CN1730662A - Method of qualitative and quantitative analysis for algae - Google Patents
Method of qualitative and quantitative analysis for algae Download PDFInfo
- Publication number
- CN1730662A CN1730662A CN 200410053531 CN200410053531A CN1730662A CN 1730662 A CN1730662 A CN 1730662A CN 200410053531 CN200410053531 CN 200410053531 CN 200410053531 A CN200410053531 A CN 200410053531A CN 1730662 A CN1730662 A CN 1730662A
- Authority
- CN
- China
- Prior art keywords
- probe
- enzyme protection
- protection analysis
- nucleotide
- signal
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention discloses a method for fast determination of algae species and quantity by employing rRNA-targeted S1 enzyme protection probe and sandwich hybridization technique, which comprises, (1) mixing and hybridizing the detected sample with S1 enzyme protection analyzing probe, (2) treating the mixed solution in step (1) through S1 enzyme digestion, (3) carrying out denaturation treatment to release S1 enzyme protection probe, (4) trapping residual S1 enzyme protection analyzing probes with trapping probes fixed on the solid-phase carriers, (5) hybridizing the linking probe with S1 enzyme protection analyzing probe, then hybridizing with the signal probe with detectable signals, (6) detecting the detectable signals to determine the algae species and/or quantity in the sample.
Description
Technical field
The present invention relates to detection range, relate to the qualitative and quantitative analytical procedure of algae particularly.More specifically relate to S1 enzyme protection analysis probe and the sandwich hybridization technology of a kind of employing at rRNA, thus the method for kind of Rapid identification algae and quantity.
Background technology
Red tide is some small planktonic algae, protozoon or a bacterium in the ocean, fulminant breeding under certain conditions (propagation) or gathering and cause a kind of deleterious ecological unusual phenomenon of water body variable color.From the whole world, the little algae of Marine Planktonic is the main biology that causes red tide, has kind more than 260 can form red tide in more than the 4000 kinds of little algaes of Marine Planktonic, wherein has kind more than 70 can produce toxin.Fish and shellfish mass mortality caused heavy economic losses and serious marine ecology disaster when red tide took place; Toxin also can be enriched in shellfish and the fish body, can be diseases induced after human the eating.
If can monitor the kind and the quantity of planktonic microalgae in the seawater in real time, obtain a large amount of monitoring data, just may in time fish, the shellfish of culture zone be taken measures for the forecast red tide provides necessary condition, avoid heavy economic losses, guarantee the development of coastland economy and social stability.
Identify that at present the method for algae is mainly by opticmicroscope and electron microscope.Well-trained expert just can identify most of little algaes easily by opticmicroscope, but the interior algae of some genus is difficult on kind of the level and separates with ordinary optical microscope.Though there are some special fluorescence dyes to be equipped with fluorescent microscope in order to distinguish them, perhaps also can observe nuance on the taxonomy with electron microscope, these methods are not only to the technical requirements height, and not only time-consuming but also effort and mistake easily takes place to detect.Therefore this area presses for simple, the reliable authentication method that develops at algae such as red tide algaes for a long time.
It is generally acknowledged that ribosome-RNA(rRNA) (rRNA) of little algae and evolution and the classification of algae have confidential relation, the data owner of the last relevant little algae of GenBank will concentrate on this zone.By the rRNA of more close little algae, find out each and plant distinctive nucleic acid as Oligonucleolide primers and probe, utilize molecular hybridization to carry out qualitative, quantitative and identify.At present mainly contain quantitative PCR, full cell hybridization and sandwich hybridization technology in usefulness.
Quantitative PCR technique is a kind of nucleic acid detection technique of highly sensitive high specific, and its application in little algae is identified is just at the early-stage.But because the existing quantitative round pcr requires highly purified DNA or RNA as the detection sample, and this technology requires than higher instrument and operator at present, has therefore limited the popularization and application of quantitative PCR in little algae detects.
The principle of full cell hybridization is to use filter membrane and filtration unit to collect frustule, and with the rRNA hybridization that contains in fluorescein-labeled specific probe and the frustule, direct viewing under fluorescent microscope is made evaluation and quantitative counting to corresponding algae kind then; Perhaps wash frustule, after the oligonucleotide probe combination, on flow cytometry, count with specific wavelength from film.Morphological specificity that can frustule to be checked when the former benefit is to count has improved the accuracy of identifying; But the shortcoming that this method does not overcome complex operation yet, wastes time and energy.The researchist trends towards using flow cytometry, because this method can be counted fast, is easy to automatization, but the spontaneous fluorescence of some algae may influence the accuracy of detection.In addition, this technology requires also than higher instrument and operator.
The PCR-ELISA technology is the nucleic acid quick diagnosis technology that development in recent years is got up.It at first also passes through pcr amplification target DNA fragment to be detected, and mixes markers such as digoxin or fluorescein when amplification; Then be fixed on 96 orifice plates specific oligonucleotide probe hybridization, behind the fragment flush away with not hybridization, the digoxin or the fluorescein antibody of added mark horseradish peroxidase (HRP) or alkaline phosphatase (AP), after adding suitable chromogenic substrate at last, just can pass through 96 orifice plate plate reading machine sense datas, thus the qualitative and quantitative analysis target DNA fragment.Sandwich hybridization technology on this basis is meant that unlabelled PCR product that amplification is good and the DNA on 96 orifice plates hybridize, thereby is arrested on micropore by the latter, and then with digoxin or fluorescein-labeled oligonucleotide probe hybridization.Because the regular-PCR amplification has very big influence and time-consuming to detecting quantitative accuracy, so little algae that this technology not too is fit to be applied in the sample of ocean is monitored in real time.
