CN1298865C - Detection probe for Heterosigma akashiwo Hada - Google Patents
Detection probe for Heterosigma akashiwo Hada Download PDFInfo
- Publication number
- CN1298865C CN1298865C CNB2004100678073A CN200410067807A CN1298865C CN 1298865 C CN1298865 C CN 1298865C CN B2004100678073 A CNB2004100678073 A CN B2004100678073A CN 200410067807 A CN200410067807 A CN 200410067807A CN 1298865 C CN1298865 C CN 1298865C
- Authority
- CN
- China
- Prior art keywords
- probe
- enzyme
- enzyme protection
- algae
- protection analysis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a detecting probe for red tide hinge algae, which belongs to the field of nucleic acid detection and is used for carrying out S1 enzyme protection analysis and sandwich hybridization detection to the algae. The present invention concretely comprises three correlative oligonucleotide probes, wherein an S1 enzyme protecting and analyzing probe only complements nucleotide in 150 to 300 regions of ribosome small subunit of the red tide hinge algae and has no homology with other kinds of alga ribosome RNA when the bioinformatics comparison is analyzed, and the length of the S1 enzyme protecting and analyzing probe is 59 bp. The S1 enzyme protecting and analyzing probe can be specifically combined on rRNA of the red tide hinge algae under a definite condition, and the sequence is 5'-GGCAGAAACTTGAATGAACCATCGACCGAAGTCGATTCGCACAGTTACTATGATTCACC. The present invention has the advantages of favorable applicability of the probes and convenient search and realization of the specific probes. The stability of the present invention is much higher than that of sandwich hybridization technology.
Description
Technical field
The present invention relates to the oligonucleotide probe that one group of algae detects, specifically is the specific probe that detects at the Heterosigma akashiwo qualitative and quantitative.Belong to the detection of nucleic acids field.
Background technology
Heterosigma akashiwo (Heterosigma akashiwo) is a kind of extensive distribution and the common Flagellatae of world's immediate offshore area, it is one of main red tide plankton, have repeatedly to form harmful algal, cause the record of cultured fishes mass mortality, bring grave danger for marine fishery and human health.Therefore, detect the population dynamics of Heterosigma akashiwo in the ocean environment in time, accurately and rapidly, it is significant to understand its number change in the ocean at any time.Traditional discrimination method that utilizes opticmicroscope direct viewing and counting, process is loaded down with trivial details, time-consuming, effort, and needs empirical systematicalian and participate.When sample size many, rich biodiversity, therefore workload was very big when monitoring range was wide, was mainly used in the qualitative of algae and separated, and be not suitable for the study on monitoring quantitatively and on a large scale of algae.So novel method and new technology that development is used for fast, accurately detecting Heterosigma akashiwo have realistic meaning.But at present international and domestic progress about this respect is little, does not form as yet very effectively to carry out qualitative and mature technology detection by quantitative to this algae.Because rRNA is considered to and the closely-related sequence of the phyletic evolution of algae, and rRNA content is very high in the eukaryotic cells, can reach 10
6～10
7Individual copy, rRNA are the good target spots of sandwich hybridization.
Find by prior art documents, Christopher A.Scholin etc. are in " utilizing rRNA southern rhombus algae of identification in full cell and " sandwich " hybridization " (U.S.'s " phycology magazine ", 1996,35 (3), 190～197) in the literary composition with the RNA that extracts or frustule lysate under certain condition with the oligonucleotide probe hybridization that is combined on 96 orifice plates after, hybridize with it with the signal probe of a mark again, carry out the enzyme labelled antibody color reaction at last, obtained satisfied result.Use to some extent in the monitoring of the present marine algae of this technology.But up to the present, use little algae that this technology can detect and be only limited to limited several (comprising Heterosigma akashiwos).Its main drawback is: one, and because of the length of capture probe 10～30bp only, the capture probe quantity that therefore can effectively distinguish the nearer little algae of sibship is few; Two, in whole testing process, all need to prevent the RNA degraded, yet each step such as washing, antibody response very easily causes the RNA degraded, so operation easier is big, the detected result fluctuation is big.
