CN1536091A - Quick quantitative detection of genetic marker of skeletonema costatum japonicum and its method - Google Patents
Quick quantitative detection of genetic marker of skeletonema costatum japonicum and its method Download PDFInfo
- Publication number
- CN1536091A CN1536091A CNA031162630A CN03116263A CN1536091A CN 1536091 A CN1536091 A CN 1536091A CN A031162630 A CNA031162630 A CN A031162630A CN 03116263 A CN03116263 A CN 03116263A CN 1536091 A CN1536091 A CN 1536091A
- Authority
- CN
- China
- Prior art keywords
- primer
- skeletonemacostatum
- sequence
- seq
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a genetic marker and method for quickly quantitatively detecting skeletonema costatum. It provides skeletonema costatum ribosomal DNA (rDNA) and transcription unit internal spacer (ITS) nucleotide sequence, and oligonucleotide probe designed by using said sequence as basis. The invention utilizes the sequence comparison and experiment to show that these probes are genetic marker peculiary to the skeletonema costatum. The invention also provides the method for quickly quantitatively detecting skeletonema costatum.
Description
Technical field
The invention belongs to and utilize molecular biology method to detect the technical field of marine phytoplankton.It relate to can be used for detecting in Skeletonemacostatum nucleotide sequence and serve as the method for Skeletonemacostatum during the basis is detected with this sequence.
Background technology
Middle Skeletonemacostatum (Skeletonema costatum) is a kind of wide temperature eurysalinity plant plankton that worldwide extensively exists, and also is one of modal diatom sociales in China coastal waters.This kind is the secondary producer's in ocean good bait, and multiplication rate is very fast, and experiment shows that its frequency dividing cell reaches every day six times.But then, in Skeletonemacostatum be again common red tide plankton in China coastal waters and good pollution indicating organism, in the economical alga culture zone, normal fight for nutrition with sea-tangle, laver etc., a large amount of wawter blooms of this kind can cause the economic algae variable color, even rot and lose edible and commercial value; According to another report, be that the wawter blooms of sociales can cause the fish gill infringement of Atlantic Ocean Oncorhynchi and final dead with middle Skeletonemacostatum; The Jiaozhou Bay write down 40 surplus in kind of the red tide plankton, middle Skeletonemacostatum is one of main sociales.The once middle Skeletonemacostatum red tide monitoring that betides the entrance of Changjiang River June nineteen ninety is found, the cell concn difference of Skeletonemacostatum is obvious in the different steps, and before and after red tide, the diversity of algae has very big-difference in the sea area, the density of middle Skeletonemacostatum sharply rises, other amount of algae reduces rapidly, and it is very simple that population structure becomes, and thinks that the dynamic change of algae density and population structure has important value to the forecast of red tide.Therefore, Skeletonemacostatum in detecting in time, accurately and rapidly, understand its culture zone dynamically, when its quantity increases, in time control, this is significant to the sea farming industry.
On taxonomy, the middle rib Skeletonema is directly sieved algae section Skeletonema in Bacillariophyta centriate diatom guiding principle rotary strainer Cutleriales.Traditional morphological method is used in the detection of middle Skeletonemacostatum always, loaded down with trivial details, time-consuming, the effort of this method operation, and workload is very big for a long time when sample size.Therefore, Skeletonemacostatum has realistic meaning in the employing novel method new technology quick identification.
Therefore, this area presses for the method for Skeletonemacostatum in new energy fast qualitative of exploitation and the detection by quantitative.
Summary of the invention
Purpose of the present invention just provides the method for Skeletonemacostatum in a kind of fast qualitative and the detection by quantitative.
Another object of the present invention provides the genetic marker of Skeletonemacostatum in fast qualitative and the detection by quantitative.
In a first aspect of the present invention, the genetic marker of Skeletonemacostatum in a kind of the detection is provided, it has a successive 70-300 Nucleotide among the SEQ ID NO:11, preferably successive 100-300 Nucleotide, more preferably successive 150-250 Nucleotide
In another preference, described genetic marker has among the SEQ ID NO:11 successive 100-210 Nucleotide in the 1-210 position.
In second aspect present invention, a kind of middle Skeletonemacostatum Auele Specific Primer is provided, its length is 15-35 Nucleotide, and its sequence is identical or complementary with the sequence shown in the SEQ ID NO:11.
In another preference, the length of described primer is 20-30 Nucleotide.More preferably described primer is selected from SEQ ID NO:1-8.
In a third aspect of the present invention, the test kit of Skeletonemacostatum in a kind of the detection is provided, it is right that it contains the primer of Skeletonemacostatum genetic marker in the specific amplification, described primer length is a 15-35 Nucleotide, and the sequence of a primer is identical with the sequence shown in the SEQ ID NO:11, and the sequence complementation shown in the sequence of another primer and the SEQID NO:11, and the length of amplified production is 70-300bp.
In another preference, described test kit also contains probe, and the length of described probe is 20-50bp, and the sequence of this probe is identical or complementary with the sequence shown in the SEQ ID NO:11.
In another preference, a primer of described primer centering is selected from down group: SEQ ID NO:1,3,5,7; Another primer is selected from down group: SEQ ID NO:2,4,6,8; And described probe is the Taqman probe, and its sequence is SEQ ID NO:9 or 10.
In a fourth aspect of the present invention, the method for middle Skeletonemacostatum in a kind of test sample is provided, it comprises step:
(a) DNA of extracting sample;
(b) with extractive DNA as template, with the primer of Skeletonemacostatum genetic marker in the specific amplification to carrying out pcr amplification, wherein said primer length is a 15-35 Nucleotide, the sequence of a primer is identical with the sequence shown in the SEQID NO:11, and the sequence complementation shown in the sequence of another primer and the SEQ ID NO:11;
(c) detect amplified production and whether exist, exist amplified production just represent to exist in the sample in Skeletonemacostatum.