Because rRNA is considered to and the closely-related sequence of the phyletic evolution of algae, and rRNA content is very high in the eukaryotic cells, can reach 10
6～10
7Individual copy, rRNA are the good target spots of sandwich hybridization.1996, Christopher A.Scholin etc. with the RNA that extracts or frustule lysate under certain condition with the oligonucleotide probe hybridization that is combined on 96 orifice plates after, hybridize with it with the signal probe of a mark again, carry out enzyme labelled antibody color reaction (see figure 1) at last.Use to some extent in the monitoring of the present marine algae of this technology, but up to the present, use little algae that this technology can detect and be only limited to limited several.Its main drawback is: (a) because of the length of capture probe 10-30bp only, the capture probe quantity that therefore can effectively distinguish the nearer little algae of sibship is few; (b) in whole testing process, all need to prevent the RNA degraded, yet each step such as washing, antibody response very easily causes the RNA degraded, so operation easier is big, the detected result fluctuation is big.
In sum, lack at present little algae carried out quick, easy, reliable authentication method, thus this area press for exploitation new can carry out quick, easy, reliable authentication method to kind and/or the quantity of little algae.
Summary of the invention
Purpose of the present invention just provides a kind ofly carries out quick, easy, reliable authentication method to little algae kind and/or quantity.
In a first aspect of the present invention, the method for algae in a kind of test sample is provided, this method may further comprise the steps:
(a) with the mixing and the hybridization of detected sample and S1 enzyme protection analysis probe, form mixing solutions;
(b) under the condition of being fit to, with the mixing solutions of S1 enzyme (concentration is generally 0.05-10U/ μ l, preferably is 0.1-5U/ μ l, more preferably is 0.5-2.5U/ μ l) treatment step (a), thus the strand part in cutting single-chain nucleic acid and the degraded double-strandednucleic acid;
(c) solution to step (b) carries out denaturing treatment, thereby discharges S1 enzyme protection analysis probe;
(d) with the probe of arresting that is fixed on the solid phase carrier, protected S1 enzyme protection analysis probe is arrested specifically on solid phase carrier;
(e) with single-minded signal probe that has detectable signal and the hybridization of S1 enzyme protection analysis probe; Perhaps, hybridize with linking probe again with the universal signal probe that has detectable signal then with linking probe and the hybridization of S1 enzyme protection analysis probe;
(f) detect detectable signal, thereby determine kind and/or the quantity of algae in the sample.
In another preference, the length of described S1 enzyme protection analysis probe is 40-100 Nucleotide, and specificity is incorporated into the rRNA specific region (for example specific specificity or genus specificity S1 enzyme protection analysis probe) of one or more algae.
In another preference, described length of arresting probe is 12～50 Nucleotide, and specificity is incorporated into an end of S1 enzyme protection analysis probe.
In another preference; the length of described linking probe is 40～100 Nucleotide; and the S1 enzyme protection analysis probe land that 15～35 Nucleotide are at one end arranged approximately; arrest an end complementation of probe with the debond of S1 enzyme protection analysis probe; and has the signal probe land of 15-50 Nucleotide at the other end, with the signal probe complementation.
In another preference; the length of described single-minded signal probe is 15～50 Nucleotide; with the debond of S1 enzyme protection analysis probe in an end complementation of arresting probe, and be selected from the marker of group down described having: digoxin, fluorescein, vitamin H, horseradish peroxidase or other combination at 5 ' end or 3 ' end.
In another preference; the length of described universal signal probe is 15～50 Nucleotide; with the debond of linking probe in an end complementation of S1 enzyme protection analysis probe, and be selected from the marker of group down described having: digoxin, fluorescein, vitamin H, horseradish peroxidase or other combination at 5 ' end or 3 ' end.
In another preference, described method is used for qualitative or the detection by quantitative Chaetoceros, and S1 enzyme protection analysis probe, arrests probe sequence, linking probe sequence and signal probe sequence and have the nucleotide sequence shown in the SEQ ID NO:1,2,3,4 respectively.
In another preference; described method is used for qualitative or the detection by quantitative Alexandrium tamarense, and S1 enzyme protection analysis probe, arrests probe sequence, linking probe sequence and signal probe sequence and have the nucleotide sequence shown in the SEQ ID NO:5,6,7,4 respectively.
In a second aspect of the present invention, the test kit of algae in a kind of test sample is provided, it comprises following assembly:
(a) S1 enzyme protection analysis probe, the length of described S1 enzyme protection analysis probe are 40-100 Nucleotide, and specificity is incorporated into the rRNA specific region of algae;
(b) arrest probe, described length of arresting probe is 12～50 Nucleotide, and specificity is incorporated into an end of S1 enzyme protection analysis probe;
(c) linking probe; the length of described linking probe is 40～100 Nucleotide; and the S1 enzyme protection analysis probe land that 15～35 Nucleotide are at one end arranged approximately; arrest an end complementation of probe with the debond of S1 enzyme protection analysis probe; and the signal probe land that has 15-50 Nucleotide at the other end; with the signal probe complementation, supplementary condition are to be when signal probe
(d1) described single-minded signal probe Then there is not linking probe;
(d) signal probe, described linking probe is selected from down group:
(d1) length of described single-minded signal probe is 15～50 Nucleotide, with the debond of S1 enzyme protection analysis probe in an end complementation of arresting probe, and be selected from the marker of group down described having: digoxin, fluorescein, vitamin H, horseradish peroxidase or other combination at 5 ' end or 3 ' end;
(d2) length of described universal signal probe is 15～50 Nucleotide; with the debond of linking probe in an end complementation of S1 enzyme protection analysis probe, and be selected from the marker of group down described having: digoxin, fluorescein, vitamin H, horseradish peroxidase or other combination at 5 ' end or 3 ' end.
In another preference; described test kit is used for qualitative or the detection by quantitative Chaetoceros, and S1 enzyme protection analysis probe, arrests probe sequence, linking probe sequence and signal probe sequence and have the nucleotide sequence shown in the SEQ ID NO:1,2,3,4 respectively.
