method using venom gland-specific gene of Red imported fire ant, Solenopsis invicta 11977}

The present invention relates to a composition for diagnosis of red fire ants for detecting Sinv11977 gene, a kit for diagnosis of red fire ants including the composition, and a method of providing information for diagnosis of red fire ants using the composition or kit.

The red imported fire ant (English: red imported fire ant, scientific name: Solenopsis invicta) is a species of ants belonging to the Antaceae family and is also called the red poison ant. It is toxic and not fatal to most people, but can be fatal to the elderly or some people with allergies. The composition of the red fire ant venom has a major difference from that of other logging insects. Peptide poisons of less than 200 amino acids are the main components of the poison of logging insects, whereas more than 90% of the venom of red fire ants are alkaloid compounds including solenopsin. Therefore, people stung by red fire ants feel severe pain, and in severe cases, anaphylaxis (severe allergic reaction) may be accompanied.

Currently, red fire ants have invaded and settled in the United States, Australia, China, Taiwan, the Philippines, India, the Caribbean, and New Zealand, and recently, red fire ants in ports in Korea and Japan have climates in which red fire ants can survive and reproduce. The discovery of individuals or colonies is reported every year. The damage caused by them is not limited to the destruction of the natural environment and agricultural and livestock products, but causes serious problems of attacking humans and destroying medical problems and buildings and infrastructure.

The control of the invading red fire ants costs enormous costs, but it is predicted that the damage that occurs if the control is not carried out is more enormous, so continuous efforts to prevent and eradicate them are required. As in the example of the United States and Australia, once a red fire ant invades and enters the settlement stage, it is impossible to completely eradicate it. Therefore, the most important step in controlling red fire ants is to detect the invasion of red fire ants early and remove them before settling.

Currently, a method using molecular markers is widely used to identify pests (Korean Patent Publication No. 10-2008-0036944), and in the case of red fire ants, a method of detecting and confirming a red fire ant-specific gene or protein is used. However, there is a problem in that the sensitivity is low.

Accordingly, the present inventors have tried to develop a method for efficiently and easily diagnosing red fire ants, and as a result of discovering a new gene specifically expressed in the red fire ant venom, and measuring the expression level of the gene, it is possible to diagnose red fire ants. The present invention was completed by developing a diagnostic composition.

Republic of Korea Patent Publication No. 10-2008-0036944

The first aspect of the present application is to provide a composition for diagnosing Sinv11977 (Solenopsis invicta 11977), characterized in that it detects the gene, red fire ant ( Solenopsis invicta ).

A second aspect of the present application is to provide a kit for diagnosis of red fire ants, including the composition for diagnosis of red fire ants.

A third aspect of the present application is to provide a method of providing information for diagnosing red fire ants, comprising the step of detecting a Sinv11977 gene from a biological sample isolated from a target individual.

A fourth aspect of the present application is, (a) a primer set comprising the nucleotide sequence of SEQ ID NO: 7 and the nucleotide sequence of SEQ ID NO: 8; And (b) provides a primer set for diagnosing red fire ants comprising at least one or more primer sets selected from the group consisting of a primer set comprising a nucleotide sequence of SEQ ID NO: 12 and a nucleotide sequence of SEQ ID NO: 13.

Specifically, it is as follows. Meanwhile, each description and embodiment disclosed herein may be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. In addition, the scope of the present application cannot be considered to be limited by the specific descriptions described below.

The first aspect of the present application provides a composition for diagnosing Sinv11977 (Solenopsis invicta 11977), characterized in that it detects the gene, red fire ants ( Solenopsis invicta, Red imported fire ants).

The term "red fire ant ( Solenopsis invicta, Red imported fire ant)" used throughout the specification of the present application is one of the species of ants, and is called a red poison ant, foreign red fire ant, or red fever ant in Korea. It is light brown and its body is dark reddish brown, its size is 3-6mm, and it is native to South America (Argentina). It is also an insect that has been designated as an ecosystem disturbance organism as of January 3, 2010. When stinged by the sting on the buttocks of a red fire ant, the solenopsin component causes severe pain, itchy wounds, and stings when symptoms worsen. Partial swelling begins and a rash appears on the body.In 0.6% to 6% of people, anaphylaxis (severe allergic reaction) occurs, such as shaking hands or narrowing of the pupils, dizziness, rapid heartbeat, shortness of breath, Symptoms of irritable shock such as lowering blood pressure and consciousness disorder may appear, and in this case, death may result if not treated.

The term "Sinv11977 (Solenopsis invicta 11977) gene" used throughout the specification of the present application is a gene specifically expressed in the venom of a red fire ant, and may include the nucleotide sequence of SEQ ID NO: 3, specifically It may be made up of a base sequence. In addition, the protein into which the gene is translated may include the amino acid sequence of SEQ ID NO: 4, and specifically may be composed of the amino acid sequence of SEQ ID NO: 4.

According to the exemplary embodiment of the present disclosure, the composition may be to detect a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 3 or a protein comprising the amino acid sequence of SEQ ID NO: 4.

According to the exemplary embodiment of the present application, the composition may be to detect a nucleic acid consisting of the nucleotide sequence of SEQ ID NO: 3 or a protein consisting of the amino acid sequence of SEQ ID NO: 4.

According to the exemplary embodiment of the present disclosure, the composition may further include a composition for detecting a Sinv11108 (Solenopsis invicta 11108) gene.

The term "Sinv11108 (Solenopsis invicta 11108) gene" as used throughout the specification of the present application is a gene specifically expressed in the venom of a red fire ant, and may include the nucleotide sequence of SEQ ID NO: 1. It may be made up of a base sequence. In addition, the protein into which the gene is translated may include the amino acid sequence of SEQ ID NO: 2, and specifically, may be composed of the amino acid sequence of SEQ ID NO: 2.

According to the exemplary embodiment of the present disclosure, the composition may be to detect a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 1 or a protein comprising the amino acid sequence of SEQ ID NO: 2.

According to the exemplary embodiment of the present application, the composition may be to detect a nucleic acid consisting of the nucleotide sequence of SEQ ID NO: 1 or a protein consisting of the amino acid sequence of SEQ ID NO: 2.

As used throughout the present specification, the term "gene detection" may be to measure the expression or level of expression of a specific gene or a protein encoded by the gene, but is not limited thereto.

According to the exemplary embodiment of the present disclosure, the composition may measure the expression level of the Sinv11977 gene and/or the DNA, cDNA, mRNA, or protein encoded by the Sinv11108, but is not limited thereto.