In another preference, described step (c) is to come middle Skeletonemacostatum in the detection by quantitative sample by the power that detects fluorescent signal.
Description of drawings
Fig. 1 has shown middle Skeletonemacostatum rDNA (rDNA) and transcriptional units transcribed spacer (ITS) putting in order on karyomit(e).Wherein two zones of ITS1 and 5.8S rDNA are the zone that nucleotide sequence involved in the present invention exists.Among the figure, SSU is a small subunit; LSU is big subunit; ITS is the transcriptional units transcribed spacer.
Fig. 2 has shown that involved in the present invention being used for detects the nucleotide sequence of Skeletonemacostatum, and middle Skeletonemacostatum specificity nucleotide probe and the definite position of TaqMan probe on this sequence that is used for real-time fluorescence quantitative PCR (RQ-PCR) reaction.Wherein underscore is S.costatum primer 1 and S.costatum primer 2; Italic is S.costatum primer 3 and S.costatum primer 4; Under to add round dot be S.costatum primer 5 and S.costatum primer 6; The shadow region is S.costatum primer 7 and S.costatum primer 8; Square frame shows S.costatum TaqMan probe.
Fig. 3 has shown PCR result.Wherein, the primer is S.costatum primer 1 and S.costatum primer 2. the algae kind of each electrophoresis road correspondence is: 1. membranous boat-shaped algae (Navicula membranacea); 3. Alexandrium tamarense (Alexandrium tamarens); 4. Thalassiosira nordenskioldi Cleve (Thalassiosira Nordenskioeldii); 5. Nitzschia closterium minutissima (Nitzschia closterium); 6. Pseudo-nitzchia pungens (Pseudonitzschia pungens); 7. Michaelis unarmored dinoflagellate (Gymnodinium mikimotoi); 8. the 10. very thin Chaetoceros of unarmored dinoflagellate (Gymnodinium sp.) (Chaetoceros gracile); 11. weak Chaetoceros (Chaetoceros debilis) 12. revolves chain Chaetoceros (Cheaetoceros curvisetus); 13. middle Skeletonemacostatum (Skeletonema costatum) 2, the 9.DNA molecular weight standard.
Fig. 4 has shown PCR result.Wherein, the primer is S.costatum primer 1 and S.costatum primer 2. the algae kind of each electrophoresis road correspondence is: 1. membranous boat-shaped algae; 3. Alexandrium tamarense; 4. Thalassiosira nordenskioldi Cleve; 5. Nitzschia closterium minutissima; 6. Pseudo-nitzchia pungens; 7. Michaelis unarmored dinoflagellate; 8. unarmored dinoflagellate; 10. very thin Chaetoceros; 11. weak Chaetoceros; 12. revolve the chain Chaetoceros; 13. middle Skeletonemacostatum; 2, the 9.DNA molecular weight standard.
Fig. 5 has shown the nucleic acid hybridization result.The algae kind of each point correspondence: 1,5,9. in Skeletonemacostatum, the point sample amount is successively decreased half successively; 2. revolve the chain Chaetoceros; 3. weak Chaetoceros; 4. very thin Chaetoceros; 6. unarmored dinoflagellate; 7. Pseudo-nitzchia pungens; 8. Nitzschia closterium minutissima; 10. Michaelis unarmored dinoflagellate; 11. Thalassiosira nordenskioldi Cleve; 12,15. Alexandrium tamarenses, the point sample amount is for doubling successively; 13. do not add any sample; 14. membranous boat-shaped algae; 16.TE damping fluid.
Fig. 6 has shown The sequencing results.
Fig. 7 has shown the change curve that the fluorescent signal of each dna solution in the PCR process increases along with cycle number.Abscissa is cycle number (Cycle Number) among the figure, ordinate is fluorescence signal intensity (Delta Rn), is critical line (Threshold) with the red double-headed arrow thick line of abscissa equality. the extent of dilution that each curve is corresponding is followed successively by from left to right: green line (1: 100), red line (1: 101), purple line (1: 102), blue line (1: 103), green line (1: 104), red line (1: 105).
Fig. 8 has shown the typical curve of middle Skeletonemacostatum RQ-PCR quantitative counting.
Fig. 9 has shown the PCR result in another embodiment of the present invention.The primer is that the algae kind of S.costatum primer 3 and S.costatum primer 4. each electrophoresis road correspondence is: 1. membranous boat-shaped algae; 3. Alexandrium tamarense; 4. Thalassiosira nordenskioldi Cleve; 5. Nitzschia closterium minutissima; 6. Pseudo-nitzchia pungens; 7. Michaelis unarmored dinoflagellate; 8. unarmored dinoflagellate; 10. very thin Chaetoceros; 11. weak Chaetoceros; 12. revolve the chain Chaetoceros; 13. middle Skeletonemacostatum; 2, the 9.DNA molecular weight standard.
Figure 10 has shown the PCR result in another embodiment of the present invention.The primer is that the algae kind of S.costatum primer 5 and S.costatum primer 6. each electrophoresis road correspondence is: 1. Skeletonemacostatum in; 2. revolve the chain Chaetoceros; 3. weak Chaetoceros; 4. very thin Chaetoceros; 5.DNA molecular weight standard; 6. unarmored dinoflagellate; 7. Michaelis unarmored dinoflagellate; 8. Alexandrium tamarense; 9. Pseudo-nitzchia pungens; 10. Nitzschia closterium minutissima; 11. membranous boat-shaped algae; 12. Thalassiosira nordenskioldi Cleve.