In another preference; described test kit is used for qualitative or the detection by quantitative Alexandrium tamarense, and S1 enzyme protection analysis probe, arrests probe sequence, linking probe sequence and signal probe sequence and have the nucleotide sequence shown in the SEQ ID NO:5,6,7,4 respectively.
Description of drawings
Fig. 1 is the synoptic diagram of the sandwich hybridization technology of development such as Christopher A.Scholin in the prior art.
Fig. 2 is the synoptic diagram of the inventive method.
Fig. 3 has shown and has used the detected result of surveying various algae at the probe of Chaetoceros, has proved the feasibility of the inventive method and the specificity of probe.
Fig. 4 has shown the detection curve to the Chaetoceros of different cell count.
Fig. 5 has shown and has used the detected result of surveying various algae at the probe of Alexandrium tamarense, has proved the feasibility of the inventive method and the specificity of probe.
Fig. 6 has shown the detection curve to the Alexandrium tamarense of different cell count.
Embodiment
The inventor is through for many years extensive and deep research, developed a kind of brand-new qualitative and quantitative analysis method at rRNA, thereby realizes the fast qualitative of biological species (as algae) and quantitatively.
As used herein, term " S1 enzyme protection analysis probe " refers to the oligonucleotide of and the S1 enzyme protection analytical procedure that be used for complementary with target RNA.Those skilled in the art can use the ordinary method of this area; by measuring biological rRNA sequence; carry out multisequencing relatively; seek out the characteristic sequence of biology to be detected; as this kind biology or such special zone of biological rRNA, then according to the special regional sequence of this rRNA (characteristic sequence) design S1 enzyme protection analysis probe.Usually this probe is about 40-100 Nucleotide, preferably is 45-75 Nucleotide, more preferably is 50～70 Nucleotide.Should be understood that the method for seeking the biologic specificity zone and all be known in the art have commercially available equipment and software to use for the technician according to the technology of special zone design probe.Existing experiment shows, also can be used as the target sequence that specific probe designs if having the continuous mispairing of 2-3 above Nucleotide or lack between the different algae rRNA.
As used herein, term " is arrested probe " and is referred to an end (being generally 3 ' end) of S1 enzyme protection analysis probe and combines, and catches the probe that gets off thereby will cut the S1 enzyme protection analysis probe that is retained in after processing and the denaturing treatment in the solution through S1 enzyme enzyme.The length of arresting probe is 12-50 Nucleotide or longer, preferably is 15～35 Nucleotide.Usually, before detecting, will arrest probe stationary, thereby form the detection carrier that ready-formed is used for sandwich hybridization in solid phase carrier.The mode that is used for fixing is not particularly limited, can be with this area fixing means commonly used, and for example combine with the vitamin H effect and be fixed on enzyme plate or sheet glass, nylon membrane and the cellulose membrane by high salt absorption, chemosynthesis or avidin.
As used herein; term " linking probe " refers to such probe; the other end of it and S1 enzyme protection analysis probe (being generally 5 ' end) complementation, thus can arrest after probe catches S1 enzyme protection analysis probe, be incorporated into the other end of S1 enzyme protection analysis probe.Usually, linking probe is about 40-100 Nucleotide, preferably be 45～70 Nucleotide, and 5 ' end or 3 ' end has the S1 enzyme protection analysis probe land of 15～35 Nucleotide approximately, with an end of S1 enzyme protection analysis probe (be different from and arrest complementary bonded one end of probe) complementation; And has the signal probe land of 15-50 Nucleotide at the other end, with the signal probe complementation.In a preference, the linking probe that is used to detect different microalgae has identical signal probe land, thereby can use general signal probe, so that further reduce cost.
As used herein, term " signal probe " refers to be incorporated into linking probe, thereby produces the probe of detectable signal.One end of signal probe and linking probe (being different from and complementary bonded one end of S1 enzyme protection analysis probe) complementation.Usually, signal probe is about 15-50 Nucleotide, 20～40 Nucleotide more preferably, and have marker at 5 ' end or 3 ' end.Marker commonly used comprises (but being not limited to): digoxin, fluorescein, vitamin H or horseradish peroxidase etc.In a preference, the signal probe that is used to detect different microalgae is identical.
A kind of signal probe of special form is the formed probe that unites two into one of the function with the function of linking probe and signal probe.Promptly linking probe not with the formed single-minded signal probes of marker such as the other end mark fluorescent element of S1 enzyme protection analysis probe, vitamin H.So special probe both worked as general linking probe, played the effect of signal probe again.Yet; shortcoming is all to need synthetic single-minded signal probe that has mark at each group detection probes; the synthetic cost is higher; and the universal signal probe can be extensively general, needn't be the synthetic single-minded expensive signal probe of each newly-designed little algae S1 enzyme protection analysis probe.
As mentioned above, those skilled in the art can use ordinary method and equipment, design and synthesize and arrest probe, linking probe and signal probe accordingly according to S1 enzyme protection analysis probe.
In brief, the inventive method be synthetic at the rRNA specific region of biology to be checked be a cover probe of core with S1 enzyme protection analysis probe, associating S1 enzyme protection analyze and the realization of sandwich hybridization technology to the qualitative and quantitative analysis of rRNA.
The principle of the inventive method as shown in Figure 2.It comprises the following steps:
(a) mixing of detected sample and S1 enzyme protection analysis probe
In this step, can handle the little algae sample to be detected that discharges rRNA through cracking and mix with S1 enzyme protection analysis probe.Also little algae sample to be detected directly can be mixed with S1 enzyme protection analysis probe, and then carry out cracking and handle, thereby discharge rRNA.In case the rRNA that discharges comprises the target sequence corresponding to S1 enzyme protection analysis probe,, then can form two strands with S1 enzyme protection analysis probe through hybridization.