According to one embodiment of the present application, the method of measuring the DNA, cDNA, or mRNA level is a polymerase reaction (PCR), a real time polymerase reaction, Taqman real time polymerase reaction, a reverse transcriptase polymerization reaction (RT- PCR), competitive reverse transcriptase polymerase (RT-PCR), real time quantitative RT-PCR, quantitative RT-PCR, RNase protection method , Northern blotting or DNA chip technology (DNA chip technology) may be.

According to one embodiment of the present application, the method of measuring the level of the protein is Western blotting, ELISA (enzyme linked immunosorbent assay), radioimmunoassay (RIA), radioimmunoassay, radioactive immunodiffusion, Ouchterlony immunodiffusion, rocket immunoeletrophoresis, immunohistochemical staining, immunoprecipitation assay, complement fixation assay, immunofluorescence ), immunochromatography, fluorescence-activated cell sorter analysis, or protein chip technology.

According to one embodiment of the present application, the composition may include an agent capable of measuring the expression level of the Sinv11977 gene and/or the protein encoded by the gene.

According to one embodiment of the present application, the composition may further include an agent capable of measuring the expression level of the Sinv11108 gene and/or the protein encoded by the gene.

According to one embodiment of the present application, "an agent capable of measuring the expression level" refers to a molecule that can be used to confirm the expression level of a specific gene or a protein encoded by the gene, and specifically, the gene or the It may include an agent capable of detecting and/or amplifying a protein, but is not limited thereto.

As used throughout the present specification, the term "an agent capable of detecting a specific gene or protein" refers to an agent capable of specifically binding to the specific gene or protein to be recognized or detectable, and "a specific gene or protein Or an agent capable of amplifying a protein” refers to an agent capable of increasing the number of the specific gene or protein by repeating replication, for example, a polynucleotide comprising the gene can be specifically amplified It may mean a primer or a probe capable of specifically binding, but is not limited thereto.

The term "primer" as used throughout the present specification is a base sequence having a short free 3'hydroxyl group, which can form a base pair with a complementary template, and a template strand copy It refers to a short sequence that functions as a starting point for Primers can initiate DNA synthesis in the presence of a reagent for polymerization (ie, DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates at an appropriate buffer and temperature. At this time, PCR conditions, the length of the sense and antisense primers can be modified based on those known in the art.

The primers used to detect or measure the expression level of the gene are appropriate conditions in an appropriate buffer (e.g., 4 different nucleoside triphosphates and a polymerization agent such as DNA, RNA polymerase or reverse transcriptase) and an appropriate temperature. It may be a single-stranded oligonucleotide that can serve as a starting point for template-directed DNA synthesis under, and the appropriate length of the primer may vary depending on the purpose of use, but is usually 15 to 30 nucleotides. Short primer molecules generally require a lower temperature to form a stable hybrid with the template. The primer sequence does not need to be completely complementary to the polynucleotide of the region for measuring the expression level of the gene, but must be sufficiently complementary to hybridize.

The probe used to detect or measure the expression level of the gene may mean a DNA-inserted fluorescent substance or a hybridization probe, and the hybridization probe is an oligonucleotide and peptide nucleic acid capable of sequence-specific binding to a complementary strand of a nucleic acid. (peptide nucleic acid). The probe may be used in a kit or method for diagnosing red fire ants by measuring the expression level of a gene, and specifically, a substance capable of binding to double-stranded DNA such as SYBR green and Cyto fluorescent substances, or a TaqMan probe (5 A substance that removes fluorescence by binding to a fluorescent substance at the end and a fluorescent substance at the end 3 may be used. Fluorescent materials that can be used in TaqMan probes are Biosearch Blue, 6-carboxyfluorescien (FAM), TET, CAL Fluor Gold 540, Quasar 570, Cy ^Tm 3, NED, TAMRA, CAL Fluor Red 610, Cy5, Qusar 670, Cy5.5 , Quasar 705, Flamma fluophore, ALEXA flurophores, but are not limited thereto, and materials that eliminate fluorescence are Black hole quencher 1, Black hole quencher 2, Black hole quencher 3, Zen-Iowa Balck FQ, Iowa Balck RQ and TAO-IOWA Black RQs may be included, but are not limited thereto. The probes of interest can be labeled to detect, for example, radioisotopes, fluorescent compounds, bioluminescent compounds, chemiluminescent compounds, metal chelates or enzymes. Properly labeling such a probe is a technique well known in the art, and can be performed through a conventional method.

According to one embodiment of the present application, the primer or probe may be chemically synthesized using a phosphoramidite solid support method, or other well-known method. Such nucleic acid sequences can also be modified using many means known in the art. Non-limiting examples of such modifications include methylation, encapsulation, substitution of one or more homologs of natural nucleotides, and modifications between nucleotides, e.g., uncharged linkers (e.g., methyl phosphonate, phosphorester, phosphoro Amidates, carbamates, etc.) or to charged linkers (eg phosphorothioate, phosphorodithioate, etc.).

According to one embodiment of the present application, the composition may include a primer set including a nucleotide sequence of SEQ ID NO: 7 and a nucleotide sequence of SEQ ID NO: 8, and specifically, the composition is a PCR reaction of the Sinv11977 gene or SYBR green in real time. It may be detected using a PCR reaction, but is not limited thereto.

According to one embodiment of the present application, the composition may include a primer set consisting of a nucleotide sequence including a nucleotide sequence of SEQ ID NO: 12 and a nucleotide sequence of SEQ ID NO: 13, and specifically, the composition includes a Sinv11977 gene and TaqMan in real time. It may be detected using PCR, but is not limited thereto.

According to the exemplary embodiment of the present disclosure, the composition may further include a probe including the nucleotide sequence of SEQ ID NO: 13, and the probe is 6-carboxyfluorescien (FAM) at the 5'end of the nucleotide sequence of SEQ ID NO: 13 As described above, lack hole quencher 1 (BHQ1) may be bound to the 3'end, and specifically, the composition may detect the Sinv11977 gene using TaqMan real-time PCR, but is not limited thereto.

According to the exemplary embodiment of the present disclosure, the composition may further include a primer set including a nucleotide sequence of SEQ ID NO: 5 and a nucleotide sequence of SEQ ID NO: 6, and specifically, the composition is a Sinv11977 gene and/or a Sinv11108 gene. May be detected using a PCR reaction or a SYBR green real-time PCR reaction, but is not limited thereto.

According to one embodiment of the present application, the composition may further include a primer set consisting of a nucleotide sequence including a nucleotide sequence of SEQ ID NO: 9 and a nucleotide sequence of SEQ ID NO: 10, and specifically, the composition includes a Sinv11977 gene and / Or the Sinv11108 gene may be detected using TaqMan real-time PCR, but is not limited thereto.