Fig. 11 has shown the PCR result in another embodiment of the present invention.The primer is that the algae kind of S.costatum primer 7 and S.costatum primer 8. each electrophoresis road correspondence is: 1. Skeletonemacostatum in; 2. revolve the chain Chaetoceros; 3. weak Chaetoceros; 4. very thin Chaetoceros; 5.DNA molecular weight standard 6. unarmored dinoflagellates; 7. Michaelis unarmored dinoflagellate; 8. Alexandrium tamarense; 9. Pseudo-nitzchia pungens; 10. Nitzschia closterium minutissima; 11. membranous boat-shaped algae; 12. Thalassiosira nordenskioldi Cleve.
Embodiment
The inventor is extensive studies through going deep into, and has found the distinctive genetic marker of middle Skeletonemacostatum first.On the basis of this genetic marker, developed Skeletonemacostatum genetic marker or its segmental primer and test kit in the specific amplification, thereby realized the rapid detection of centering Skeletonemacostatum first.
Sequence polymorphism that main theoretical basis of the present invention is ribosomal gene and transcribed spacer thereof and 5 ' end nuclease detection method.The present inventor has at first measured separation from the rDNA of the middle Skeletonemacostatum of Jiaozhou Bay and the sequence that transcriptional units transcribed spacer (ITS district) always is about 3000 base pairs, by with Internet (Genbank) in all disclosed rDNA and ITS region sequence find that relatively the middle Skeletonemacostatum rDNA shown in SEQ ID NO:11 and the sequence of ITS sequence and other biological respective regions have very big difference.The contriver is that basic design goes out multiple nucleic acid molecule primer and probe with this sequence for this reason.With these primers and probe, the contriver set up fast, accurately detected and quantitative counting in the molecular biology method of Skeletonemacostatum.
The genetic marker that is used for the Skeletonemacostatum detection provided by the present invention, its nucleotide sequence (SEQ ID NO:11) have contained the overwhelming majority zone of ITS1 as shown in Figure 1 and 5 ' the end small part zone of 5.8S rDNA.Its complete sequence and constitutional features such as SEQ ID NO:11 and shown in Figure 2.This sequence can obtain with PCR method (as embodiment 1); Perhaps form and order synthetic according to a conventional method obtaining on business-like automatic dna synthesizer by the Nucleotide of this sequence.
The primer of Skeletonemacostatum and detection probe in the specific amplification of the present invention, can design according to the sequence (SEQ ID NO:11) of genetic marker of the present invention, and be synthesized into (for example can be synthetic) with business-like automatic dna synthesizer by the DNA synthetic method of routine.
These primers of the present invention can carry out mark with radio isotope, vitamin H, enzyme, fluorescein or other chemiluminescent substances.
Skeletonemacostatum specificity nucleic acid molecule primer has specific specificity preferably in of the present invention.Carry out conventional PCR reaction with primer of the present invention, it is 70-300 specific PCR product that the result can only be from contain amplifies size in the DNA extraction thing of the material of Skeletonemacostatum.Therefore, carry out conventional PCR reaction with primer of the present invention, and by judge having or not of corresponding big or small PCR product can detect accurately and rapidly in Skeletonemacostatum, and required sample size is seldom.
In order to reduce false positive, also can to amplified production with in the Skeletonemacostatum specific probe hybridize.A kind of preferred probes is the Taqman probe, it can be in PCR reaction directly whether and the height of quantity the existence by fluorescent signal reflection amplified production in real time.
Probe of the present invention can carry out mark with radio isotope, vitamin H, enzyme, fluorescein or other chemiluminescent substances.5 ' end report fluorophor such as Fluoresceincarboxylic acid (Carboxyfluorescein with this sequence, mark such as FAM), 3 ' end reacts with promptly can be used for the RQ-PCR that the centering Skeletonemacostatum carries out qualitative and quantitative analysis behind cancellation fluorophor such as the marks such as TAMRA or Dabcyl.
Primer of the present invention is combined with the Taqman probe technique, just obtained while centering Skeletonemacostatum of the present invention and carried out qualitative detection and quantitative counting analytical procedure, be i.e. RQ-PCR reaction.This analytical procedure has not only overcome the error in the conventional quantifying PCR method, and it is few to analyze required sample size, and detection limit is low, and is highly sensitive.
Because the present invention not only provides the genetic marker that is used for the Skeletonemacostatum rapid detection, and the method for quick, easy, in enormous quantities this algae of detection by quantitative is provided, make the dynamic change of middle Skeletonemacostatum in certain sea area of monitoring or the plant's maritime interior waters become possibility.By the dynamic data that monitors, the culture zone owner can grasp middle rib flesh bar algae bait and throw in situation, sea pollution situation, and takes corresponding measure to reduce financial loss immediately; Simultaneously, these dynamic datas and other data (such as the quantity of nutritive salt, other species, climatological data etc.) are combined, can be that the mutual relationship between each factor provides some useful helps in the scientific research marine ecology.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, people such as Sambrook for example, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Embodiment 1
Be used for detecting the preparation of the genetic marker of Skeletonemacostatum
The used middle Skeletonemacostatum of the present invention separates from Jiaozhou Bay's natural sea-water sample.By obtaining pure growth at microscopically picking single algae cell repeatedly.Used substratum is conventional F/2 substratum, and culture condition is: illumination/dark cycle is 12h/12h, and intensity of illumination is 4000Lx, and culture temperature is 22 ℃～25 ℃.
The middle Skeletonemacostatum frustule that is in logarithmic phase with millipore filtration or the centrifugal collection of 10000r/min of 0.45 μ m, with 200 μ l TE damping fluid (10mmol/L Tris-HCl pH8.0,1mmol/L EDTA pH8.0) washes about 20mg frond, 55 ℃ extraction buffer (3% (w/v) CTAB of being preheated to that adds 2 times of volumes, 1% (w/v) sarcosyl, 20mmol/L EDTA, 1.4mol/L NaCl, 0.1mol/LTris-HCl pH8.0,1% (v/v) 2 mercapto ethanol), handled 1 hour, put upside down mixing once in per 10 minutes therebetween for 55 ℃; Take out in 4 ℃ of refrigerators and left standstill 3 minutes, add isopyknic chloroform: primary isoamyl alcohol (24: 1), put upside down mixing to being the milkiness shape, 10000r/min, 4 ℃ centrifugal 10 minutes, get phase; Add isopyknic chloroform in making progress mutually: primary isoamyl alcohol (24: 1), repeat the step once; Operation afterwards is with conventional DNA extraction.The DNA of Ti Quing dissolves with 50 μ l TE damping fluids at last.