Summary of the invention
The objective of the invention is to overcome the deficiencies in the prior art; one group of detection probes at the specific Heterosigma akashiwo of Heterosigma akashiwo rRNA is provided; according to this group probe this algae is carried out that the S1 enzyme protection is analyzed and sandwich hybridization detects, realize the fast qualitative of this algae and quantitative.
The present invention is used for this algae is carried out analysis of S1 enzyme protection and sandwich hybridization detection; specifically comprise three oligonucleotide probes that are mutually related: S1 enzyme protection analysis probe; arrest probe; signal probe or linking probe; described S1 enzyme protection analysis probe; be meant complementary and be used for the oligonucleotide probe of S1 enzyme protection analytical procedure with Heterosigma akashiwo rRNA; the described probe of arresting; be meant with an end of S1 enzyme protection analysis probe and combine; this end is generally 3 ' end; an other end is marked with vitamin H; thereby will through S1 enzyme enzyme cut handle and denaturing treatment after be retained in S1 enzyme protection analysis probe in the solution and catch the probe that gets off; described signal probe or linking probe can arrested after probe catches S1 enzyme protection analysis probe; be incorporated into S1 enzyme protection analysis probe the other end probe be linking probe; this probe mark has detectable signal simultaneously; perhaps at one end have the signal probe land, can with the complementation of universal signal probe.
S1 enzyme protection analysis probe is when carrying out the information biology compare of analysis; only with small subunit ribosome 150～300 regional Nucleotide complementations; and do not have homology with other algae ribosome-RNA(rRNA); length is 59bp; but specificity is incorporated on the rRNA of Heterosigma akashiwo under certain conditions, and sequence is: 5 '-GGCAGAAACTTGAATGAACCATCGACCGAAGTCGATTCGCACAGTTACTATGATTC ACC.By measuring the rRNA sequence of Heterosigma akashiwo, carry out multisequencing relatively, seek the characteristic sequence of Heterosigma akashiwo, as the special zone of the rRNA of this algae, then according to the special regional sequence of this rRNA (characteristic sequence) design S1 enzyme protection analysis probe.Seek the method in biologic specificity zone and all adopt prior art according to special zone design probe.Existing experiment shows, just can be used as the target sequence that specific probe designs if having the continuous mispairing of 2～3 above Nucleotide or lack between the different algae rRNA.
Arrest probe specificity and be incorporated into S1 enzyme protection analysis probe one end; length is 27bp; sequence signature is: 5 '-GGTGAATCATAGTAACTGTGCGAATCG; be marked with vitamin H, phosphate group at 5 ' end, perhaps amino group and other any marks that can be used for can be for fixing to the marks of solid substrate
Signal probe or linking probe have the complementary district of universal signal probe at the other end, combine with the universal signal probe is complementary, and sequence is: 5 '-TCGATGGTTCATTCAAGTTTCTGCC; The signal of the various detections of mark on this sequence specifically comprises: fluorescein, digoxin, vitamin H are used for the sequence of signal detection, perhaps with general one section sequence of signal probe complementary.
One end of universal signal probe and linking probe (being different from and complementary bonded one end of S1 enzyme protection analysis probe) complementation.Marker commonly used comprises (but being not limited to): digoxin, fluorescein, vitamin H or horseradish peroxidase etc.
In brief, The present invention be directed to the rRNA specific region of Heterosigma akashiwo synthetic is one group of probe of core with S1 enzyme protection analysis probe, associating S1 enzyme protection analyze and the realization of sandwich hybridization technology to the qualitative and quantitative detection of Heterosigma akashiwo rRNA.