According to the exemplary embodiment of the present application, the composition may further include a probe including the nucleotide sequence of SEQ ID NO: 11, and the probe is 6-carboxyfluorescien (FAM) at the 5'end of the nucleotide sequence of SEQ ID NO: 11 May be a combination of lack hole quencher 1 (BHQ1) at the 3'end, specifically, the composition may be to detect Sinv11977 gene and/or Sinv11108 gene using TaqMan real-time PCR, but is not limited thereto. .

The term "diagnosis" used throughout the specification of the present application means to determine whether an individual ant is a red fire ant, and may mean classification identification of red fire ants or confirmation of red fire ants.

According to one embodiment of the present application, the composition may specifically diagnose or confirm only red fire ants among any ant individual, specifically, red fire ants ( Solenopsis invicta, Si ), tropical fire ants ( Solenopsis geminate, Sg), Japanese ant ( Solenopsis japonica, Sj), ant ( Lasius niger, Ln ), ant ( Formica japonica, Fj ), ant ( Crematogster sp., C.sp. ), ant ( Tetramorium caespitum, Tc. ), Acromymer echinatior, Atta cephalotes, Camonotus floridanus, Cardiocondyla obscurior, Cerapachys biroi, Harpergnathos saltator, Linepithema humile, and Pogonomyrmex barbtus , among 15 ants, which may specifically diagnose red fire ants, but are not limited thereto. .

According to an embodiment of the present application, the Sinv11977 gene and the Sinv11108 gene that are specifically expressed only in the poison gland of red fire ants are tropical fire ants ( Solenopsis geminate, Sg), Japanese row ants ( Solenopsis japonica, Sj), and beetle hair ants ( Lasius niger. , Ln ), bear ants ( Formica japonica, Fj ), tail ants ( Crematogster sp., C.sp. ) and wrinkle ants ( Tetramorium caespitum, Tc ) were not detected at all (Experimental Example 2), Acromymer echinatior, Atta cephalotes, Camonotus floridanus, Cardiocondyla obscurior, Cerapachys biroi, Harpergnathos saltator, Linepithema humile, and Pogonomyrmex barbtus ants were not found to have high homology with the Sinv11977 gene and the Sinv11108 gene (Experimental Example 3). It can be seen that red fire ants can be diagnosed by detecting specifically expressed Sinv11977 gene or Sinv11108 gene.

The second aspect of the present application provides a kit for diagnosis of red fire ants, including the composition for diagnosis of red fire ants. The content that overlaps with the first aspect also applies to the red fire ant diagnostic kit on the second aspect.

According to one embodiment of the present application, the kit may be an RT-PCR kit, qRT-PCR kit, DNA chip kit, Western blot kit, or ELISA kit, and specifically, a PCR kit, a real-time PCR kit, SYBR green real-time PCR Kit or TaqMan real-time PCR kit may be, but is not limited thereto.

According to one embodiment of the present application, the kit may include a polynucleotide, cDNA, mRNA, polypeptide, etc. of the present application, as well as other constituent compositions, solutions, or devices suitable for analysis methods.

According to one embodiment of the present application, the PCT kit may be a kit including essential elements necessary for performing PCR. PCR kits, in addition to the polynucleotides, primers or probes specific for the Sinv11977 gene and/or the Sinv11108 gene, a test tube or other suitable container, a reaction buffer (varies in pH and magnesium concentration), deoxynucleotides (dNTPs), Taq- Enzymes such as polymerase and reverse transcriptase, DNase, RNAse inhibitors, DEPC-water, sterile water, and the like.

According to one embodiment of the present application, the real-time PCR kit may be a kit including essential elements necessary to perform real-time PCR-in addition to a specific polynucleotide, primer or probe for the Sinv11977 gene and/or Sinv11108 gene, SYBR DNA insertion fluorescent materials such as green, Taqman probes, etc. may be included.

According to one embodiment of the present application, the DNA chip kit may be a kit including essential elements necessary to perform a DNA chip, and the DNA chip kit is a specific polynucleotide, primer for the Sinv11977 gene and/or Sinv11108 gene. Alternatively, a substrate to which a probe is attached may be included, and the substrate may include a nucleic acid corresponding to a quantitative control gene or a fragment thereof.

According to one embodiment of the present application, the RT-PCR kit may be a kit including essential elements necessary for performing RT-PCR, and the RT-PCR kit is specific for the Sinv11977 gene and/or Sinv11108 gene. In addition to individual primers, test tubes or other suitable containers, reaction buffers (varies in pH and magnesium concentration), deoxynucleotides (dNTPs), didioxynucleotides (ddNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase , RNAse inhibitors, DEPC-water, sterile water, and the like.

A third aspect of the present application provides a method of providing information for diagnosing red fire ants, including the step of detecting the Sinv11977 gene from a biological sample isolated from a target individual. The content overlapping with the first side and the second side also applies to the method of providing information for diagnosis of red fire ants on the third side.

The term "individual" as used throughout the specification of the present application means all organisms suspected of being red fire ants, and as a specific example, may be any ant individual.

According to an embodiment of the present application, the object of interest is a red fire ant ( Solenopsis invicta, Si ), a tropical fire ant ( Solenopsis geminate, Sg), a Japanese row ant ( Solenopsis japonica, Sj), a beetle hair ant ( Lasius niger, Ln ), bear ant ( Formica japonica, Fj ), tail ant ( Crematogster sp., C.sp. ), wrinkle ant ( Tetramorium caespitum, Tc ), Acromymer echinatior, Atta cephalotes, Camonotus floridanus, Cardiocondyla obscurior, Cerapachys biroi, Harpergnath saltos biroi, , Linepithema humile and Pogonomyrmex barbtus may be included, but is not limited thereto.

As used throughout the specification, the term "biological sample" refers to a material derived from an individual that is likely to be a red fire ant, and specifically may include tissue, cells, whole blood, serum, plasma, saliva, etc. It does not become. In addition, a gene sample may be obtained from these samples, and the gene sample may include a nucleic acid, for example, DNA, mRNA, or cDNA synthesized from mRNA, and the expression level of a specific gene/protein can be confirmed or As far as it can be detected, the type is not limited thereto.

According to one embodiment of the present application, the method comprises the step of detecting a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 3 or a protein comprising an amino acid sequence of SEQ ID NO: 4 from a biological sample isolated from a target individual. I can.

According to one embodiment of the present application, the step of detecting the Sinv11977 gene may be to use a composition including a primer set including a nucleotide sequence of SEQ ID NO: 7 and a nucleotide sequence of SEQ ID NO: 8.

According to one embodiment of the present application, the step of detecting the Sinv11977 gene may be to use a composition comprising a primer set including a nucleotide sequence of SEQ ID NO: 12 and a nucleotide sequence of SEQ ID NO: 13, and additionally, a base of SEQ ID NO: 14 It may be to additionally use a probe containing the sequence.