The dna solution 1 μ l that gets extraction adds in the PCR reaction solution of 49 μ l and (comprises 50mM KCl in the reaction system of 50 μ l, 10mM Tris-HCl (pH8.3), 1.5mM MgCl
2, 0.2mM dNTPs, 0.5U polysaccharase, each 3 μ M of forward and reverse primer) and carry out first round PCR.Wherein the sequence of forward primer is 5 '-GCTCGNMWYWARGR TTAAGCCATGC-3 ' (SEQ ID NO:12), and the sequence of reverse primer is 5 '-CCTTGGTCCGTGTTTCAAGA-3 ' (SEQ ID NO:13).Behind the mixing, put into the PCR instrument of heat lid.The PCR program is: 94 ℃ of 3min; 94 ℃ of 30sec, 50 ℃ of 30sec, 72 ℃ of 1min, totally 30 circulations; 72 ℃ of 5min.Behind the PCR product of gained PCR product purification test kit purifying, get 1 μ l and add and carry out second in the aforesaid PCR reaction system and take turns PCR with Watson company.This takes turns the used primer of PCR: 5 '-CCTTTGTACACACCGCCC-3 ' (forward) (SEQ ID NO:14), 5 '-CACGGTACTTGTWYRCTATCGGT-3 ' (oppositely).The PCR program is: 94 ℃ of 3min; 94 ℃ of 30sec, 55 ℃ of 30sec, 72 ℃ of 1min, totally 30 circulations; 72 ℃ of 5min.The second PCR product of taking turns is behind electrophoresis on 1% the sepharose, rubber tapping is downcut the brightest band and is cloned into the pMD18-T carrier, in the XL1-Blue intestinal bacteria after the vegetative propagation, with M13/pUC (20 and M13/pUC (48) primer on the automatic sequencer of commercialization, checking order, from obtaining the nucleotide sequence shown in SEQ ID NO:11 the sequence of measuring.
Among the embodiment 2. the Skeletonemacostatum Auele Specific Primer to the design of probe and synthetic
By with Genbank in the sequence of all known other eukaryotes, procaryotic respective regions compare, discovery shown in SEQ ID NO:11 sequence and the corresponding sequence of other biological very big difference is arranged, the contriver is that each nucleic acid molecule primer of basic design table 1 is right with this sequence for this reason.Form and arrangement synthetic each primer on business-like dna synthesizer according to the right Nucleotide of these primers.Wherein primer 1,3, and 5 and 7 is upstream primer, primer 2, and 4,6 and 8 is downstream primer.
| Primer | Sequence (5 '-3 ') | ????SEQ?ID?NO： |
| ??1 | ????AAACCTTTACTTCCCCGAGAAGAG | ????1 |
| ??2 | ????GATGTCTTGGGTCACACAACGAT | ????2 |
| ??3 | ????CCAAACCTTTACTTCCCCGAG | ????3 |
| ??4 | ????CCGCCCATTACCGAACTG | ????4 |
| ??5 | ????ACTTCCCCGAGAAGAGGC | ????5 |
| ??6 | ????TGGAGATTCGTCTCTTCTAGCTG | ????6 |
| ??7 | ????CCTGCTGCCGATACACTGGTAG | ????7 |
| ??8 | ????ACTGCTTTTGGAGATTCGTCTC | ????8 |
Simultaneously, also following probe has been synthesized in design:
AAAACCAAACCAGGTGCCAAAGTAGG(SEQ?ID?NO：9)
CCTACTTTGGCACCTGGTTTGGTTTT(SEQ?ID?NO：10)。
Skeletonemacostatum during the conventional PCR method of embodiment 3. usefulness detects
Present embodiment has selected for use the common a few strain advantage plant planktons in Jiaozhou Bay as the reference algae, they are: revolve chain Chaetoceros, weak Chaetoceros, very thin Chaetoceros, unarmored dinoflagellate, Michaelis unarmored dinoflagellate, Alexandrium tamarense, Thalassiosira nordenskioldi Cleve, Pseudo-nitzchia pungens, Nitzschia closterium minutissima, membranous boat-shaped algae, they all separate the natural sea-water from the Jiaozhou Bay, by obtaining pure growth at microscopically picking single algae cell repeatedly.Cultivate these algaes and extract these algaes and the DNA of middle Skeletonemacostatum by embodiment 1 described method.
Get the DNA extraction thing 1 μ l of various algaes, carry out PCR by embodiment 1 described PCR reaction system, with primer 1 and 2 (SEQ ID NO:1 and 2) as forward and reverse primer.The PCR program is: 94 ℃ of 3min; 94 ℃ of 30sec, 52 ℃ of 30sec, 72 ℃ of 30sec, totally 30 circulations; 72 ℃ of 5min.The PCR product obtains result as shown in Figure 3 in taking pictures behind the electrophoresis on 1.5% the sepharose.As can be known from Fig. 3, the PCR product that therefrom to amplify a size in the Skeletonemacostatum dna profiling be 256bp; Substantially do not see specific amplification from the dna profiling of other algae.
Therefore, for certain sample to be checked, be template with its DNA extraction thing, with S.costatum primer 1 and primer 2 is primer, carry out the PCR reaction with the described PCR program of present embodiment, if there is size to be the existence of middle Skeletonemacostatum is promptly arranged the band of 256bp in this sample of decidable in the PCR product; If this sample is a pure growth, then this pure growth of decidable is middle Skeletonemacostatum.