(b) the S1 enzyme is handled
The S1 enzyme is that a kind of known, molecular weight is about 32, the 000 daltonian Zn of containing
2+Glycoprotein, be the specific endonuclease of a kind of strand, DNA or RNA can be degraded into acid-solubility 5 '-P Nucleotide, final 5 '-P mononucleotide that is degraded to more than 90%.Also can degrade strand part in the double-strandednucleic acid, the S1 enzyme of moderate can be in otch or small gap place cutting double-stranded DNA.If the consumption of S1 enzyme is excessive, then double-strandednucleic acid can be by complete digestion; The optimal pH of S1 enzyme is near 4.5, and doing the time spent must have cofactor Zn
2+, the inhibitor of this enzyme is certain density EDTA and phosphate cpd.It belongs to dependence Zn
2+Sugar-protein, it is stable to thermoae, in the presence of substrate 65～70 degrees centigrade still can show activity.
In the methods of the invention, after the rRNA of S1 enzyme protection analysis probe and biology to be detected hybridization, (being generally 0.05-10U/ μ l, preferably is 0.1-5U/ μ l with proper concn, more preferably being 0.5-2.5U/ μ l, is 1U/ μ l best) the excessive free probe of S1 enzymic digestion; When the non-target rRNA reaction of this probe and other, because crossbred exists otch or small gap, the S1 enzyme also can cut off this probe; Finally retain and the S1 enzyme protection analysis probe of coupling and the DNA/RNA two strands that the rRNA of target organism forms fully, and amount that should two strands has been represented the amount of corresponding rRNA in the sample.
(c) sex change of DNA-RNA heterozygote
Is dna single chain (being S1 enzyme protection analysis probe) and RNA single strand in this step with the double-stranded heterozygote sex change of DNA/RNA.Suitable denaturation method is not particularly limited, can be with this area various denaturation method commonly used, and thermally denature etc. for example.For example, add the neutralization solution post-heating, make the heterozygote sex change of the rRNA formation of S1 enzyme protection analysis probe and target organism, thereby discharge the S1 enzyme protection analysis probe that remains.Because the RNA instability, the RNA single strand of separating chain formation is easily by the RNA enzyme liberating in endogenous or source.
(d) catch S1 enzyme protection analysis probe
On solid phase carrier, arrest probe hybridization with remaining with the solution of S1 enzyme protection analysis probe and predetermined fixed, S1 enzyme protection analysis probe is arrested on solid phase carrier specifically, and non-specific combination is removed in washing.
(e) probe of combined belt detectable signal
A kind of method comprises step: (e1) with linking probe and the hybridization of captive S1 enzyme protection analysis probe, and non-specific combination is removed in washing; (e2) hybridize with linking probe again, and non-specific combination is removed in washing with the signal probe that has marker.
Another kind method is to use single-minded signal probe and the hybridization of captive S1 enzyme protection analysis probe, and washs and remove non-specific combination, and can omit step (e1) this moment.
(f) signal detection
Available this area ordinary method is carried out signal detection to detectable signal.Fluorescent signal on for example can mark on the signal probe comes reading of data by fluorescence excitation like this; Also can be on mark on the signal probe digoxin, fluorescein or vitamin H etc., antibody or the avidin by horseradish peroxidase or alkali phosphatase enzyme mark reacts with it then; Add luminous substrate or chromogenic substrate (TMB or NPP etc.) at last, come the interpretation signal by surveying luminous power or absorbancy.
Major advantage of the present invention is:
1) the probe suitability is good: the key of sandwich hybridization specific recognition is the specificity of arresting probe, generalized case is arrested long approximately 20～30 Nucleotide of probe, this probe will have specificity, must bigger difference to be arranged with the rRNA molecule of other nontarget organisms, although different biological rRNA can be variant on evolving, but find and the nearer biology of good authentication sibship between specific probe be not a nothing the matter, this may also be that the sandwich hybridization technical development only finds seldom amount to arrest one of reason of probe till now.The S1 enzyme protection analysis probe that relates among the present invention; although length is about 60 Nucleotide; but and do not require that the probe total length all will have specificity; and the region intermediate of only requiring probe has the difference of several Nucleotide to get final product; this greatly facilitates the searching and the realization of specific probe, thereby makes the present invention can be widely used in nearly all little algae.
2) stability is high: one of key of sandwich hybridization technology successful execution is to guarantee that the RNA molecule is not degraded in whole process, will guarantee to arrest that section target RNA molecule (may arrive between the hundreds of Nucleotide tens) the standing intact in whole experiment between probe and the signal probe especially.But because experimentation relates to antigen antibody reaction and washing step repeatedly, this provides more chance for the RNA enzyme to the RNA molecular degradation, so will guarantee the target RNA molecule very large difficulty that has not been degraded.Even finally can realize qualitative analysis, the confidence level of quantitative analysis is also made a discount greatly.And the direct process relevant with the rRNA molecule has only S1 enzyme protection analysis probe and this step of rRNA molecular hybridization among the present invention; as long as the rRNA molecule was not degraded or seldom is degraded when the suitable RNA enzyme inhibitors of hybridization lysate adding just can guarantee hybridization; other steps of experimental implementation all are to carry out at stable dna molecular, carry out relatively easily.Therefore stability of the present invention is higher than the sandwich hybridization technology far away.
(3) can realize a large amount of samples of rapid automatized analysis: owing to do not need extracting RNA or DNA, also do not need to carry out the PCR reaction, therefore operation is simple relatively, can realize automatization; The present invention can obtain the result about 5 hours, realized a large amount of samples of rapid detection, can satisfy the requirement of extensive at-once monitor.