According to the exemplary embodiment of the present disclosure, the detecting of the Sinv11977 gene may be a PCR reaction, a real-time PCR reaction, a SYBR green real-time PCR reaction, or a Taqman real-time PCR reaction, but is not limited thereto.

According to the exemplary embodiment of the present disclosure, when the Sinv11977 gene is detected, the step of diagnosing the individual as a red fire ant may be further included.

According to one embodiment of the present application, the method comprises the steps of measuring the Sinv11977 gene expression level from a biological sample isolated from a control; And comparing the expression levels of the Sinv11977 gene of the individual and the control.

As used throughout the present specification, the term "control group" may mean a negative control group, which is an individual with a certain species of ants other than the red fire ant, or a positive control group, which is an individual with a certain red fire ant.

According to one embodiment of the present application, the method is a case where the expression level of the Sinv11977 gene of the target individual is higher than the expression level of the Sinv11977 gene of the negative control or is similar to the expression level of the Sinv11977 gene of the positive control. It may be to further include the step of diagnosing as.

According to the exemplary embodiment of the present disclosure, the method may further include detecting the Sinv11108 gene from a biological sample isolated from a target individual.

According to one embodiment of the present application, the method further comprises the step of detecting a nucleic acid containing the nucleotide sequence of SEQ ID NO: 1 or a protein containing the amino acid sequence of SEQ ID NO: 2 from a biological sample isolated from the subject of interest. It can be.

According to one embodiment of the present application, the step of detecting the Sinv11108 gene may be using a composition comprising a primer set including a nucleotide sequence of SEQ ID NO: 5 and a nucleotide sequence of SEQ ID NO: 6.

According to one embodiment of the present application, the step of detecting the Sinv11108 gene may be to use a composition comprising a primer set including a nucleotide sequence of SEQ ID NO: 9 and a nucleotide sequence of SEQ ID NO: 10, and additionally, a base of SEQ ID NO: 11 It may be to additionally use a probe containing the sequence.

According to an exemplary embodiment of the present disclosure, the detecting of the Sinv11108 gene may be a PCR reaction, a real-time PCR reaction, a SYBR green real-time PCR reaction, or a Taqman real-time PCR reaction, but is not limited thereto.

According to the exemplary embodiment of the present disclosure, when the Sinv11108 gene is detected, the step of diagnosing the individual as a red fire ant may be further included.

According to one embodiment of the present application, the method comprises the steps of measuring the Sinv11108 gene expression level from a biological sample isolated from a control; And comparing the expression levels of the Sinv11108 gene of the individual and the control group.

According to one embodiment of the present application, the method is a case where the expression level of Sinv11108 gene of the target individual is higher than the expression level of Sinv11108 gene of the negative control or is similar to the expression level of Sinv11108 gene of the positive control. It may be to further include the step of diagnosing as.

The fourth aspect of the present application is (a) a primer set comprising the nucleotide sequence of SEQ ID NO: 7 and the nucleotide sequence of SEQ ID NO: 8; And (b) provides a primer set for diagnosing red fire ants comprising at least one or more primer sets selected from the group consisting of a primer set comprising a nucleotide sequence of SEQ ID NO: 12 and a nucleotide sequence of SEQ ID NO: 13. The content overlapping with the first to third sides also applies to the primer set for diagnosing red fire ants on the fourth side.

According to one embodiment of the present application, the primer set may be for detecting the Sinv11977 gene.

According to the exemplary embodiment of the present disclosure, the primer set may further include a probe including the nucleotide sequence of SEQ ID NO: 14.

According to one embodiment of the present application, (a) a primer set comprising a nucleotide sequence of SEQ ID NO: 5 and a nucleotide sequence of SEQ ID NO: 6; And (b) at least one or more primer sets selected from the group consisting of at least one or more primer sets selected from the group consisting of a primer set comprising a nucleotide sequence of SEQ ID NO: 9 and a nucleotide sequence of SEQ ID NO: 10. I can.

According to the exemplary embodiment of the present disclosure, the primer set may further include a probe including the nucleotide sequence of SEQ ID NO: 11.

According to the composition for diagnosis of red fire ants of the present invention, a kit for diagnosis of red fire ants, a method of providing information for diagnosis of red fire ants, and a primer set for diagnosis of red fire ants, the Sinv11977 gene can be detected and used for diagnosis of red fire ants.

1 is a schematic diagram illustrating a method of diagnosing red fire ants using the Sinv11977 gene.
2 is a diagram showing the results of a PCR reaction using genomic DNA of 7 ants and a Sinv11108 gene primer set.
3 is a diagram showing the results of a PCR reaction using genomic DNA of 7 ants and a Sinv11977 gene primer set.
4 is a diagram showing the results of performing a real-time SYBR green PCR reaction using genomic DNA of 7 ants and a set of Sinv11108 gene primers; Red fire ant ( Solenopsis invicta, Si ) -dark red line; Solenopsis geminate ( Sg) -red line; Japanese fissure ant ( Solenopsis japonica, Sj) -Orange; Pale hair ant ( Lasius niger, Ln ) -yellow line; Bear ant ( Formica japonica, Fj )-bright green line; Crematogster sp., C.sp. -Green line; Wrinkle ant ( Tetramorium caespitum, Tc ) -bright blue line.
5 is a diagram showing the results of performing a real-time SYBR green PCR reaction using genomic DNA of 7 ants and a Sinv11977 gene primer set; Red fire ant ( Solenopsis invicta, Si ) -dark red line; Solenopsis geminate ( Sg) -red line; Japanese fissure ant ( Solenopsis japonica, Sj) -Orange; Pale hair ant ( Lasius niger, Ln ) -yellow line; Bear ant ( Formica japonica, Fj )-bright green line; Crematogster sp., C.sp. -Green line; Wrinkle ant ( Tetramorium caespitum, Tc ) -bright blue line.
6 is a diagram showing the result of performing a real-time SYBR green PCR reaction using genomic DNA of three ants and a Sinv11108 gene TagMan primer set; Red fire ant ( Solenopsis invicta, Si ) -dark red line; Solenopsis geminate ( Sg) -red line; Japanese fissure ant ( Solenopsis japonica, Sj) -Orange line.
7 is a diagram showing the results of performing a real-time SYBR green PCR reaction using genomic DNA of three ants and a Sinv11977 gene TagMan primer set; Red fire ant ( Solenopsis invicta, Si ) -dark red line; Solenopsis geminate ( Sg) -red line; Japanese fissure ant ( Solenopsis japonica, Sj) -Orange line.
8 is a diagram showing the results of performing TagMan real-time PCR reaction using genomic DNA of three ants and Sinv11108 gene TagMan primer set and probe; Red fire ant ( Solenopsis invicta, Si ) -dark red line; Solenopsis geminate ( Sg) -red line; Japanese fissure ant ( Solenopsis japonica, Sj) -Orange line.
9 is a diagram showing the results of performing TagMan real-time PCR reaction using genomic DNA of three kinds of ants and a Sinv11977 gene TagMan primer set and probe; Red fire ant ( Solenopsis invicta, Si ) -dark red line; Solenopsis geminate ( Sg) -red line; Japanese fissure ant ( Solenopsis japonica, Sj) -Orange line.