The advantage of present method: since present method use be the specificity primer of middle Skeletonemacostatum and increase by PCR reaction pair testing sample, therefore Skeletonemacostatum during whether this method exists in the test sample very exactly, as long as there is the PCR product of corresponding size to occur, be to have middle Skeletonemacostatum to exist in the decidable sample to be checked, and according to what of PCR product amount, also according to a preliminary estimate in the sample in what of Skeletonemacostatum.Present method sensitivity simultaneously is very high, only needs material to be checked seldom accurately to detect.
Skeletonemacostatum specificity primer and probe carry out RQ-PCR detection and quantitative counting in embodiment 4. usefulness
1. selection is described with reference to algae as embodiment 3, presses the DNA of embodiment 1 described method extraction with reference to algae and middle Skeletonemacostatum.
2. make conventional PCR by the requirement of RQ-PCR reaction.The dna solution 1 μ l that promptly gets extraction adds in the PCR reaction solution of 49 μ l and (comprises 50mM KCl in the reaction system of 50 μ l, 10mM Tris-HCl (pH8.3), 2.5mMMgCl
2, 0.2mM dNTPs, 1.25U polysaccharase, each 3 μ M of forward and reverse primer), wherein forward primer is S.costatum primer 1 (SEQ ID NO:1), reverse primer is S.costatum primer 2 (SEQ ID NO:2).Behind the mixing, put into the PCR instrument of heat lid.The PCR program is: 94 ℃ of 5min; 94 ℃ of 15sec, 58 ℃ of 30sec, 72 ℃ of 30sec, totally 40 circulations; 72 ℃ of 5min.The PCR product obtains result as shown in Figure 4 in taking pictures behind the electrophoresis on 1.5% the sepharose.
From the result of Fig. 4 as can be known, the PCR product that therefrom to amplify a size in the Skeletonemacostatum dna profiling be 256bp; From the dna profiling that revolves the weak Chaetoceros of chain Chaetoceros, very thin Chaetoceros, also amplified the PCR product, but their size is all greater than 256bp; Substantially do not see specific amplification from the dna profiling of other algae.
3. nucleic acid hybridization: at first with the above-mentioned PCR products of various algaes with the PCR product purification test kit purifying of Watson company and concentrate one times, get 12 μ l routinely the Dot-Blot hybrid method put on uncharged nylon membrane after handling; With 5 ' end by γ-
32The S.costatum TaqMan probe of p mark is hybridized with it.Concrete operation is carried out according to the Dot-Blot nucleic acid hybridization of routine fully, and radioautograph 24～48h after hybridization is finished obtains result as shown in Figure 5 through development, photographic fixing.
Result from Fig. 5 as can be known, γ-
32The S.costatum TaqMan probe of p mark only has hybridization signal with the PCR product of middle Skeletonemacostatum.
4. sequencing and analysis:
Will be as shown in Figure 4 very thin Chaetoceros (Lane10), weak Chaetoceros (Lane11), revolve band rubber tapping in the PCR product of chain Chaetoceros (Lane12) and middle Skeletonemacostatum (Lane13) and reclaim rear clone and go into the pMD18-T carrier, in the XL1-Blue intestinal bacteria after the vegetative propagation, with M13/pUC (20 and M13/pUC (48) primer on the automatic sequencer of commercialization, checking order; The size of several bands is respectively: 2219bp, 332bp, 332bp, 332bp, 256bp; The sequence of measuring with the analysis of ClustalX freeware compares the zone that maximum comparability is arranged with S.costatum TaqMan probe sequence in each bar sequence then, obtains result as shown in Figure 6.
From Fig. 6 result as can be known, the sequence of S.costatum TaqMan probe and the respective regions of middle Skeletonemacostatum have 100% similarity, and have only 50% with the similarity of other four sequences.(annotate: Fig. 6 has only listed the zone with maximum comparability, the base that correspondence position is identical indicates with underscore) annealing temperature of these identical bases is 36 ℃, annealing temperature (60 ℃) well below probe, therefore in the process of RQ-PCR, S.costatum TaqMan probe can not form stable pairing with the sequence of these non-specific amplifications, and therefore the non-characteristic amplification that is produced by primer can not influence the result of RQ-PCR.
Synthetic nucleus acid hybridization and The sequencing results are in the same place Skeletonemacostatum Auele Specific Primer in of the present invention as can be known with probe combinations, be suitable for RQ-PCR centering Skeletonemacostatum fully and carry out specific rapid detection and quantitative counting.
The preparation of used TaqMan probe among the embodiment 5.RQ-PCR
To the SEQ ID NO:9 and the 10 described probes of preparation among the embodiment 2, with its 5 ' end of FAM fluorescent substance mark, with its 3 ' end of TAMRA mark.Whole synthetic and labeling process can be at the probe of commercialization can disposable finishing on the synthetic and marking appliance.
The RQ-PCR of Skeletonemacostatum detects and quantitative counting among the embodiment 6.
At first the logarithmic phase culture of centering Skeletonemacostatum and other contrast algae is counted, and prepares mixed algae liquid 10ml (cell concn of various algaes sees Table 2) then, and in 4 ℃ of centrifugal 10min of 10000r/min, the careful suction abandoned supernatant, and precipitation is dissolved with 1ml TE damping fluid; Therefrom get 200 μ l cell suspending liquids, add 400 μ l and be preheated to 55 ℃ extraction buffer (prescription is seen embodiment 1), handled 1 hour, put upside down mixing once in per 10 minutes therebetween for 55 ℃; Take out in 4 ℃ of refrigerators and left standstill 3 minutes, add 800 μ l chloroforms: primary isoamyl alcohol (24: 1), put upside down mixing to being the milkiness shape, 10000r/min, 4 ℃ are centrifugal 10 minutes; Get phase on the 550 μ l, to wherein adding 550 μ l chloroforms: primary isoamyl alcohol (24: 1), put upside down mixing to being the milkiness shape, 10000r/min, 4 ℃ are centrifugal 10 minutes; Operation is afterwards carried out according to the relevant operation of the leaf DNA extraction test kit of Watson company fully, and final step washes DNA (per 1 μ l dna solution correspondence 9.2 * 10 with 50 μ l T1 liquid from adsorption column
6Skeletonemacostatum cell in individual).