This group probe of the present invention can be used for whether to have Heterosigma akashiwo and quantity thereof in analysis of S1 enzyme protection and the sandwich hybridization technology for detection sample, and described testing process comprises the following steps:
(a) mixing of detected sample and S1 enzyme protection analysis probe
In this step, can handle the little algae sample to be detected that discharges rRNA through cracking and mix with S1 enzyme protection analysis probe.Also little algae sample to be detected directly can be mixed with S1 enzyme protection analysis probe, and then carry out cracking and handle, thereby discharge rRNA.In case the rRNA that discharges comprises the target sequence corresponding to S1 enzyme protection analysis probe,, then can form two strands with S1 enzyme protection analysis probe through hybridization.
(b) the S1 enzyme is handled
After the rRNA of S1 enzyme protection analysis probe and biology to be detected hybridization, with the excessive free probe of S1 enzymic digestion of proper concn (being generally 0.5U～2U/ μ l, preferably is 1U/ μ l); When the non-target rRNA reaction of this probe and other, because crossbred exists otch or small gap, the S1 enzyme also can cut off this probe; Finally retain and the S1 enzyme protection analysis probe of coupling and the DNA/RNA two strands that the rRNA of Heterosigma akashiwo forms fully, and amount that should two strands has been represented the amount of corresponding rRNA in the sample.
(c) sex change of DNA-RNA heterozygote
With the double-stranded heterozygote sex change of DNA/RNA is dna single chain (being S1 enzyme protection analysis probe) and RNA single strand.Suitable denaturation method is not particularly limited, can be with this area various denaturation method commonly used, and thermally denature etc. for example.For example, add the neutralization solution post-heating, make the heterozygote sex change of the rRNA formation of S1 enzyme protection analysis probe and target organism, thereby discharge the S1 enzyme protection analysis probe that remains.Because the RNA instability, the RNA single strand of separating chain formation is easily by the RNA enzyme liberating of endogenous or external source.
(d) catch S1 enzyme protection analysis probe
On solid phase carrier, arrest probe hybridization with remaining with the solution of S1 enzyme protection analysis probe and predetermined fixed, S1 enzyme protection analysis probe is arrested on solid phase carrier specifically, and non-specific combination is removed in washing.
(e) probe of combined belt detectable signal
With linking probe and the hybridization of captive S1 enzyme protection analysis probe, and wash and remove non-specific combination, use signal probe to combine again, and non-specific combination is removed in washing with linking probe.
(f) signal detection
Available this area ordinary method is carried out signal detection to detectable signal.Fluorescent signal on for example can mark on the signal probe comes reading of data by fluorescence excitation like this; Also can be on mark on the signal probe digoxin, fluorescein or vitamin H etc., antibody or the avidin by horseradish peroxidase or alkali phosphatase enzyme mark reacts with it then; Add luminous substrate or chromogenic substrate (TMB or NPP etc.) at last, come the interpretation signal by surveying luminous power or absorbancy.
Major advantage of the present invention is:
(1) the probe suitability is good: the key of sandwich hybridization specific recognition is the specificity of arresting probe, generalized case is arrested long approximately 20～30 Nucleotide of probe, this probe will have specificity, must bigger difference to be arranged with the rRNA molecule of other nontarget organisms, although different biological rRNA can be variant on evolving, but find and the nearer biology of good authentication sibship between specific probe be not a nothing the matter, this may also be that the sandwich hybridization technical development only finds seldom amount to arrest one of reason of probe till now.The S1 enzyme protection analysis probe that relates among the present invention; although length is about 60 Nucleotide; but and do not require that the probe total length all will have specificity, and only require that the region intermediate of probe has the difference of several Nucleotide to get final product, this greatly facilitates the searching and the realization of specific probe.