Hereinafter, the present application will be described in more detail through examples and experimental examples. However, these Examples and Experimental Examples are for illustrative purposes only, and the scope of the present application is not limited to these Examples and Experimental Examples.

Example 1: Collection of 7 kinds of ants including red fire ants and genomic DNA extraction

Red fire ants ( Solenopsis invicta, Si ) collected individuals found in Busan Port and Incheon Port, rapidly frozen, and stored at -50℃. Tropical fire ants ( Solenopsis geminate, Sg) were collected from the Philippines and then frozen and brought in. The Japanese rowdy ant ( Solenopsis japonica, Sj) used individuals collected in the mountains near Wonju, Gangwon-dong. Godong hair ants ( Lasius niger, Ln ), bear ants ( Formica japonica, Fj ), tail ants ( Crematogster sp., C.sp. ) and wrinkle ants ( Tetramorium caespitum, Tc ) were collected from Jungang Park, Dongan-gu, Anyang-si, Gyeonggi-do. Was used.

In addition, genomic DNA was extracted from live or frozen ant samples using the DNeasy Blood & Tissue kit (Qiagen, Valencia, CA, USA). The extracted genomic DNA was quantified using a spectrophotometer and the concentration was adjusted to 10 ng/μl.

Example 2: PCR reaction for verification of red fire ant poisonous specific gene

After preparing a gene-specific primer set to verify the red fire ant-specific gene, a PCR reaction was performed using the genomic DNAs of 7 kinds of ants including the red fire ant extracted in Example 1. Specifically, 10 pmole forward primer, 10 pmole reverse primer, and 10 ng genomic DNA were mixed with rTaq plus PCR mixture (ELPIS Biotech, Daejeon, Korea) to prepare a total of 20 μl of a mixture. Next, the prepared mixture was subjected to a PCR reaction using an ABI 2720 PCR machine (Applied Biosystems). PCR conditions were carried out by initial heating at 95°C for 5 minutes, 95°C 10 seconds, 55°C 10 seconds, 72°C 10 seconds for a total of 30 cycles, followed by storage at 72°C for 10 minutes. Next, the PCR results were subjected to electrophoresis on 2.0% agarose gel to confirm the presence of amplified DNA, and all amplified DNAs were cloned with a TA cloning kit, and the DNA sequences were read from both directions to confirm. .

Example 3: Real-time PCR reaction using DNA-binding fluorescent material

In order to confirm the red fire ant-specific gene amplification in real time, a real time PCR reaction was performed using SYBR green. Specifically, 10 pmole forward primer, 10 pmole reverse primer, 20 ng genomic DNA, nPfu-Forte polymerase (Enzynomics, Daejeon, Korea), SYBR green, Dntp and buffer were mixed to prepare a total of 20 μl of a mixture. Next, the prepared mixture was subjected to a real-time PCR reaction using AriaMX real time PCR (Agilent). Real-time PCR conditions were initial heating at 95°C for 2 minutes, followed by 95°C for 30 seconds, 63°C for 30 seconds, and 72°C for 1 minute for a total of 40 cycles. The fluorescence values that change depending on whether or not the red fire ant-specific gene is amplified was confirmed by converting it into a graph using AriaMX version 1.5 software.

Example 4: TaqMan real-time PCR reaction

The TagMan real-time PCR method is a method that can confirm the presence and concentration of a target gene by using a probe DNA with a fluorescent substance that binds to a primer set and an amplicon. The TaqMan probe was prepared by combining 6-carboxyfluorescien (FAM) at the 5'end and Black hole quencher 1 (BHQ1) (Bioneer, DaeJeon, Korea) at the 3'end. To perform the TagMan real-time PCR reaction, 20 ng of genomic DNA, 10 pmole of forward primer, 10 pmole of reverse primer, and 5 pmole of probe were mixed with TaqMan RT PCR master mix (Enzynomics), and the mixture was then mixed with AriaMx RT- It was carried out using a PCR system (Agilent Technologies). TaqMan real-time PCR reaction results were analyzed using AriaMx Version 1.5 software (Agilent Technologies).

Experimental Example 1: Discovery of specific genes for development of molecular diagnostic method for red fire ants

The red imported fire ant (RIFA) molecular diagnosis method currently used has a disadvantage in that the diagnosis time is long, so a novel gene was discovered to develop a new molecular diagnosis method that can shorten the diagnosis time. Specifically, in order to discover a novel gene, two candidate genes were identified by performing a self-expression genome analysis of less than red fire ants, and the genes were named as Solenopsis invicta 11108 (Sinv11108) and Solenopsis invicta 11977 (Sinv11977), respectively. . The base sequence and amino acid sequence of Sinv11108 are shown in SEQ ID NOs: 1 and 2, and the base sequence and amino acid sequence of Sinv11977 are shown in SEQ ID NOs: 3 and 4, respectively (Table 1).