The cell concn of various algaes in the table 1. mixed algae liquid (unit: individual cell/ml)
Algae kind name cell concn algae kind name cell concn algae kind name cell concn
Middle Skeletonemacostatum 2.3 * 10
8Membranous boat-shaped algae 2.6 * 10
6Alexandrium tamarense 1.0 * 10
5
Revolve chain Chaetoceros 3.8 * 10
7Nitzschia closterium minutissima 1.3 * 10
6Michaelis unarmored dinoflagellate 1.1 * 10
6
Weak Chaetoceros 2.8 * 10
7Pseudo-nitzchia pungens 2.6 * 10
5Unarmored dinoflagellate 7.5 * 10
5
Very thin Chaetoceros 3.5 * 10
7Thalassiosira nordenskioldi Cleve 8.3 * 10
6
Get the dna solution that extracts by last method, by 1: 10 doubling dilution, (the middle Skeletonemacostatum cell concn of each extent of dilution correspondence was followed successively by 9.2 * 10 to totally 5 extent of dilution
5Individual/μ l, 9.2 * 10
4Individual/μ l, 9.2 * 10
3Individual/μ l, 9.2 * 10
2Individual/μ l, 9.2 * 10
1Individual/μ l).Get 1 μ l dna solution then respectively and add 49 μ l RQ-PCR reaction system (1 * Buffer; 2.5mmol/L MgCl
20.2mmol/L dNTP; 0.32 μ mol/LS.costatum primer 1; 0.32 μ mol/L S.costatum primer 2; 0.5U Taq enzyme; 0.32 μ mol/LS.costatum Taqman probe (SEQ ID NO:9 or 10)), in the ABI of commercialization 7700 type RQ-PCR instrument, press PCR program (50 ℃ of 95 ℃ of 10 minutes (95 ℃ 15 seconds 60 ℃ 1 minute) 50 circulations in 2 minutes) reaction, and the real time record fluorescent signal, obtain result as shown in Figure 7.
Fig. 7 has shown the change curve that the fluorescent signal of each dna solution in the PCR process increases along with cycle number.According to the principle of RQ-PCR, the pairing cycle number of intersection point of critical line (Threshold) and each dna solution fluorescent signal curve is the C of this dna solution
TValue.Can obtain the C of each extent of dilution dna solution from Fig. 7
TValue is followed successively by: 19.47,22.11,26.38,29.99,32.54,36.76.
Logarithmic value with the actual cell count that is used for RQ-PCR is an abscissa, with corresponding C
TValue is drawn out typical curve as shown in Figure 8 for ordinate.This curve's equation formula is: y=-3.4671x+43.352, its regression coefficient is: R
2=0.9956.
The detected result of the middle Skeletonemacostatum Auele Specific Primer that embodiment 7. is different
Repeat the method by embodiment 3, difference is with different primers replacing S.costatum primer 1 and 2.
With S.costatum primer 3 and 4 (SEQ ID NO:3 ﹠amp; 4) result of Huo Deing as shown in Figure 9.As we know from the figure, only in Skeletonemacostatum amplify size and be the dna fragmentation of 158bp; Though unarmored dinoflagellate and Michaelis unarmored dinoflagellate also have amplified production, their size is about 350bp, much bigger than middle Skeletonemacostatum.
With S.costatum primer 5 and 6 (SEQ ID NO:5 ﹠amp; 6) result of Huo Deing as shown in figure 10.As we know from the figure, only in Skeletonemacostatum amplify size and be the dna fragmentation of 198bp; The size of unarmored dinoflagellate and Michaelis unarmored dinoflagellate amplified production is about 550bp, and the size of very thin Chaetoceros amplified production is about 650bp, all much bigger than middle Skeletonemacostatum.
With S.costatum primer 7 and 8 (SEQ ID NO:7 ﹠amp; 8) result of Huo Deing as shown in figure 11.As we know from the figure, only middle Skeletonemacostatum amplifies the dna fragmentation of the about 163bp of size; Though three kinds of Chaetoceros, unarmored dinoflagellate, Michaelis unarmored dinoflagellates all have the amplified production that differs in size, these amplified productions or be significantly less than 163bp are perhaps obviously greater than 163bp.
From The above results as can be seen, various middle Skeletonemacostatum Auele Specific Primer of the present invention can both amplify genetic marker or its fragment of the middle Skeletonemacostatum shown in the SEQ ID NO:11 effectively.
The detection of embodiment 8. samples to be checked
For a certain seawater sample to be checked, collect the plant plankton cell with ordinary method earlier, with an amount of TE damping fluid dissolved cell precipitation, extract DNA then as stated above and be RQ-PCR, measure its C
TValue.With C
TValue can be calculated the cell count of the middle Skeletonemacostatum in this sample to be checked on the typical curve of Fig. 8, and then extrapolates the cell concn of middle Skeletonemacostatum in the seawater sample to be checked.
The advantage of present method: present method biggest advantage is can carry out simultaneously quantitatively and qualitative detection, has both known whether have middle Skeletonemacostatum to exist in the sample to be checked, also to know the amount of this algae kind in the sample to be checked by this method.