(2) stability is high: one of key of sandwich hybridization technology successful execution is to guarantee that the RNA molecule is not degraded in whole process, will guarantee to arrest that section target RNA molecule (may arrive between the hundreds of Nucleotide tens) the standing intact in whole experiment between probe and the signal probe especially.But because experimentation relates to antigen antibody reaction and washing step repeatedly, this provides more chance for the RNA enzyme to the RNA molecular degradation, so will guarantee the target RNA molecule very large difficulty that has not been degraded.Even finally can realize qualitative analysis, the confidence level of quantitative analysis is also made a discount greatly.And the direct process relevant with the rRNA molecule has only S1 enzyme protection analysis probe and this step of rRNA molecular hybridization among the present invention; as long as the rRNA molecule was not degraded or seldom is degraded when the suitable RNA enzyme inhibitors of hybridization lysate adding just can guarantee hybridization; other steps of experimental implementation all are to carry out at stable dna molecular, carry out relatively easily.Therefore stability of the present invention is higher than the sandwich hybridization technology far away.
Description of drawings
The various algae synoptic diagram of Fig. 1 the present invention
Fig. 2 shows the detection curve synoptic diagram to the Heterosigma akashiwo of different cell count
Embodiment
Below in conjunction with accompanying drawing, further set forth the present invention at specific embodiment.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (NewYork:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Embodiment: use at the S1 enzyme protection of rRNA analyze and the sandwich hybridization technology to the Heterosigma akashiwo qualitative and quantitative detection
In the present embodiment, S1 enzyme protection analytical technology and sandwich hybridization technical tie-up are used for realizing qualitative and detection by quantitative to the biological Heterosigma akashiwo of marine red tide (Heterosigma akashiwo), step is as follows:
1.1 the design of the searching in the special zone of Heterosigma akashiwo rRNA and S1 enzyme protection analysis probe is with synthetic
By measuring Heterosigma akashiwo small subunit ribosome 18S rRNA sequence and carrying out multisequencing relatively with the rRNA sequence of other algae, find its 150～300 zones different with other algae at small subunit rRNA, determine that this regional sequence is a characteristic sequence; According to characteristic sequence design with synthesize S1 enzyme protection analysis probe HER_S1:5 '-GGCAGAAACTTGAATGAACCATCGACCGAAGTCGATTCGCACAGTTACTATGATTC ACC (SEQ IDNO.1).
According to S1 enzyme protection analysis probe design with synthesize other required probes of sandwich hybridization:
Arrest probe HER_CAPT:
5 '-Biotin-GGTGAATCATAGTAACTGTGCGAATCG (SEQ ID NO.2), complementary with 3 ' end of S1 enzyme protection analysis probe, at 5 ' end vitamin H (Biotin) mark is arranged;
Linking probe HER_LINK:
5 '-
TCGATGGTTCATTCAAGTTTCTGCCTAACAACTCACCTGCCGAATGAACTAGCCCTG (SEQID NO.3), complementary at 25 Nucleotide of 5 ' end with 5 ' end of S1 enzyme protection analysis probe, hold complementation at 32 Nucleotide of 3 ' end with 5 ' of universal signal probe.
1.2 arrest probe stationary in enzyme plate
Arrest the fixing means of probe: add the 40nM that 100 μ l are dissolved in CBS (pH 7.2) and arrest probe in each hole of the enzyme plate that is coated with avidin in advance (Pierce company), 37 ℃ left standstill 2 hours.It is inferior standby to give a baby a bath on the third day after its birth with PBS.
1.3S1 enzyme protection analysis
Will be with behind the marine alga sample of the f2 culture medium culturing counting, centrifugally be collected in the 1.5ml plastics tubing supernatant discarded; adding concentration is 1000 μ l lysate (0.8%SDS, 1.2M Urea, 20%Formamide of 50nM S1 enzyme protection analysis probe; 0.3M NaCl, 50mM Tris, pH 7.0).
Carry out specificity when checking of Heterosigma akashiwo, with unarmored dinoflagellate, Michaelis unarmored dinoflagellate, Alexandrium tamarense, Chaetoceros, middle Skeletonemacostatum, Nitzschia closterium minutissima, Thalassiosira nordenskioldi Cleve, membranous boat-shaped algae, melosira, red englena, ocean Prorocentrum, minisize Prorocentrum, spine rhombus algae etc. each about 10
6Individual cell carries out above-mentioned processing respectively.
When carrying out the detection curve analysis of Heterosigma akashiwo, the Heterosigma akashiwo sample that filtration is collected obtains 7 samples for 6 times altogether with the 10 times of stepwise dilutions of lysate that contain S1 enzyme protection analysis probe.。
For the mixture of marine alga sample and S1 enzyme protection analysis probe, ultrasonication two minutes is placed mixing solutions 10 minutes at 95 ℃, hybridizes 2 hours for 70 ℃ then.Add S1 enzymolysis damping fluid (the 50mM ZnSO that 500 μ l contain 800US1 enzyme (Promega company) behind the naturally cooling
4, 500mM NaAc, 50mM NaClpH4.5), cut processing 30 minutes at 50 ℃ of enzymes.
1.4DNA-RNA the sex change of heterozygote
Add 250 μ l sex change damping fluids (1.5M NaOH, 300mM EDTA), handled 10 minutes, and be used for sandwich hybridization behind the naturally cooling for 95 ℃.This moment, the sex change of DNA-RNA heterozygote formed single stranded DNA (promptly once being incorporated into the S1 enzyme protection analysis probe of target sequence) and single stranded RNA.Meanwhile, single stranded RNA is degraded, so only contains the S1 enzyme protection analysis probe that once was incorporated into target sequence in the solution.
1.5 sandwich hybridization
Arrest: the reaction mixture after the above-mentioned sex change of 100 μ l is moved into respectively pre-fixes in the enzyme plate micropore of arresting probe, 50 ℃ of hybridization 1 hour is washed 6 times with the 0.1 * SSC washings that contains 0.1%SDS.
Sandwich hybridization: every hole adds the hybridization buffer that contains 100 μ l 5nM linking probes, and (2 * SSC 0.1%SDS), in 50 ℃ of hybridization 30 minutes, washes 6 times with the 0.1 * SSC washings that contains 0.1%SDS; Every hole adds the hybridization buffer that contains 100ul 5nM signal probe, and (2 * SSC 0.5%SDS) in 50 ℃ of hybridization 30 minutes, washes 6 times with the 0.1 * SSC washings that contains 0.1%SDS.
1.6 signal detection
Enzyme plate is washed 6 times with phosphoric acid buffer (PBS); The adding of every hole has contained underlined the anti-fluorescein antibody of horseradish peroxidase (available from Roche company), hatches 30 minutes for 37 ℃, washes 6 times with PBS then; Every hole adds TMB (available from Pierce company) colour developing liquid 100 μ l, handles after 15 minutes for 37 ℃, and every hole adds 50 μ l2M sulfuric acid termination reactions.Enzyme plate is placed on the plate reading machine in 450nm mensuration absorbance value.
1.7 result
Detected result as depicted in figs. 1 and 2.
Fig. 1 has shown and has used the detected result of surveying various algae at the probe of Heterosigma akashiwo, has proved that the inventive method has high feasibility and specificity.
Data are carried out match with conventional statistical method, obtain following relation
y＝0.0002x-0.0643；
R
2＝0.9943；
X is the cell count of Heterosigma akashiwo in the sample, and y is the OD. of practical measurement
450, R
2Be relation conefficient.
Following table has been listed with the Heterosigma akashiwo sample size of present embodiment method mensuration and microscopic count result's comparison:
| OD. 450nm | The cell count that present method is measured | The cell count that microscopic count obtains |
| 2.565 | 13146 | 1.5E+04 |
| 1.235 | 6496 | 6.2E+03 |
| 0.511 | 2876 | 3.0E+03 |
Sequence that the present invention relates to and mark are as follows respectively:
(1) information of SEQ ID NO.1
＜110〉Chinese Marine University of Shanghai Communications University
＜120〉Heterosigma akashiwo S1 enzyme protection analysis probe
<160>1
<170>PatentIn Version 2.1
<210>1
<211>59
<212>DNA
＜213〉artificial sequence
<400>1
GGCAGAAACTTGAATGAACCATCGACCGAAGTCGATTCGCACAGTTACTATGATTCACC
(2) information of SEQ ID NO.2
＜110〉Chinese Marine University of Shanghai Communications University
＜120〉Heterosigma akashiwo is arrested probe
<160>1
<170>PatentIn Version 2.1
<210>1
<211>27
<212>DNA
＜213〉artificial sequence
<400>1
GGTGAATCATAGTAACTGTGCGAATCG
(3) information of SEQ ID NO.3
＜110〉Chinese Marine University of Shanghai Communications University
＜120〉Heterosigma akashiwo signal probe (linking probe)
<160>1
<170>PatentIn Version 2.1
<210>1
<211>25
<212>DNA
＜213〉artificial sequence
<400>1
TCGATGGTTCATTCAAGTTTCTGCC
Claims (3)
1. the detection probes of a Heterosigma akashiwo, it is characterized in that, be used for this algae is carried out analysis of S1 enzyme protection and sandwich hybridization detection, specifically comprise three oligonucleotide probes that are mutually related: S1 enzyme protection analysis probe, arrest probe, signal probe, described S1 enzyme protection analysis probe, be meant complementaryly and be used for the oligonucleotide probe of S1 enzyme protection analytical procedure with Heterosigma akashiwo rRNA, its sequence SEQ ID NO.1 is as follows: 5 '-GGCAGAAACTTGAATGAACCATCGACCGAAGTCGATTCGCACAGTTACTATGATTC ACC;
The described probe of arresting, be meant with an end of S1 enzyme protection analysis probe and combine, an other end is marked with vitamin H, thereby will through S1 enzyme enzyme cut handle and denaturing treatment after be retained in S1 enzyme protection analysis probe in the solution and catch the probe that gets off, its sequence SEQ ID NO.2 is as follows: 5 '-GGTGAATCATAGTAACTGTGCGAATCG;
Described signal probe can arrested after probe catches S1 enzyme protection analysis probe; be incorporated into the other end of S1 enzyme protection analysis probe; this probe mark has detectable signal simultaneously, and its sequence SEQ ID NO.3 is as follows: 5 '-TCGATGGTTCATTCAAGTTTCTGCC.
2. the detection probes of Heterosigma akashiwo according to claim 1 is characterized in that, described S1 enzyme protection analysis probe, and when carrying out the information biology compare of analysis, but specificity is incorporated on the rRNA of Heterosigma akashiwo under certain conditions.
3. the detection probes of Heterosigma akashiwo according to claim 1 is characterized in that, described signal probe, the signal of mark fluorescein, digoxin, vitamin H on this sequence.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2004100678073A CN1298865C (en) | 2004-11-04 | 2004-11-04 | Detection probe for Heterosigma akashiwo Hada |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2004100678073A CN1298865C (en) | 2004-11-04 | 2004-11-04 | Detection probe for Heterosigma akashiwo Hada |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1635154A CN1635154A (en) | 2005-07-06 |
| CN1298865C true CN1298865C (en) | 2007-02-07 |
Family
ID=34846695
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2004100678073A Expired - Fee Related CN1298865C (en) | 2004-11-04 | 2004-11-04 | Detection probe for Heterosigma akashiwo Hada |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1298865C (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5958689A (en) * | 1996-05-22 | 1999-09-28 | Monterey Bay Aquarium Research Institute | Detection of toxigenic marine diatoms of the genus Pseudo-nitzschia |
| CN1275717A (en) * | 2000-07-07 | 2000-12-06 | 中山大学 | Nucleic acid molecular probe for identifying blue-green alga and method |
| CN1403590A (en) * | 2002-09-29 | 2003-03-19 | 中山大学 | Nucleotide sequence, nucleic acid molecular probe and method for identifying red tide phaeocystis globosa |
| WO2004001067A2 (en) * | 2002-06-23 | 2003-12-31 | Stiftung Alfred-Wegener-Institut Für Polar- Und Meeresforschung | Detection of toxic algae |
| CN1536091A (en) * | 2003-04-09 | 2004-10-13 | 中国海洋大学 | Quick quantitative detection of genetic marker of skeletonema costatum japonicum and its method |
-
2004
- 2004-11-04 CN CNB2004100678073A patent/CN1298865C/en not_active Expired - Fee Related
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5958689A (en) * | 1996-05-22 | 1999-09-28 | Monterey Bay Aquarium Research Institute | Detection of toxigenic marine diatoms of the genus Pseudo-nitzschia |
| CN1275717A (en) * | 2000-07-07 | 2000-12-06 | 中山大学 | Nucleic acid molecular probe for identifying blue-green alga and method |
| WO2004001067A2 (en) * | 2002-06-23 | 2003-12-31 | Stiftung Alfred-Wegener-Institut Für Polar- Und Meeresforschung | Detection of toxic algae |
| CN1403590A (en) * | 2002-09-29 | 2003-03-19 | 中山大学 | Nucleotide sequence, nucleic acid molecular probe and method for identifying red tide phaeocystis globosa |
| CN1536091A (en) * | 2003-04-09 | 2004-10-13 | 中国海洋大学 | Quick quantitative detection of genetic marker of skeletonema costatum japonicum and its method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1635154A (en) | 2005-07-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Antonella et al. | The quantitative real-time PCR applications in the monitoring of marine harmful algal bloom (HAB) species | |
| Gleason et al. | High‐throughput molecular identification of fish eggs using multiplex suspension bead arrays | |
| Traub et al. | Molecular epidemiology: a multidisciplinary approach to understanding parasitic zoonoses | |
| Chen et al. | Development of a PNA probe for fluorescence in situ hybridization detection of Prorocentrum donghaiense | |
| CN103820558B (en) | Gene chip for detecting nine pathogenicity vibrios in marine products | |
| CN104561333B (en) | The method of the green damp waterside liverwort algae of a kind of Rapid identification | |
| Kavanagh et al. | Real-time PCR detection of Dinophysis species in Irish coastal waters | |
| Teimouri et al. | Molecular identification of agents of human cutaneous leishmaniasis and canine visceral leishmaniasis in different areas of Iran using internal transcribed spacer 1 PCR-RFLP | |
| CN104630336A (en) | Gene chip for microbiological exploration and application method of gene chip | |
| CN1693479A (en) | Kit with fluorescent quantitative RT-PCR detection technique used for cell keratin 19(Ck19)mRNA | |
| Zeleny et al. | Evaluation of PCR-based beef sexing methods | |
| CN1298865C (en) | Detection probe for Heterosigma akashiwo Hada | |
| CN1277935C (en) | Detection probe of phaeocystis | |
| CN1298864C (en) | Detection probe for ocean Prorocentrum | |
| CN1292079C (en) | Detecting probe for Pseudo-nitzchia pungens | |
| CN1288253C (en) | Detection probe for minisize Prorocentrum | |
| CN109097488A (en) | For synchronizing nucleic acid, method and the kit of five kinds of dog diarrhea virus of detection and identification | |
| CN1661091A (en) | Detection probe of Skeletonema costatum | |
| CN1632577A (en) | Detection probe for Scrippsiella trochoidea | |
| CN1699599A (en) | Probe and method for detecting heterosigma akashiwo | |
| CN103667450B (en) | DNA chip suitable for high-throughput detection of transgenic products | |
| KR101817107B1 (en) | Method For Identification Of Beringraja pulchra Using Real-Time PCR assay | |
| CN100352937C (en) | Method of qualitative and quantitative analysis for algae | |
| CN1661092A (en) | Detection probe for phycobiont | |
| CN1624476A (en) | Detecting probe of round hailian seaweed |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20070207 Termination date: 20091204 |