gene DNA/amino acid sequence order Sequence number Sinv11108 DNA ATGTTTATTTTCAATTTATTTGTAATATTTTTAATTCTGATCTATTGGCCTTTTATTACTCTAAATCTAATTAGGAATAGCATTACATTAGCAATGAAACCACCAAAAAGAGGAATAACAAAACCTGCGAGATATCAAACTACAGAATCCTCAGATGATGGTGAAAATGTAACTATAGAGAAATACGATTTAACCAAAGACGAAGTTCACAATGAGGTGGAAAGTGATGTACTAGCACTAAGTCAAGTTTTCGTTGAGACACAGCATGTACTGAATAAAAAAGATGATGAAAATAACTCACTTCTTTTAAATCGTAATCAATTACCAAACAATAAATCATCTATTCGATCTCACGTGATATTAGATTTTCCACTCGAAAATTTAAAAGCTTCATCATCTAGTTATCACAATGAACCAACAATCTCAAAGCAACATGATATGTCTCATTTCAATGTATTGTACAATGATCCTGTGGCCTCAACGTCTTCAACGGTAATTTCTAATGCTCAATATGAACCAACAAACTCAAGCTTGGTATCTTATCAATCAGAAACATACAAAGAAGATGAACTTTGTACTAAAAAAAGTGTGAAAAATATTGATAACCAACACTATGATTACTTGAGCAATAAACGGCCAGAAACCACATTAAAAACTTATGAACGAAATAATACATCAAAGTTACATTTGTACAATAAATTACAAACAGACAATGAAAATGTACCTGAAAAAATATATTACAATTTGGATGCCAAAAAACTTGTGGACAAACGAACAAAAACAGAAGTTAAGGTTCATTCTCCAGTATATACTCCAGCAGAAAAGAAAGATATTGAATTTACCTCATCTATAGCTGAAGATTTTCGAAGCACTCTCCGAGAATAA One amino acid M F I F N L F V I F L I L I Y W P F I T L N L I R N S I T L A M K P P K R G I T K P A R Y Q T T E S S D D G E N V T I E K Y D L T K D E V H N E V E S D V L A L S Q V F V E T Q H V L N K K D D E N N S L L L N R N Q L P N N K S S I R S H V I L D F P L E N L K A S S S S Y H N E P T I S K Q H D M S H F N V L Y N D P V A S T S S T V I S N A Q Y E P T N S S L V S Y Q S E T Y K E D E L C T K K S V K N I D N Q H Y D Y L S N K R P E T T L K T Y E R N N T S K L H L Y N K L Q T D N E N V P E K I Y Y N L D A K K L V D K R T K T E V K V H S P V Y T P A E K K D I E F T S S I A E D F R S T L R E Stop 2 Sinv11977 DNA ATGGGCAAGGAGAGAAGGAAGCGCGGAAAACGGGCTGGCCGTAAGGTCTTTTTAAAAGGATTAAAAAAGGAACTACATGCGGCCGGCGAATTCGATCCATCGACCGTATTCCCTAAAACCCCACGCCACTCACCACCGGTCGAACGCGCAACCACCGTTCATCCGGATCGACGACTGAGACGGGATCCTTCCCCCAAACAAAGGAAACCCGCCAATCCTAAAGACACTTTCGTCCCTGCGCGGATCCTGACGAGGCCCATTCCGATGCAAGTGTATGTGCGAAAACCATTGTCGGCAACTTCTCCGAAACCAAAAATTCGATACAATATTTCTGTAAAGCTTAAATTATCAATAACCCCCTCAGGGATAATACGTATCAAGCACTAG 3 amino acid M G K E R R K R G K R A G R K V F L K G L K K E L H A A G E F D P S T V F P K T P R H S P P V E R A T T V H P D R R L R R D P S P K Q R K P A N P K D T F V P A R I L T R P K L K I A S K S K P I P K I S I S K S P 4

Experimental Example 2: Method for diagnosing red fire ants using general PCR reaction

In order to confirm the species of red fire ants through the expression of the new genes Sinv11108 or Sinv11977 discovered in Experimental Example 1, a primer set that reacts specifically to each gene was prepared, and the primer set and the genomic DNA of the 7 ants PCR reaction was performed as in Example 2.

As a result of conducting a PCR reaction using primer sets (SEQ ID NOs: 5 and 6) for amplifying Sinv11108, DNA fragments amplified by PCR of about 200 bp were observed only in red fire ants (Fig. 2), and a primer set for amplifying Sinv11977 ( As a result of the PCR reaction using SEQ ID NOs: 7 and 8), DNA fragments amplified by PCR of about 200 bp were observed only in red fire ants (FIG. 3). In addition, it was confirmed that the amplified gene was subjected to capillary sequencing to have the same base sequence as Sinv11108 and Sinv11977.

Based on the above results, it was confirmed that the new genes Sinv11108 or Sinv11977 are expressed only in red fire ants, and red fire ants can be diagnosed by confirming the expression of the gene.

gene Primer name Primer sequence (5'→ 3') Sequence number Sinv11108 Sinv11108F1 GCATTACATTAGCAATGAAACC 5 Sinv11108B1 ATTCAGTACATGCTGTGTCTCA 6 Sinv11977 Sinv11977F1 CTAAAACCCCACGCCACTCACC 7 Sinv11977B1 TTCGGAGAAGTTGCCGACAATGG 8

Experimental Example 3: DNA of Sinv11108 and Sinv11977 genes in silico Sequence comparison analysis result

Currently, there are a total of 10 ants, including red fire ants, for which the entire genome has been analyzed. Using the base sequences of Sinv11108 and Sinv11977, a comparative analysis study was performed with the total genome sequence and expression genome sequence of 9 ants except for red fire ants.

In the case of the Sinv11108 gene, genes with high homology (E value <10 ^-5 ) were found in the genomes of 8 ants including Acromymer echinatior, Atta cephalotes, Camonotus floridanus, Cardiocondyla obscurior, Cerapachys biroi, Harpergnathos saltator, Linepithema humile, and Pogonomyrmex barbtus . It was not found, and in Wasmannia auropunctata , a part with E value = 1.19 x 10 ^-19 was present on genomic DNA, but the homology of the whole gene was 71.45% and the gap was 10.47%, the difference in nucleotide sequence between the red fire ant and the whole gene As a result, it was confirmed that amplification was not performed with the Sinv11108 primer set of Experimental Example 2 (Table 3).

Ant species Maximum Homology Acromyrmex echinatior
(Scissor ant) No gene with E value <10 ^-5 Atta cephalotes (leaf cutter ants) No gene with E value <10 ^-5 Camponotus floridanus
(Florida carpenter ant, Florida carpenter ant) No gene with E value <10 ^-5 Cardiocondyla obscurior No gene with E value <10 ^-5 Cerapachys biroi No gene with E value <10 ^-5 Harpegnathos saltator No gene with E value <10 ^-5 Linepithema humile No gene with E value <10 ^-5 Pogonomyrmex barbtus
(red harvester ants) No gene with E value <10 ^-5 Wasmannia auropunctata (little fire ants) E value = 1.19 x 10 ^-19 in the genomic region exists.
However, the DNA identity is only 71.45% and the gap is very high, about 10.47%, so the possibility of amplification is very small.

In addition, in the case of the Sinv11977 gene, it was confirmed that the region of the gene with high homology (E value <10 ^-5 ) did not exist in 9 types of ants excluding red fire ants (Table 4).

Ant species Maximum Homology Acromyrmex echinatior
(Scissor ant) No gene with E value <10 ^-5 Atta cephalotes (leaf cutter ants) No gene with E value <10 ^-5 Camponotus floridanus
(Florida carpenter ant, Florida carpenter ant) No gene with E value <10 ^-5 Cardiocondyla obscurior No gene with E value <10 ^-5 Cerapachys biroi No gene with E value <10 ^-5 Harpegnathos saltator No gene with E value <10 ^-5 Linepithema humile No gene with E value <10 ^-5 Pogonomyrmex barbtus
(red harvester ants) No gene with E value <10 ^-5 Wasmannia auropunctata (little fire ants) No gene with E value <10 ^-5

Based on the above results, it can be seen that the genes Sinv11108 and Sinv11977 of the present application are genes specifically expressed only in red fire ants, and red fire ants can be diagnosed by checking whether the genes are expressed.