Another tangible advantage of present method is quantitatively accurately, this be by real time fluorescence quantifying PCR method itself and present method increase at the target fragment determined.For a certain species, the copy number of ribosomal gene on karyomit(e) is constant, can not change along with the difference of physiological status of cells, living environment, that is to say in the quantity of cells in sample and the sample that the quantity of ribosomal gene is linear dependence on the chromosomal DNA, because the target fragment of present method amplification is the ribosomal gene on the chromosomal DNA, so cells in sample quantity to be checked what the power of amplified signal directly reflected.
In addition present method operating process simple, save time, whole process can all be finished in 4 hours, can realize in the sea area in the dynamic tracking monitor of Skeletonemacostatum.
Skeletonemacostatum rapid detection and quantitative counting test kit among the embodiment 9.
In order to help the commercialization of present method, special being equipped with, make things convenient for the test kit that uses, and contains following reagent and material in the box:
1.S.costatum primer 1 solution (20 μ mol/L)
2.S.costatum primer 2 solution (20 μ mol/L)
3. the S.costatum TaqMan probe of fluorescent substance mark (20 μ mol/L)
4. working instructions (portion)
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table
＜110〉Chinese Marine University
Shanghai Wubaihao Biological Engineering Research ﹠ Development Co., Ltd.
＜120〉genetic marker of Skeletonemacostatum and method in the rapid detection
<130>031644
<160>15
<170>PatentIn?version?3.1
<210>1
<211>24
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉oligonucleotide
<400>1
aaacctttac?ttccccgaga?agag?????????????????????????????????24
<210>2
<211>23
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉oligonucleotide
<400>2
gatgtcttgg?gtcacacaac?gat??????????????????????????????????23
<210>3
<211>21
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉oligonucleotide
<400>3
ccaaaccttt?acttccccga?g????????????????????????????????????21
<210>4
<211>18
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉oligonucleotide
<400>4
ccgcccatta?ccgaactg????????????????????????????????????????18
<210>5
<211>18
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉oligonucleotide
<400>5
acttccccga?gaagaggc????????????????????????????????????????18
<210>6
<211>23
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉oligonucleotide
<400>6
tggagattcg?tctcttctag?ctg??????????????????????????????????23
<210>7
<211>22
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉oligonucleotide
<400>7
cctgctgccg?atacactggt?ag???????????????????????????????????22
<210>8
<211>22
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉oligonucleotide
<400>8
actgcttttg?gagattcgtc?tc???????????????????????????????????22
<210>9
<211>26
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉oligonucleotide
<400>9
aaaaccaaac?caggtgccaa?agtagg???????????????????????????????26
<210>10
<211>26
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉oligonucleotide
<400>10
cctactttgg?cacctggttt?ggtttt???????????????????????????????26
<210>11
<211>300
<212>DNA
＜213〉Skeletonemacostatum (Skeletonema costatum) in
<400>11
ctatccaaac?ctttacttcc?ccgagaagag?gcgcccgaag?cctgctgccg?atacactggt???60
agtgagcttc?gagtgccaaa?cttataaaaa?ccaaaccagg?tgccaaagta?ggccccagct??120
tcggctggtt?ggctagccgc?ggtgccgccc?attaccgaac?tgaaactgta?actgaatata??180
aactgctttt?ggagattcgt?ctcttctagc?tgtaaaatct?attacaactt?ttagcaatgg??240
atgtcttggg?tcacacaacg?atgaagaacg?cagcgaaatg?cgatacgtaa?tgcgaattgc??300
<210>12
<211>25
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
<222>(6)..(6)
<223>n＝a，t，c，g
<220>
<221>misc_feature
＜223〉oligonucleotide
<400>12
gctcgnmwyw?argrttaagc?catgc????????????????????????????????25
<210>13
<211>19
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉oligonucleotide
<400>13
ccttggtccg?tgtttcaag???????????????????????????????????????19
<210>14
<211>18
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉oligonucleotide
<400>14
cctttgtaca?caccgccc????????????????????????????????????????18
<210>15
<211>23
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉oligonucleotide
<400>15
cacggtactt?gtwyrctatc?ggt??????????????????????????????????23
Claims (10)
1. the genetic marker of Skeletonemacostatum in the detection is characterized in that it has a successive 70-300 Nucleotide among the SEQ ID NO:11.
2. genetic marker as claimed in claim 1 is characterized in that, it has among the SEQ ID NO:11 successive 100-210 Nucleotide in the 1-210 position.
3. a primer is characterized in that, its length is 15-35 Nucleotide, and its sequence is identical or complementary with the sequence shown in the SEQ ID NO:11.
4. primer as claimed in claim 3 is characterized in that, its length is 20-30 Nucleotide.
5. primer as claimed in claim 3 is characterized in that, primer is selected from SEQ ID NO:1-8.
6. the test kit of Skeletonemacostatum in the detection, it is characterized in that, it is right that it contains the primer of Skeletonemacostatum genetic marker in the specific amplification, described primer length is a 15-35 Nucleotide, and the sequence of a primer is identical with the sequence shown in the SEQ ID NO:11, and the sequence complementation shown in the sequence of another primer and the SEQ ID NO:11, and the length of amplified production is 70-300bp.
7. test kit as claimed in claim 6 is characterized in that, also contains probe, and the length of described probe is 20-50bp, and the sequence of this probe is identical or complementary with the sequence shown in the SEQ ID NO:11.
8. test kit as claimed in claim 6 is characterized in that, a primer of described primer centering is selected from down group: SEQ ID NO:1,3,5,7; Another primer is selected from down group: SEQ ID NO:2,4,6,8; And described probe is the Taqman probe, and its sequence is SEQ ID NO:9 or 10.
9. the method for Skeletonemacostatum in the test sample is characterized in that it comprises step:
(a) DNA of extracting sample;
(b) with extractive DNA as template, with the primer of Skeletonemacostatum genetic marker in the specific amplification to carrying out pcr amplification, wherein said primer length is a 15-35 Nucleotide, the sequence of a primer is identical with the sequence shown in the SEQ IDNO:11, and the sequence complementation shown in the sequence of another primer and the SEQ ID NO:11;
(c) detect amplified production and whether exist, exist amplified production just represent to exist in the sample in Skeletonemacostatum.