(4) accuracy height as a result.Because the characteristic of S1 enzyme, can be with the S1 enzyme protection analysis probe degraded of non-specific combination, so the inventive method when being used for the little algae of qualitative detection specificity very high, and linearity is very good when being used for the little algae of detection by quantitative, the accuracy height of detected result.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Embodiment 1: to use at the S1 enzyme protection of rRNA analyze and the realization of sandwich hybridization technology to the qualitative and quantitative analysis of Chaetoceros
In the present embodiment, S1 enzyme protection analytical technology and sandwich hybridization technical tie-up are used for realizing qualitative and quantitative analysis to the biological Chaetoceros of marine red tide (Chaetoceros sp.), step is as follows:
1.1 the design of the searching in the special zone of Chaetoceros rRNA and S1 enzyme protection analysis probe is with synthetic
By measuring Chaetoceros small subunit ribosome 18S rRNA sequence and carrying out multisequencing relatively with the rRNA sequence of other algae, find its 550～700 zones different with other algae at small subunit rRNA, determine that this regional sequence is a characteristic sequence; According to characteristic sequence design with synthesize S1 enzyme protection analysis probe CHV_S1, sequence is: 5 '-TTA ATGCCAGGACGAACCACTCAAGGATGGCGCGACAACATCGAGTACCCACCAAAGGT C (SEQ IDN0:1).
According to S1 enzyme protection analysis probe design with synthesize other required probes of sandwich hybridization:
Arrest probe CHV_CAPT:
5 '-Biotin-GACCTTTGGTGGGTACTCGATGTTG (SEQ ID NO:2), long 25 Nucleotide, complementary with 3 ' end of S1 enzyme protection analysis probe, at 5 ' end vitamin H (Biotin) mark is arranged; Linking probe CHV_LINK:
5 '-CTTGAGTGGTTCGTCCTGGCATTAATAACAACTCACCTG CCGAATGAACTAGCCCTG (SEQ IDO:3) is in 5 ' end complementation of 25 Nucleotide with the S1 enzyme protection analysis probe of 5 ' end.
Universal signal probe Universal_SIGNAL_PROBE:
5 '-Fluorescein-CAGGGCTAGTTCATTCGGCAGGTGAGTT GTTA (SEQ ID NO:4), long 32 Nucleotide are marked with fluorescein (Fluorescein) at 5 ' end, and are complementary with 3 ' end of linking probe.
1.2 arrest probe stationary in enzyme plate
Arrest the fixing means of probe: add the 40nM that 100 μ l are dissolved in PBS (pH7.2) and arrest probe in each hole of the enzyme plate that is coated with avidin in advance (Pierce company), 37 degrees centigrade left standstill 2 hours.It is inferior standby to give a baby a bath on the third day after its birth with PBS.
1.3Sl enzyme protection analysis
After will counting with the marine alga sample of f2 culture medium culturing; centrifugal being collected in the 1.5ml plastics tubing; supernatant discarded; adding concentration is 1000 μ l lysate (0.8%SDS of 50nM S1 enzyme protection analysis probe (SEQ ID NO:1); 1.2M urea (Urea), 20% methane amide (Formamide), 0.3M NaCl; 50mM Tris, pH7.0).
Carry out specificity when checking, with unarmored dinoflagellate, triangle brown fat algae, middle Skeletonemacostatum, Parlova gyransButcher, film born of the same parents algae, revolve chain Chaetoceros, Ka Shi ball calcium plate algae, Isochrysis galbana, Isochrysis galbana, Alexandrium tamarense, membranous boat-shaped algae, Nitzschia closterium minutissima, each about 1000000 cell of Thalassiosira nordenskioldi Cleve and carry out above-mentioned processing respectively.
When the detection curve that carries out Chaetoceros is analyzed, with centrifugal obtain 5 * 10
7The Chaetoceros sample obtains 6 samples for five times altogether with the 10 times of stepwise dilutions of lysate that contain S1 enzyme protection analysis probe.
For the mixture of marine alga sample and S1 enzyme protection analysis probe, ultrasonication two minutes is placed mixing solutions 10 minutes at 95 degrees centigrade, hybridizes 2 hours for 70 degrees centigrade then.Add S1 enzymolysis damping fluid (the 50mM ZnSO that 500 μ l contain 800U S1 enzyme (Promega company) behind the naturally cooling
4, 500mM NaAc, 50mM NaCl pH4.5), cut processing 30 minutes at 50 degrees centigrade of enzymes.
1.4DNA-RNA the sex change of heterozygote
Add 250 μ l sex change damping fluids (1.5M NaOH, 300mM EDTA), handled 10 minutes, and be used for sandwich hybridization behind the naturally cooling for 95 degrees centigrade.This moment, the sex change of DNA-RNA heterozygote formed single stranded DNA (promptly once being incorporated into the S1 enzyme protection analysis probe of target sequence) and single stranded RNA.Meanwhile, single stranded RNA is degraded, so only contains the S1 enzyme protection analysis probe that once was incorporated into target sequence in the solution.
1.5 sandwich hybridization
Arrest: the reaction mixture after the above-mentioned sex change of 100 μ l is moved into respectively pre-fixes in the enzyme plate micropore of arresting probe (SEQ IDNO:2), 50 degrees centigrade of hybridization 1 hour is washed 6 times with the 0.1 * SSC washings that contains 0.1%SDS.
Sandwich hybridization: every hole adds the hybridization buffer that contains 100 μ l 5nM linking probes (SEQ ID NO:3), and (2 * SSC 0.1%SDS), in 50 degrees centigrade of hybridization 30 minutes, washes 6 times with the 0.1 * SSC washings that contains 0.1%SDS; Every hole adds the hybridization buffer that contains 100ul 5nM universal signal probe (SEQ ID NO:4), and (2 * SSC 0.5%SDS) in 50 degrees centigrade of hybridization 30 minutes, washes 6 times with the 0.1 * SSC washings that contains 0.1%SDS.
1.6 signal detection
Enzyme plate is washed 6 times with phosphoric acid buffer (PBS); The adding of every hole has contained underlined the anti-fluorescein antibody of horseradish peroxidase (available from Roche company), and 37 degrees centigrade were reacted 30 minutes, and washed 6 times with PBS then; Every hole adds TMB (available from Pierce company) colour developing liquid 100 μ l, handles after 15 minutes for 37 degrees centigrade, and every hole adds 50 μ l 2M sulfuric acid.Enzyme plate is placed on the plate reading machine in 450nm mensuration absorbance value.
1.6 result
Detected result as shown in Figure 3 and Figure 4.
Fig. 3 has shown and has used the detected result of surveying various algae at the probe of Chaetoceros, has proved that the inventive method has high feasibility and specificity.
Fig. 4 has shown the detection curve to the Chaetoceros of different cell count.Data are carried out match with conventional statistical method, obtain following relation
y＝2.6571x+13.617；
R
2＝0.9965；
X is the 0D. of practical measurement
450Natural logarithm, y is the natural logarithm of the cell count in the sample; R is a relation conefficient.
Following table has been listed with the Chaetoceros sample size of present embodiment method mensuration and microscopic count result's comparison:
| OD. 450nm | The cell count that present method is measured | The cell count that microscopic count obtains |
| 1.235 | 1436637 | 1.5E+06 |
| 0.511 | 137740 | 1.5E+05 |
| 0.211 | 13134 | 1.5E+04 |
Embodiment 2: to use at the S1 enzyme protection of rRNA analyze and the realization of sandwich hybridization technology to the qualitative and quantitative analysis of Alexandrium tamarense
In the present embodiment, S1 enzyme protection analytical technology and multiple sandwich hybridization technique are united the qualitative and quantitative analysis that is used for realizing to Alexandrium tamarense (Alexandrium tamarense), step is as follows:
2.1 the design of the searching in the special zone of Alexandrium tamarense rRNA and S1 enzyme protection analysis probe is with synthetic
By measuring Alexandrium tamarense small subunit ribosome 18S rRNA sequence and carrying out multisequencing relatively with the rRNA sequence of other algae, find its 600～800 zones different with other algae at small subunit rRNA, determine that this regional sequence is a characteristic sequence; According to characteristic sequence design with synthesize S1 enzyme protection analysis probe ALT S1:5 '-CACACCACACAGTCAAGTGCAGTTGTGCTTTCAAGATAAATGCTCAGGCTGTGCCA AAT (SEQ IDNO:5).
According to S1 enzyme protection analysis probe design with synthesize other required probes of sandwich hybridization:
Arrest probe ALT CAPT:
5 '-Biotin-GACCTTTGGTGGGTACTCGATGTTG (SEQ ID NO:6), long 24 Nucleotide, complementary with 5 ' end of S1 enzyme protection analysis probe, at 5 ' end biotin labeling is arranged;
Linking probe AlT LINK:
5 '-ACAACTGCACTTGACTGTGTGGTGT GTAACAACTCACCTGCCGAATGAACTAGCCCTG (SEQID NO:7) is in 3 ' end complementation of 25 Nucleotide with the S1 enzyme protection analysis probe of 5 ' end.
Signal probe SIGNAL PROBE:
5 '-Fluorescein-CAGGGCTAGTTCATTCGGCAGGTGAGTTGTTA (SEQ ID NO:4), long 32 Nucleotide are marked with fluorescein at 5 ' end, with the 3 ' end complementary (with embodiment 1) of linking probe.
2.2 arrest probe stationary in enzyme plate
Method is with embodiment 1.1, and difference only is the probe of arresting that probe is replaced Chaetoceros of arresting with Alexandrium tamarense.
2.3S1 enzyme protection analysis
Method is with embodiment 1.3, and difference is to replace Chaetoceros sample to be analyzed with Alexandrium tamarense sample to be analyzed.
2.4DNA-RNA the sex change of heterozygote
Method is with embodiment 1.4.
2.5 sandwich hybridization
Method is with embodiment 1.5, and difference only is to replace with the linking probe of Alexandrium tamarense the linking probe of Chaetoceros.
2.6 signal detection
Method is with embodiment 1.6.
2.7 result
Detected result as shown in Figure 5 and Figure 6.
Fig. 5 has shown and has used the detected result of surveying various algae at the probe of Alexandrium tamarense, has proved that the inventive method has high feasibility and specificity.
Fig. 6 has shown the detection curve to the Alexandrium tamarense of different cell count.Data are carried out match with conventional statistical method, obtain following relation
y＝2.1496x+9.6158
R
2＝0.9993
X is the OD. of practical measurement
450Natural logarithm, y is the natural logarithm of the cell count in the sample; R
2Be relation conefficient.
Following table has been listed with the Alexandrium tamarense sample size of present embodiment method mensuration and microscopic count result's comparison:
| OD. 450nm | The cell count that present method is measured | The cell count that microscopic count obtains |
| 1.361 | 29059 | 3.0E+04 |
| 0.678 | 6505 | 6.0E+03 |
| 0.337 | 1447 | 1.2E+03 |
Embodiment 3: to use at the S1 enzyme protection of rRNA analyze and the realization of sandwich hybridization technology to the qualitative and quantitative analysis of Chaetoceros
In the present embodiment, repeat each step of embodiment 1, difference only is not use general signal probe, but the direct mark fluorescent element of 5 of single-minded signal probe ' end (function that is about to linking probe and signal probe unites two into one).
The result has obtained the qualitative results with embodiment 1 identical Chaetoceros, with almost completely identical detection by quantitative result.Yet; the shortcoming of this embodiment is all to need synthetic single-minded signal probe that has mark at each group detection probes; the synthetic cost is higher; and embodiment 1 and the 2 universal signal probes that use can be extensively general, needn't be the synthetic single-minded expensive signal probe of each newly-designed little algae S1 enzyme protection analysis probe.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table
＜110〉Chinese Marine University
Shanghai Communications University
＜120〉algae is carried out the method that qualitative and quantitative is analyzed
<130>045545
<160>7
<170>PatentIn version 3.1
<210>1
<211>60
<212>DNA
＜213〉Chaetoceros (Chaetoceros sp)
<400>1
ttaatgccag gacgaaccac tcaaggatgg cgcgacaaca tcgagtaccc accaaaggtc 60
<210>2
<211>25
<212>DNA
＜213〉Chaetoceros (Chaetoceros sp)
<400>2
gacctttggt gggtactcga tgttg 25
<210>3
<211>57
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉linking probe
<400>3
cttgagtggt tcgtcctggc attaataaca actcacctgc cgaatgaact agccctg 57
<210>4
<211>32
<212>DNA
＜213〉artificial sequence
<220〉
<221>misc_feature
＜223〉signal probe
<400>4
cagggctagt tcattcggca ggtgagttgt ta 32
<210>5
<211>59
<212>DNA
＜213〉Alexandrium tamarense (Alexandrium tamarense)
<400>5
cacaccacac agtcaagtgc agttgtgctt tcaagataaa tgctcaggct gtgccaaat 59
<210>6
<211>25
<212>DNA
＜213〉Alexandrium tamarense (Alexandrium tamarense)
<400>6
gacctttggt gggtactcga tgttg 25
<210>7
<211>58
<212>DNA
＜213〉artificial sequence
<400>7
acaactgcac ttgactgtgt ggtgtgtaac aactcacctg ccgaatgaac tagccctg 58
Claims (10)
1. the method for algae in the test sample is characterized in that this method may further comprise the steps:
(a) with the mixing and the hybridization of detected sample and S1 enzyme protection analysis probe, form mixing solutions;
(b) under the condition of being fit to, with the mixing solutions of S1 enzyme treatment step (a), thus the strand part in cutting single-chain nucleic acid and the degraded double-strandednucleic acid;
(c) solution to step (b) carries out denaturing treatment, thereby discharges S1 enzyme protection analysis probe;
(d) with the probe of arresting that is fixed on the solid phase carrier, protected S1 enzyme protection analysis probe is arrested specifically on solid phase carrier;
(e) with single-minded signal probe that has detectable signal and the hybridization of S1 enzyme protection analysis probe; Perhaps, hybridize with linking probe again with the universal signal probe that has detectable signal then with linking probe and the hybridization of S1 enzyme protection analysis probe;
(f) detect detectable signal, thereby determine kind and/or the quantity of algae in the sample.
2. the method for claim 1 is characterized in that, the length of described S1 enzyme protection analysis probe is 40-100 Nucleotide, and specificity is incorporated into the rRNA specific region of one or more algae.
3. the method for claim 1 is characterized in that, described length of arresting probe is 12～50 Nucleotide, and specificity is incorporated into an end of S1 enzyme protection analysis probe.
4. the method for claim 1; it is characterized in that; the length of described linking probe is 40～100 Nucleotide; and the S1 enzyme protection analysis probe land that 15～35 Nucleotide are at one end arranged approximately; arrest an end complementation of probe with the debond of S1 enzyme protection analysis probe; and has the signal probe land of 15-50 Nucleotide at the other end, with the signal probe complementation.
5. the method for claim 1, it is characterized in that, the length of described single-minded signal probe is 15～50 Nucleotide, with the debond of S1 enzyme protection analysis probe in an end complementation of arresting probe, and be selected from the marker of group down described having: digoxin, fluorescein, vitamin H, horseradish peroxidase or other combination at 5 ' end or 3 ' end;
Perhaps; the length of described universal signal probe is 15～50 Nucleotide; with the debond of linking probe in an end complementation of S1 enzyme protection analysis probe, and be selected from the marker of group down described having: digoxin, fluorescein, vitamin H, horseradish peroxidase or other combination at 5 ' end or 3 ' end.
6. the method for claim 1; it is characterized in that; described method is used for qualitative or the detection by quantitative Chaetoceros, and S1 enzyme protection analysis probe, arrests probe sequence, linking probe sequence and signal probe sequence and have the nucleotide sequence shown in the SEQ ID NO:1,2,3,4 respectively.
7. the method for claim 1; it is characterized in that; described method is used for qualitative or the detection by quantitative Alexandrium tamarense, and S1 enzyme protection analysis probe, arrests probe sequence, linking probe sequence and signal probe sequence and have the nucleotide sequence shown in the SEQ ID NO:5,6,7,4 respectively.
8, the test kit of algae in a kind of test sample is characterized in that it comprises following assembly:
(a) S1 enzyme protection analysis probe, the length of described S1 enzyme protection analysis probe are 40-100 Nucleotide, and specificity is incorporated into the rRNA specific region of algae;
(b) arrest probe, described length of arresting probe is 12～50 Nucleotide, and specificity is incorporated into an end of S1 enzyme protection analysis probe;
(c) linking probe; the length of described linking probe is 40～100 Nucleotide; and the S1 enzyme protection analysis probe land that 15～35 Nucleotide are at one end arranged approximately; arrest an end complementation of probe with the debond of S1 enzyme protection analysis probe; and the signal probe land that has 15-50 Nucleotide at the other end; with the signal probe complementation, supplementary condition are to be when signal probe
(d1) described single-minded signal probe Then there is not linking probe:
(d) signal probe, described linking probe is selected from down group:
(d1) length of described single-minded signal probe is 15～50 Nucleotide, with the debond of S1 enzyme protection analysis probe in an end complementation of arresting probe, and be selected from the marker of group down described having: digoxin, fluorescein, vitamin H, horseradish peroxidase or other combination at 5 ' end or 3 ' end;
(d2) length of described universal signal probe is 15～50 Nucleotide; with the debond of linking probe in an end complementation of S1 enzyme protection analysis probe, and be selected from the marker of group down described having: digoxin, fluorescein, vitamin H, horseradish peroxidase or other combination at 5 ' end or 3 ' end.
9. test kit as claimed in claim 8; it is characterized in that; described test kit is used for qualitative or the detection by quantitative Chaetoceros, and S1 enzyme protection analysis probe, arrests probe sequence, linking probe sequence and signal probe sequence and have the nucleotide sequence shown in the SEQ ID NO:1,2,3,4 respectively.
10. test kit as claimed in claim 8; it is characterized in that; described test kit is used for qualitative or the detection by quantitative Alexandrium tamarense, and S1 enzyme protection analysis probe, arrests probe sequence, linking probe sequence and signal probe sequence and have the nucleotide sequence shown in the SEQ ID NO:5,6,7,4 respectively.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2004100535313A CN100352937C (en) | 2004-08-06 | 2004-08-06 | Method of qualitative and quantitative analysis for algae |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2004100535313A CN100352937C (en) | 2004-08-06 | 2004-08-06 | Method of qualitative and quantitative analysis for algae |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1730662A true CN1730662A (en) | 2006-02-08 |
| CN100352937C CN100352937C (en) | 2007-12-05 |
Family
ID=35963083
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2004100535313A Expired - Fee Related CN100352937C (en) | 2004-08-06 | 2004-08-06 | Method of qualitative and quantitative analysis for algae |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100352937C (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103667473A (en) * | 2013-12-06 | 2014-03-26 | 江南大学 | Schizochytrium limacinum strain detection probe group |
| CN103667474A (en) * | 2013-12-06 | 2014-03-26 | 江南大学 | Nannochloropsis sp. detection probe group |
| CN107132326A (en) * | 2017-05-04 | 2017-09-05 | 天津大学 | A kind of device of in-site detecting halomereid species and biomass |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101845484B (en) * | 2009-03-24 | 2012-05-30 | 中国水产科学研究院东海水产研究所 | Identification method for heterocapsa circularisquama |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPH04135498A (en) * | 1990-09-28 | 1992-05-08 | Toshiba Corp | Detection of gene |
| US6232066B1 (en) * | 1997-12-19 | 2001-05-15 | Neogen, Inc. | High throughput assay system |
| CN1277933C (en) * | 2000-08-24 | 2006-10-04 | 清华大学 | Method and composite for identifying nucleic acid molecule by nucleic acid enzymolysis activity and hybrid technology |
| CN1293255A (en) * | 2000-10-25 | 2001-05-02 | 中国科学院武汉病毒研究所 | Process for detecting gene mutation on glass plate |
-
2004
- 2004-08-06 CN CNB2004100535313A patent/CN100352937C/en not_active Expired - Fee Related
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103667473A (en) * | 2013-12-06 | 2014-03-26 | 江南大学 | Schizochytrium limacinum strain detection probe group |
| CN103667474A (en) * | 2013-12-06 | 2014-03-26 | 江南大学 | Nannochloropsis sp. detection probe group |
| CN107132326A (en) * | 2017-05-04 | 2017-09-05 | 天津大学 | A kind of device of in-site detecting halomereid species and biomass |
Also Published As
| Publication number | Publication date |
|---|---|
| CN100352937C (en) | 2007-12-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1814805A (en) | H5, H7, H9 subtype auian flu virus real-time fluo rescent quantixative PCR detecting method | |
| CN1294262C (en) | Method for collecting and using nuclear mRNA | |
| CN1932041A (en) | The primers specific to cervus elaphus, c. nippon, c. canadensis and rangifer tarandus gene and the method to identify cervi parvum cornu species | |
| CN1582341A (en) | Method of isolating cells and uses thereof | |
| CN1274846C (en) | Assay systems, kits and methods for detecting microorganisms | |
| CN101045943A (en) | Process of PCR detecting salmonella with added amplifying internal standard | |
| CN1955310A (en) | Nucleotide sequential, testing kit and method for detecting swine streptococcus II | |
| CN1406285A (en) | Method for detecting and quantifying adenovirus | |
| CN1824801A (en) | Real-time fluorescent PCR testing primer, probe and immobilized kit for citrus ulcer bacteria and testing process thereof | |
| CN1730662A (en) | Method of qualitative and quantitative analysis for algae | |
| CN1900314A (en) | Fluorescence labelling ABO gene typing method and its reagent kit | |
| CN1724686A (en) | Target sequence used for detecting mycoplasma pnoumoniae and reagent box | |
| CN1772922A (en) | Method of identifying invasion of south American glim ant and its nucleic acid sequence, probe and reagent kit | |
| CN1661112A (en) | Detection reagent for shiga toxin family gene of entero-hemorrhagic escherichia coli | |
| CN1188530C (en) | Gene detection reagent kit for SARS virus and its detection method | |
| CN100351395C (en) | Norwalk virus expression detecting kit and its special primer and probe | |
| CN1710097A (en) | Insitu method for rapid qualitative identification of red tide micro algae | |
| CN101045942A (en) | Transgenic papaya and detection of transgenic component in transgenic papaya product | |
| CN1810988A (en) | Method and kit for detecting ox and sheep components in feed | |
| CN1536091A (en) | Quick quantitative detection of genetic marker of skeletonema costatum japonicum and its method | |
| CN1557966A (en) | Internal standard gene suitable to exogenous gene detection such as transgene cotton and application thereof | |
| CN1277935C (en) | Detection probe of phaeocystis | |
| CN1480538A (en) | Quantitative measuring transgene component in transgene rapeseed and processed product | |
| CN1298864C (en) | Detection probe for ocean Prorocentrum | |
| CN1298865C (en) | Detection probe for Heterosigma akashiwo Hada |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20071205 Termination date: 20130806 |