Experimental Example 4: Method for diagnosing red fire ants using real-time PCR reaction

In order to identify the species of red fire ants through the expression of the new genes Sinv11108 or Sinv11977 discovered in Experimental Example 1, the primer set of Experimental Example 2 and genomic DNA of 7 ants were used as in Example 2 in real time. -time) PCR reaction was performed.

As a result of analysis of the Sinv11108 gene, only in the case of red fire ants, the fluorescence index reached about 2,000 in 30 cycles, and the fluorescence index rapidly increased up to 35 cycles, but in the case of other species, only tropical fire ants ( Sg ) were fluorescent in 30 cycles. The index was about 370, which was less than 1/5 of the red fire ants, and the other five species showed only the baseline level of fluorescence index (Fig. 4).

In addition, as a result of analysis of the Sinv11977 gene, in the case of red fire ants, the fluorescence index reached about 1,700 in 25 cycles, but the other six species showed only the baseline value. It was confirmed that the index was close to 7,000, and in the case of other species, it was less than 2,000, which was not insignificant to 1/3 of the red fire ant fluorescence index (FIG.

Based on the above results, it can be seen that only red fire ants can be specifically diagnosed based on the expression of the Sinv11108 and Sinv11977 genes using the SYBR green real-time PCR reaction.

Experimental Example 5: Method for diagnosing red fire ants using TaqMan real-time PCR reaction

In order to confirm the species of red fire ants through the expression of the new genes Sinv11108 or Sinv11977 discovered in Experimental Example 1, primer sets and probes for the Sinv11108 or Sinv11977 genes were designed (Table 5), red fire ants ( Si ), The SYBR green real-time PCR reaction of Example 3 and the TaqMan real-time PCR reaction of Example 4 were performed using genomic DNA of tropical fire ants ( Sg ) and Japanese rowan ants ( Sj ).

gene Primer/probe name Primer/probe sequence (5'→ 3') Sequence number Sinv11108 Sinv11108 F-TM ACCTGCGAGATATCAAACTACAG 9 Sinv11108 R-TM CATGCTGTGTCTCAACGAAAAC 10 Sinv11108 Probe CCAAAGACGAAGTTCACAATGAGGTGGA 11 Sinv11977 Sinv11977 F-TM GACCGTATTCCCTAAAACCCC 12 Sinv11977 R-TM ACACTTGCATCGGAATGGG 13 Sinv11977 Probe TCCTAAAGACACTTTCGTCCCTGCG 14

Specifically, first, a study was conducted using the SYBR RT PCR method to confirm whether the primer set for TaqMan(TM) specifically amplifies only the target gene.In the case of the Sinv11108 gene, only the red fire ants have a fluorescence index. More than 3600 came out, and the remaining two showed only a fluorescence index of 800 or less (Fig. 6), and in the case of the Sinv11977 gene, only the red fire ants started to amplify the fluorescence signal after the 27th cycle. Was shown (Fig. 7). These results show that even the primer set for TM can specifically diagnose only red fire ants.

Next, a TaqMan real-time PCR reaction was performed using a TM primer set and a probe. In the case of the Sinv11108 gene, fluorescence started to be amplified after 24 cycles in red fire ants and showed a fluorescence index of 900 or more in 30 cycles, but the remaining two showed a fluorescence signal of less than 350 even at 35 cycles (FIG. 8). In addition, in the case of the Sinv11977 gene, the fluorescence signal started to be amplified after 25 cycles only in red fire ants, and showed a fluorescence index of 500 at 30 cycles and 1600 or higher at 35 cycles (FIG. 9). These results show that the diagnosis method using the TaqMan real-time PCR reaction can be used to diagnose red fire ants.

From the above description, those skilled in the art to which the present invention pertains will appreciate that the present invention may be implemented in other specific forms without changing its technical spirit or essential features. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention should be construed as including all changes or modifications derived from the meaning and scope of the following claims rather than the above detailed description and equivalent concepts thereof.

<110> Industry Academic Cooperation Foundation, Hallym University <120> Molecular diagnostic method using venom gland-specific gene of Red imported fire ant, Solenopsis invicta 11977 <130> 11977 <160> 14 <170> KoPatentIn 3.0 <210> 1 <211> 885 <212> DNA <213> Solenopsis invicta <400> 1 atgtttattt tcaatttatt tgtaatattt ttaattctga tctattggcc ttttattact 60 ctaaatctaa ttaggaatag cattacatta gcaatgaaac caccaaaaag aggaataaca 120 aaacctgcga gatatcaaac tacagaatcc tcagatgatg gtgaaaatgt aactatagag 180 aaatacgatt taaccaaaga cgaagttcac aatgaggtgg aaagtgatgt actagcacta 240 agtcaagttt tcgttgagac acagcatgta ctgaataaaa aagatgatga aaataactca 300 cttcttttaa atcgtaatca attaccaaac aataaatcat ctattcgatc tcacgtgata 360 ttagattttc cactcgaaaa tttaaaagct tcatcatcta gttatcacaa tgaaccaaca 420 atctcaaagc aacatgatat gtctcatttc aatgtattgt acaatgatcc tgtggcctca 480 acgtcttcaa cggtaatttc taatgctcaa tatgaaccaa caaactcaag cttggtatct 540 tatcaatcag aaacatacaa agaagatgaa ctttgtacta aaaaaagtgt gaaaaatatt 600 gataaccaac actatgatta cttgagcaat aaacggccag aaaccacatt aaaaacttat 660 gaacgaaata atacatcaaa gttacatttg tacaataaat tacaaacaga caatgaaaat 720 gtacctgaaa aaatatatta caatttggat gccaaaaaac ttgtggacaa acgaacaaaa 780 acagaagtta aggttcattc tccagtatat actccagcag aaaagaaaga tattgaattt 840 acctcatcta tagctgaaga ttttcgaagc actctccgag aataa 885 <210> 2 <211> 294 <212> PRT <213> Solenopsis invicta <400> 2 Met Phe Ile Phe Asn Leu Phe Val Ile Phe Leu Ile Leu Ile Tyr Trp 1 5 10 15 Pro Phe Ile Thr Leu Asn Leu Ile Arg Asn Ser Ile Thr Leu Ala Met 20 25 30 Lys Pro Pro Lys Arg Gly Ile Thr Lys Pro Ala Arg Tyr Gln Thr Thr 35 40 45 Glu Ser Ser Asp Asp Gly Glu Asn Val Thr Ile Glu Lys Tyr Asp Leu 50 55 60 Thr Lys Asp Glu Val His Asn Glu Val Glu Ser Asp Val Leu Ala Leu 65 70 75 80 Ser Gln Val Phe Val Glu Thr Gln His Val Leu Asn Lys Lys Asp Asp 85 90 95 Glu Asn Asn Ser Leu Leu Leu Asn Arg Asn Gln Leu Pro Asn Asn Lys 100 105 110 Ser Ser Ile Arg Ser His Val Ile Leu Asp Phe Pro Leu Glu Asn Leu 115 120 125 Lys Ala Ser Ser Ser Ser Tyr His Asn Glu Pro Thr Ile Ser Lys Gln 130 135 140 His Asp Met Ser His Phe Asn Val Leu Tyr Asn Asp Pro Val Ala Ser 145 150 155 160 Thr Ser Ser Thr Val Ile Ser Asn Ala Gln Tyr Glu Pro Thr Asn Ser 165 170 175 Ser Leu Val Ser Tyr Gln Ser Glu Thr Tyr Lys Glu Asp Glu Leu Cys 180 185 190 Thr Lys Lys Ser Val Lys Asn Ile Asp Asn Gln His Tyr Asp Tyr Leu 195 200 205 Ser Asn Lys Arg Pro Glu Thr Thr Leu Lys Thr Tyr Glu Arg Asn Asn 210 215 220 Thr Ser Lys Leu His Leu Tyr Asn Lys Leu Gln Thr Asp Asn Glu Asn 225 230 235 240 Val Pro Glu Lys Ile Tyr Tyr Asn Leu Asp Ala Lys Lys Leu Val Asp 245 250 255 Lys Arg Thr Lys Thr Glu Val Lys Val His Ser Pro Val Tyr Thr Pro 260 265 270 Ala Glu Lys Lys Asp Ile Glu Phe Thr Ser Ser Ile Ala Glu Asp Phe 275 280 285 Arg Ser Thr Leu Arg Glu 290 <210> 3 <211> 387 <212> DNA <213> Solenopsis invicta <400> 3 atgggcaagg agagaaggaa gcgcggaaaa cgggctggcc gtaaggtctt tttaaaagga 60 ttaaaaaagg aactacatgc ggccggcgaa ttcgatccat cgaccgtatt ccctaaaacc 120 ccacgccact caccaccggt cgaacgcgca accaccgttc atccggatcg acgactgaga 180 cgggatcctt cccccaaaca aaggaaaccc gccaatccta aagacacttt cgtccctgcg 240 cggatcctga cgaggcccat tccgatgcaa gtgtatgtgc gaaaaccatt gtcggcaact 300 tctccgaaac caaaaattcg atacaatatt tctgtaaagc ttaaattatc aataaccccc 360 tcagggataa tacgtatcaa gcactag 387 <210> 4 <211> 128 <212> PRT <213> Solenopsis invicta <400> 4 Met Gly Lys Glu Arg Arg Lys Arg Gly Lys Arg Ala Gly Arg Lys Val 1 5 10 15 Phe Leu Lys Gly Leu Lys Lys Glu Leu His Ala Ala Gly Glu Phe Asp 20 25 30 Pro Ser Thr Val Phe Pro Lys Thr Pro Arg His Ser Pro Pro Val Glu 35 40 45 Arg Ala Thr Thr Val His Pro Asp Arg Arg Leu Arg Arg Asp Pro Ser 50 55 60 Pro Lys Gln Arg Lys Pro Ala Asn Pro Lys Asp Thr Phe Val Pro Ala 65 70 75 80 Arg Ile Leu Thr Arg Pro Ile Pro Met Gln Val Tyr Val Arg Lys Pro 85 90 95 Leu Ser Ala Thr Ser Pro Lys Pro Lys Ile Arg Tyr Asn Ile Ser Val 100 105 110 Lys Leu Lys Leu Ser Ile Thr Pro Ser Gly Ile Ile Arg Ile Lys His 115 120 125 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Sinv11108B1 <400> 5 gcattacatt agcaatgaaa cc 22 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Sinv11108B1 <400> 6 attcagtaca tgctgtgtct ca 22 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Sinv11977F1 <400> 7 ctaaaacccc acgccactca cc 22 <210> 8 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Sinv11977B1 <400> 8 ttcggagaag ttgccgacaa tgg 23 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Sinv11108 F-TM <400> 9 acctgcgaga tatcaaacta cag 23 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Sinv11108 R-TM <400> 10 catgctgtgt ctcaacgaaa ac 22 <210> 11 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Sinv11108 Probe <400> 11 ccaaagacga agttcacaat gaggtgga 28 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Sinv11977 F-TM <400> 12 gaccgtattc cctaaaaccc c 21 <210> 13 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Sinv11977 R-TM <400> 13 acacttgcat cggaatggg 19 <210> 14 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Sinv11977 Probe <400> 14 tcctaaagac actttcgtcc ctgcg 25

Claims (11)

Sinv11977 (Solenopsis invicta 11977), characterized in that to detect the gene, red fire ants ( Solenopsis invicta ) diagnostic composition.
The method of claim 1,
The composition is to detect a nucleic acid containing the nucleotide sequence of SEQ ID NO: 3, a composition for diagnosis of red fire ants.
The method of claim 1,
The composition comprises a primer set comprising the nucleotide sequence of SEQ ID NO: 7 and the nucleotide sequence of SEQ ID NO: 8, the composition for diagnosis of red fire ants.
The method of claim 1,
The composition comprises a primer set comprising a nucleotide sequence of SEQ ID NO: 12 and a nucleotide sequence of SEQ ID NO: 13, a composition for diagnosis of red fire ants.
According to claim 4,
The composition further comprises a probe comprising the nucleotide sequence of SEQ ID NO: 14, the composition for diagnosis of red fire ants.
delete A kit for diagnosing red fire ants comprising the composition of any one of claims 1 to 5.
A method for providing information for diagnosing red fire ants, comprising the step of detecting a Sinv11977 gene from a biological sample isolated from a target individual.
The method of claim 8,
The method further comprises the step of diagnosing the individual as a red fire ant when the Sinv11977 gene is detected, the method of providing information for diagnosis of red fire ants.
delete (a) a primer set comprising the nucleotide sequence of SEQ ID NO: 7 and the nucleotide sequence of SEQ ID NO: 8; And
(b) a primer set comprising the nucleotide sequence of SEQ ID NO: 12 and the nucleotide sequence of SEQ ID NO: 13
A primer set for diagnosing red fire ants comprising at least one or more primer sets selected from the group consisting of.

Images