10. method as claimed in claim 9 is characterized in that, described step (c) is to come middle Skeletonemacostatum in the detection by quantitative sample by the power that detects fluorescent signal.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA031162630A CN1536091A (en) | 2003-04-09 | 2003-04-09 | Quick quantitative detection of genetic marker of skeletonema costatum japonicum and its method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA031162630A CN1536091A (en) | 2003-04-09 | 2003-04-09 | Quick quantitative detection of genetic marker of skeletonema costatum japonicum and its method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1536091A true CN1536091A (en) | 2004-10-13 |
Family
ID=34320295
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA031162630A Pending CN1536091A (en) | 2003-04-09 | 2003-04-09 | Quick quantitative detection of genetic marker of skeletonema costatum japonicum and its method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1536091A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1298865C (en) * | 2004-11-04 | 2007-02-07 | 上海交通大学 | Detection probe for Heterosigma akashiwo Hada |
| CN1298864C (en) * | 2004-11-04 | 2007-02-07 | 上海交通大学 | Detection probe for ocean Prorocentrum |
| CN101130820B (en) * | 2007-09-07 | 2011-05-04 | 中国海洋大学 | Skeletonema costatum PCNA gene detecting method |
| CN105441579A (en) * | 2016-01-25 | 2016-03-30 | 国家海洋局第三海洋研究所 | Primer and probe for identifying temperature-sensitive type of coral symbiotic photosynthetic algae and identifying method |
| CN105506145A (en) * | 2016-01-25 | 2016-04-20 | 厦门大学 | Primers, probe and identification method for identifying rapid division types of coral symbiotic photosynthetic algae |
-
2003
- 2003-04-09 CN CNA031162630A patent/CN1536091A/en active Pending
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1298865C (en) * | 2004-11-04 | 2007-02-07 | 上海交通大学 | Detection probe for Heterosigma akashiwo Hada |
| CN1298864C (en) * | 2004-11-04 | 2007-02-07 | 上海交通大学 | Detection probe for ocean Prorocentrum |
| CN101130820B (en) * | 2007-09-07 | 2011-05-04 | 中国海洋大学 | Skeletonema costatum PCNA gene detecting method |
| CN105441579A (en) * | 2016-01-25 | 2016-03-30 | 国家海洋局第三海洋研究所 | Primer and probe for identifying temperature-sensitive type of coral symbiotic photosynthetic algae and identifying method |
| CN105506145A (en) * | 2016-01-25 | 2016-04-20 | 厦门大学 | Primers, probe and identification method for identifying rapid division types of coral symbiotic photosynthetic algae |
| CN105506145B (en) * | 2016-01-25 | 2019-04-23 | 厦门大学 | A kind of primer, probe and identification method for identifying the quick Schizoid of the photosynthetic algae of coral symbiosis |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1286989C (en) | Biochip for detecting pathogenesis fungus | |
| CN1932041A (en) | The primers specific to cervus elaphus, c. nippon, c. canadensis and rangifer tarandus gene and the method to identify cervi parvum cornu species | |
| CN1274846C (en) | Assay systems, kits and methods for detecting microorganisms | |
| CN101041864A (en) | Chlamydi trachomatis and Neisseria gonorrhoeae dual real-time fluorescence PCR detection method | |
| CN101045943A (en) | Process of PCR detecting salmonella with added amplifying internal standard | |
| CN1536091A (en) | Quick quantitative detection of genetic marker of skeletonema costatum japonicum and its method | |
| Makkonen et al. | Genetic variation in the ribosomal internal transcribed spacers of Aphanomyces astaci Schikora from Finland | |
| CN1824801A (en) | Real-time fluorescent PCR testing primer, probe and immobilized kit for citrus ulcer bacteria and testing process thereof | |
| CN1879892A (en) | Method for establishing extranodal nasal type NK/T-celllymphoma animal model | |
| CN1441845A (en) | Method of detecting and quantifying human P450 molecular species and probe and kit for this method | |
| CN1724686A (en) | Target sequence used for detecting mycoplasma pnoumoniae and reagent box | |
| CN1745177A (en) | Method for the detection of pathogenic gram positive bacteria selected from the genera staphylococcus, enterococcus and streptococcus | |
| CN1215177C (en) | Gene chip used for identifying pathogenic bacteria in blood and its making method | |
| CN1350592A (en) | Nucleic acid probe-based diagnostic assays for prokaryotic and eukaryotic organisms | |
| CN100351395C (en) | Norwalk virus expression detecting kit and its special primer and probe | |
| CN1274848C (en) | Nucleic acid primers of acid alicyclic acid bacterium and method of identifying acid alicyclic acid bacterium | |
| CN1824802A (en) | Real-time fluorescent PCR testing primer, probe and immobilized kit for citrus candidatus liberobacter asiaticum Jagoueix and testing process thereof | |
| CN1699599A (en) | Probe and method for detecting heterosigma akashiwo | |
| CN1749417A (en) | Real time quantitative PCR detecting reagent kit and method for epidermal growth factor receptor exon 19 deletion mutation | |
| CN1772922A (en) | Method of identifying invasion of south American glim ant and its nucleic acid sequence, probe and reagent kit | |
| CN1772923A (en) | Chaetuceros sp. detecting probe and method | |
| CN1721554A (en) | Method of testing anticancer agent-sensitivity of tumor cells | |
| CN101045942A (en) | Transgenic papaya and detection of transgenic component in transgenic papaya product | |
| CN1810988A (en) | Method and kit for detecting ox and sheep components in feed | |
| CN1300340C (en) | Kit for testing transgene cottonseed and products produced, and testing method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |