CN100351395C - Norwalk virus expression detecting kit and its special primer and probe - Google Patents
Norwalk virus expression detecting kit and its special primer and probe Download PDFInfo
- Publication number
- CN100351395C CN100351395C CNB200510127520XA CN200510127520A CN100351395C CN 100351395 C CN100351395 C CN 100351395C CN B200510127520X A CNB200510127520X A CN B200510127520XA CN 200510127520 A CN200510127520 A CN 200510127520A CN 100351395 C CN100351395 C CN 100351395C
- Authority
- CN
- China
- Prior art keywords
- type
- water
- quality control
- norwalk virus
- rna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The present invention relates to a kit for detecting Norwalk virus expression quantity, a special primer thereof and probes, which belongs to the technical field of detecting viral nucleic acid. The kit comprises sample pretreatment liquid A, sample pretreatment liquid B, sample pretreatment liquid C, sample pretreatment liquid D, RNA extraction reagents, water without ribonuclease, a random primer, reverse transcription buffer liquid, dNTP mixture, 0.1M DTT, reverse transcriptase storage liquid, GGI type PCR reaction liquid, GGII type reaction liquid, GGI type probes, GGII type probes, GGI type UNG enzymes, GGII type UNG enzymes, GGI type standard substances, GGII type standard substances, GGI type quality control substances and GGII type quality control substances. The kit provided by the present invention can be used for Norwalk virus RNA expression detection in oyster shells or human excrement and provide convenient and rapid detection tools for Norwalk virus research, Norwalk virus prevention and control and large-scale explosion caused by the guiding of fresh marine products.
Description
Technical field
The present invention relates to a kind of Norwalk virus expression detecting kit and primer special thereof and probe, especially refer to the amount of norwalk virus (Norovirus) in a kind of detection by quantitative sample and distinguish its genotypic detection kit and primer special and probe, belong to the detection technique field of viral nucleic acid.
Background technology
Norovirus (once being called norwalk group viruses, Norwalk-like virus) separated from acute gastroenteritis patient's stool sample of Ohio, USA C city outburst, and was the RNA viruses of a kind of diameter 27 μ m in 1972 first.Nearest Norovirus (NoV) is considered to food origin disease and breaks out most important cause of disease, its by the human-to-human transmission mode propagate mostly be two, three generations patient, and mostly the incident of just sending out is the eruption and prevalence that causes by contaminated food products and water, especially fresh sea-food to have become serious day by day public health problem.There is 2,300 ten thousand routine gastro-enteritis every year in the U.S., and wherein 50,000 examples need hospital care, 300 example death, are caused by NoV; The disease prevention and control center of the U.S. (CDC) just receives the gastro-enteritis outburst report that 104 NoV from Washington, 3 states in New Hampshire and New York cause only between in November, 2002~December.The data presentation of 10 Monitoring systemss in Europe, NoV should be responsible for the viral food origin disease above 85% in the period of nineteen ninety-five~2000.According to Japanese IASR (Infectious AgentsSurveillance Report) monitoring net, one month October in 2003 only, the gastro-enteritis outburst that 4 NoV cause just takes place in, rock hand gloomy green grass or young crops and three counties of Shiga Prefecture in succession; The main pathogen of Japan's children's diarrhae in winter also is NoV simultaneously.After the outburst that CDC in 2002 report NoV causes by food is risen rapidly, in the food, the research of NoV just becomes the problem that people extremely pay close attention in the especially fresh sea-food.China because few to understanding deficiency, the correlative study of NoV itself, detection means is backward, the high influence factor such as maybe can not make a definite diagnosis of misdiagnosis rate, does not see as yet that so far NoV causes the report that food origin disease breaks out.
Both at home and abroad the research of NoV in food, the especially fresh sea-food is hesitated to move forward because of examined technology limitation at present.Because the NoV prototype-strain can not cultivate with cell strain, can not set up animal model, traditional detection method is the stool sample with the electron microscopic examination patient, because of its resolving power low (near 10
6~10
7Just can be detected during individual virus/gram concentration), and can not be used for detecting the virus of food or this low concentration of water gauge, in addition Electronic Speculum investigation cost height, sample is difficult obtains, be only limited to and carry out the investigation of sample on a small scale; Immunoelectronmicroscopy can make susceptibility improve 10~100 times, but and in close relations between operator's experience and technical ability, thereby false negative rate is higher.Enzyme-linked immunosorbent assay (ELISA) but detectable level 10
4~10
6The clinical samples of/ml (two minutes serum), but since NoV not between homophyletic shell clothing proteantigen have sizable variability, reduced the specificity and the susceptibility of this method, and material source is limited, limited the use of this method.
The appearance of fluorescence quantitative RT-RCR technology, the accurate method of a detection by quantitative viral RNA is provided for us, so-called real-time fluorescence quantitative PCR technology, be meant in the PCR reaction system to add a specificity fluorescent probe in a pair of primer of adding, utilize the fluorescent signal accumulation whole PCR process of monitoring in real time.Taqman fluorescent probe commonly used at present is an oligonucleotide, and two ends are mark report fluorophor and a cancellation fluorophor respectively.When probe was complete, the reporter group fluorescent signal emitted was absorbed by quenching group, so detect less than fluorescence; In the pcr amplification process, 5 '-3 ' 5 prime excision enzyme activity of Taq enzyme is cut degraded with the probe enzyme, the report fluorophor is separated with the cancellation fluorophor, thereby the fluorescence monitoring system can receive fluorescent signal.In the pcr amplification process, detect first order fluorescence intensity after each loop ends, entire reaction just can obtain a working curve after finishing, and can carry out quantitative analysis to unknown template according to this curve.
In the present invention, we have adopted present state-of-the-art real-time fluorescence quantitative PCR detection technique, reduce false-positive interference under the prerequisite that keeps hypersensitivity as far as possible.Overcome many difficult problems of conventional PCR detection technique,, bromination second pyridine toxicity time-consuming, be prone to difficult problems such as false positive, specificity be low as the product electrophoresis.Test kit of the present invention can (Norovirus, content NoV) carries out detection by quantitative, and can distinguish its genotype (GG I type, GG II type) to norwalk virus in oyster, the human faecal mass.Test kit of the present invention quantitatively reaches somatotype to norwalk virus and detects and will help this viral epidemiological study, and can be the genotype of analyzing NoV in the seafood prods and the genotypic relation of the popular NoV of crowd, Chinese NoV genotype and the NoV features of pollution of genotypic comparative analysis of international NoV and sea-food, popular variation trend and rule research thereof the testing tool efficiently of providing convenience; Research, prevention and the control NoV that also can be China NoV is through the large-scale outburst of fresh sea-food mediation the causing testing tool efficiently of providing convenience.
Summary of the invention
First purpose of the present invention provides primer special and the probe that detects norwalk virus.
Second purpose of the present invention provides a kind of sensitivity, Norwalk virus expression detecting kit quick, easy and simple to handle.
For achieving the above object, the present invention is by the following technical solutions:
Detect the primer and the probe of norwalk virus, have following nucleotide sequence:
1.CCATGTTCCGYTGGATGCGNTTYC;
2.TGGGGCGTCCTTAGACGCCATCAT;
3.TGCCCAGACAAGAGTCAATGTTTA;
4.AGCAGCGTCATTCGACGCCATCT;
5.GACAGGAGATYGCGATCTCCTGYCC;
6.CTAAGCACATGGGAGGGCGATCGCAA;
Wherein N is A, C, G, or T; Y is T/U or C.
Test kit of the present invention comprises: sample pre-treatments liquid A, sample pre-treatments liquid B, sample pre-treatments liquid C, sample pre-treatments liquid D, RNA extracts reagent, the water of no RNA enzyme, reverse transcriptase primer, the reverse transcription damping fluid, the dNTP mixture, 0.1M DTT, reversed transcriptive enzyme is preserved liquid, GG I type PCR reaction solution, GG II type PCR reaction solution, GG I type probe, GG II type probe, GG I type UNG enzyme is preserved liquid, GG II type UNG enzyme is preserved liquid, GGI type standard substance, GG II type standard substance, GG I type quality control product, GG II type quality control product.
(1) sample pre-treatments liquid A is the glycine buffer (9.5,25 ℃ of pH) of 0.05M: contain glycine, the 0.15mol NaCI of 0.05mol among the 1000ml, solvent is a water;
(2) sample pre-treatments liquid B is 16% polyethylene glycol 6000 (PEG6000) solution: contain PEG6000, the NaCI of 0.3mol of 160 grams among the 1000ml, solvent is a water;
(3) sample pre-treatments liquid C is the Na of 0.15M
2HPO
4Solution (9.0,25 ℃ of pH): the Na that contains 0.15mol among the 1000ml
2HPO
4, solvent is a water;
(4) sample pre-treatments liquid D is the PBS damping fluid: the KH that contains 1.47mmol among the 1000ml
2PO
4, 136.9mmol KCl, the Na of 7.96mmol of NaCl, 2.68mmol
2HPO
412H
2O, solvent are water;
(5) RNA extracts reagent: be Trizol reagent;
(6) water of no RNA enzyme: the preparation method adds DEPC (diethylpyrocarbonate) to deionized water, to final concentration be 0.05% (V/V), placed 2 hours for 37 ℃, 121 ℃, the 20min high pressure, standby;
(7) reverse transcriptase primer: be random primer six primers, be dissolved into the use liquid of 100 μ mol/L with deionized water;
(8) reverse transcription damping fluid: the Tris-HCl (8.3,25 ℃ of pH), the KCl of 375mmol, the MgCl of 15mmol that contain 250mmol among the 1000ml
2, solvent is a water;
(9) dNTP mixture: contain dATP, dCTP, each 10mmol of dGTP, dTTP among the 1000ml, solvent is water (pH7.0-7.5,25 ℃);
(10) reversed transcriptive enzyme is preserved liquid: the glycerine, the Nonidet p-40,2.0 * 10 of 0.1ml of DTT, 500ml of EDTA, 1.0mmol of NaCl, 0.1mmol that contains Tris-HCl (7.5,25 ℃ of pH), the 100mmol of 20mmol among the 1000ml
8The reversed transcriptive enzyme of U (M-MLV), water;
(11) GG I type PCR reaction solution: contain the Tris-HCI (pH8.3,25 ℃) of 20mmol, the MgCI of 3.0mmol among the 1000ml
2, 100mmol KCI, 0.4 μ mol the upstream and downstream primer (/L), 1.0 * 10
5The dUTP of dGTP, the 800nmol of dCTP, the 400nmol of the Taq enzyme of U, dATP, the 400nmol of 400nmol,, solvent is a water;
The upstream and downstream primer sequence is respectively:
P1:5’-CCATGTTCCGYTGGATGCGNTTYC-3’
P2:5’-TGGGGCGTCCTTAGACGCCATCAT-3’
(12) GG II type PCR reaction solution: contain the Tris-HCI (pH8.3,25 ℃) of 20mmol, the MgCI of 3.0mmol among the 1000ml
2, 100mmol KCI, 0.4 μ mol the upstream and downstream primer (/L), 1.0 * 10
5The dGTP of dCTP, the 400nmol of the Taq enzyme of U, dATP, the 400nmol of 400nmol, the dUTP of 800nmol, solvent are water;
The upstream and downstream primer sequence is respectively:
P1:5’-TGCCCAGACAAGAGTCAATGTTTA-3’
P2:5’-AGCAGCGTCATTCGACGCCATCT-3’
(13) GG I type probe is a fluorescence labeling probe, and its sequence is:
5’-FAM-GACAGGAGATYGCGATCTCCTGYCC-TAMRA-3’;
(14) GG II type probe is a fluorescence labeling probe, and its sequence is:
5’-FAM-CTAAGCACATGGGAGGGCGATCGCAA-TAMRA-3’;
(15) GG I type UNG enzyme: the Tween 20,1.0 * 10 of DTT, 0.5ml of EDTA, 1.0mmol that contains NaCl, the 1.0mmol of the glycerine of 50ml, the Tris-HCl of 30mmol (7.5,25 ℃ of pH), 150mmol among the 1000ml
6The UNG enzyme of U, solvent are water;
(16) GG II type UNG enzyme: the Tween 20,1.0 * 10 of DTT, 0.5ml of EDTA, 1.0mmol that contains NaCl, the 1.0mmol of the glycerine of 50ml, the Tris-HCl of 30mmol (7.5,25 ℃ of pH), 150mmol among the 1000ml
6The UNG enzyme of U, solvent are water;
(17) sequence of GG I type standard substance is:
1 CCATGTTCCG CTGGATGCGT TTCCATGATC TGAGTTTGTG GACAGGAGAT CGCGATCTCC
61TGCCCGATTA TGTAAATGAT GATGGCGTCT AAGGACGCCC CA
(18) sequence of GG II type standard substance is:
1 TGCCCAGACA AGAGTCAATG TTTAGGTGGA TGAGGTTCTC AGATCTAAGC ACATGGGAGG
61GCGATCGCAA TCTGGCTCCC AGTTTTGTGA ATGAAGATGG CGTCGAATGA CGCTGCT
(19) GG I type quality control product is divided into positive quality control product and negative quality control product, and positive quality control product is the sample that contains GG I type RNA, and negative quality control product is not for containing the sample of GG I type RNA.
(20) GG II type quality control product is divided into positive quality control product and negative quality control product, and positive quality control product is the sample that contains GG II type RNA, and negative quality control product is not for containing the sample of GG II type RNA.
The specification of test kit of the present invention is 20 a parts/box; Sample pre-treatments reagent and RNA extract reagent and are stored in 4 ℃; RT-PCR reagent is stored in-20 ℃, reduces multigelation as far as possible.
The preparation process of test kit of the present invention (concrete preparation process is seen embodiment 1)
1. design primer, probe are also synthetic; The preparation standard product.
2. the water for preparing no RNA enzyme by the preparation method in the summary of the invention.
3. prepare positive reference substance and negative control product.
4. press the concentration requirement preparation sample pre-treatments liquid A in the summary of the invention, sample pre-treatments liquid B, sample pre-treatments liquid C, sample pre-treatments liquid D, reverse transcriptase primer, the reverse transcription damping fluid, the dNTP mixture, 0.1M DTT, reversed transcriptive enzyme is preserved liquid, GG I type PCR reaction solution, GG II type PCR reaction solution, GG I type probe, GG II type probe, GG I type UNG enzyme is preserved liquid, GG II type UNG enzyme is preserved liquid, GG I type standard substance, GG II type standard substance, GG I type quality control product, GG II type quality control product.
5. by the specification of test kit of the present invention above-mentioned each component is carried out packing.
The using method of test kit of the present invention:
[providing reagent and material for oneself]
The rifle head of aseptic 50ml centrifuge tube, aseptic Erlenmeyer flask (100ml), the 1.5ml centrifuge tube of no RNA enzyme, the 0.5ml centrifuge tube of no RNA enzyme, no RNA enzyme (range is 1ml, 200 μ l, 10 μ l, 2 μ l); Chloroform, Virahol, dehydrated alcohol.
[instrument]
ABI PRISM5700, ABI PRISM 7000, iCycle or other similar fluorescent quantitation detector.
[sample requirement]
The oyster or the human faecal mass of fresh or-20 ℃ of preservations, and follow these steps to carry out the pre-treatment of sample:
(1) pre-treatment of oyster (preparation of concentrated solution)
Annotate: the digestive gland of 3 oysters is 1 sample, can examine 3~10 samples for 1 batch, notes avoiding the crossed contamination of sample room.
(1) with the shellfish post of cut-out oysters such as bamboo let, scalpel, opens shell.
(2) remove adventitia, digestive gland (dark matter) fatty tissue (white mass) on every side as far as possible with removals such as scalpel, pincets, is taken out digestive gland.
(3) digestive gland is put in the homogenizer homogenate fast after, homogenate is put into the Erlenmeyer flask of sterilization, add the sample pre-treatments liquid A of 7 times of volumes, fully be sub-packed in the 50ml centrifuge tube after the vibration under the room temperature, 4 ℃, 3000g, 30min is centrifugal.
(4) supernatant liquor is transferred in the new aseptic 50ml centrifuge tube, transfers pH value to 7.5, add isopyknic sample pre-treatments liquid B, slight mixing, 4 ℃ of precipitations are after 4 hours, and 4 ℃, 3000g, 30min is centrifugal.
(5) abandon supernatant, precipitation is resuspended with 1.5ml sample pre-treatments liquid C, and 100rpm vibration after 20 minutes under the room temperature is sub-packed in the centrifuge tube of no RNA enzyme of 1.5ml, and 4 ℃, 10000g, 30min is centrifugal.
(6) supernatant is moved in the centrifuge tube of no RNA enzyme of new 1.5ml, and regulate pH value 7.4, place-20 ℃ of preservations, standby.
(2) pre-treatment of faecal samples (preparation of concentrated solution)
Annotate: should note the infectivity of ight soil during operation, note avoiding the crossed contamination of sample room again.
Ight soil is made the suspension of 10% (g/ml) with sample pre-treatments liquid D.
Behind the thermal agitation, 4 ℃, 12000rpm, 20min is centrifugal.
Get supernatant in the centrifuge tube of the no RNA enzyme of 1.5ml, place-20 ℃ of preservations, standby.
[operation steps]
(1), RNA extracts
1. get oyster sample concentration liquid or faecal samples concentrated solution 300 μ l, add 1ml RNA and extract reagent, behind the mixing that turns upside down, add 200 μ l chloroforms, acutely shake 15sec, place 3min in the ice chest.
4.4 ℃, the centrifugal 15min of 12000g can shake again and makes it mixing if occur layering before centrifugal in the pipe.
5. taking-up centrifuge tube sucts clearly in the 1.5ml of another no RNA enzyme centrifuge tube, notes not sucking intermediary DNA layer.The Virahol that adds 700 μ l is placed 10min in the ice chest, 12000g afterwards, 4 ℃ of centrifugal 10min.
6. abandon the liquid in the centrifuge tube, add 75% ethanol 1ml, turn upside down 3-5 time, room temperature was placed 2 minutes, 7500g, 4 ℃, centrifugal 5min; Repeated washing once.
7. liquid in the pipe abandon is inverted 10min under the room temperature, adds the DEPC treated water of 20-50 μ l, dissolving RNA.Ice chest is placed standby or-70 ℃ of preservations.
(2), RT reaction
1. with each component mixing in the RT test kit, of short duration centrifugal.
2. prepare the RNA/ primer mixture in 0.5ml PCR pipe, form is as follows:
Table 1
Composition | Sample |
Total RNA dNTP mixture | 2μg 1μl |
Reverse transcriptase primer does not have the water of RNA enzyme | 1μl To 13μl |
3.65 ℃ hatch 5min, ice chest is placed 1min at least.
4. the centrifuge tube that DTT, M-MLV and reverse transcription damping fluid will be housed takes out from-20 ℃, place treat on the ice chest that it slowly melts after, of short duration centrifugal, DTT and reverse transcription damping fluid all added in the M-MLV pipe be mixed with mixed solution, mixing, of short duration centrifugal, place on the ice chest standby
5. add the above-mentioned mixed solution of 7 μ l, mixing, of short duration centrifugal collection to the every pipe of RNA/ primer mixture.
6.25 ℃, hatch 5min; 37 ℃ afterwards, hatch 50min.
7.70 ℃, 15min termination reaction, cooled on ice or-20 ℃ of preservations.
(3), pcr amplification
Annotate: the RT product of a sample of a. will be used GG I simultaneously, and GG II type primer detects, and need prepare the typical curve of amphitypy simultaneously; So that positive is carried out somatotype and detection by quantitative.
B. each detection all should be set up the positive and negative control.
1. the centrifuge tube that PCR damping fluid, UNG enzyme and probe will be housed takes out from-20 ℃, place treat on the ice chest that it slowly melts after, of short duration centrifugal, probe and PCR damping fluid all added in the UNG enzyme pipe be mixed with the PCR reaction solution, mixing, of short duration centrifugal, place on the ice chest standbyly, use back residue PCR reaction mixture can put into-20 ℃ of refrigerators and preserve.
Prepare the PCR system by following composition:
Table 2
Reverse transcription product PCR reaction mixture deionized water | 3.0μl 15.0μl 7.0μl |
The PCR reaction conditions: 37 ℃ 10 minutes; 95 ℃ 15 minutes; (95 ℃ 15 seconds, 56 ℃ 1 minute, 40 circulations).
2. the making of typical curve
With standard substance stock solution (2 * 10
6Copies/ul) gradient dilution is 2 * 10
5, 2 * 10
4, 2 * 10
3, 2 * 10
2, 2 * 10
1It is that template is together carried out pcr amplification, production standard curve with testing sample that copies/ul, the standard substance diluent of 5 concentration respectively get 5ul.
(4), interpretation of result
1. use the accompanying software of real-time fluorescence quantitative PCR instrument to carry out the preservation of file and the setting of threshold value.
2. choose the hole and the labeled standards value of different concns standard substance correspondence, analyze, draw typical curve and relevant information.
3. choose all samples to detect the hole, use corresponding the analysis, draw the starting template number of testing sample, and then calculate the copy number in the sample.
The present invention has set up the method for utilizing Norovirus expression amount in real-time fluorescence quantitative RT-PCR technology for detection oyster or the human faecal mass sample and gene type thereof, and the detected result of sample shows that test kit of the present invention is easy and simple to handle, superior performance.
1. the sample-pretreating method of test kit of the present invention has the following advantages: (1). and easy and simple to handle; (2). safe in utilization, operating process does not have organic solution and pollutes; (3). the concentration of gained virion and purity are all higher.
2. test kit of the present invention adopts the high-efficiency high-quality reversed transcriptive enzyme and the warm start Taq archaeal dna polymerase of import, utilizes primer reasonable in design and probe, can guarantee susceptibility, specificity and the repeatability of detected result.
3. utilize genetic engineering technique, obtain special standard substance, be set at 2 * 10
1, 2 * 10
2, 2 * 10
3, 2 * 10
4, 2 * 10
5Copies/ μ l, the typical curve dependency is greater than 0.99, can be accurately the quantitative copy number of testing gene.
4. test kit of the present invention adopts quantitative fluorescent PCR as detection method, uses the anti-pollution system of UNG enzyme simultaneously, has overcome many difficult problems of conventional round pcr at one stroke,, bromination second pyridine toxicity time-consuming as the product electrophoresis, is prone to difficult problems such as false positive, specificity are low.
5. test kit of the present invention is of very high actual application value, and its meaning is: (1). the strong instrument whether monitoring food is polluted by norwalk virus; (2). auxiliary patient's early diagnosis, for treatment is raced against time; (3). the evaluation of patient's clinical therapeutic efficacy; (4). sea-food norwalk virus features of pollution, popular variation trend and rule thereof are studied conveniently testing tool.
Below in conjunction with the drawings and specific embodiments the present invention is done further narration; so that the public has more deep understanding to summary of the invention; be not limitation of the present invention, the replacement that is equal to of all any this areas of making according to the disclosure of invention all belongs to protection scope of the present invention.
Description of drawings
Fig. 1 is GG I type standard substance detected result figure.
Fig. 2 is a GG I type canonical plotting.
Fig. 3 is GG II type standard substance detected result figure.
Fig. 4 is a GG II type canonical plotting.
Embodiment
Preparation of embodiment 1. Norwalk virus expression detecting kits and application
One, the preparation of test kit
(1), material and equipment
PEG6000 (import packing, chemical pure) is available from the Shantou Xilong Chemical Factory, Guangdong; NaCl (analytical pure) is available from Shanghai chemical reagents corporation of Chinese Medicine group; Na
2HPO
412H2O (analytical pure) is available from Shanghai chemical reagents corporation of Chinese Medicine group; Glycine (import packing, TBD production number: G7403) available from Inst. of Biomedicine Engineering Chinese Academy of Medicine; KH
2PO
4(analytical pure) is available from Shanghai chemical reagents corporation of Chinese Medicine group; KCI (analytical pure) is available from Shanghai chemical reagents corporation of Chinese Medicine group; Trizol reagent is available from Invitrogen company; Chloroform (analytical pure) is available from Chemical Reagent Co., Ltd., Sinopharm Group; Virahol (analytical pure) is available from Chinese Shanghai 5-linked chemical plant; Dehydrated alcohol (analytical pure) is available from Chemical Reagent Co., Ltd., Sinopharm Group; DEPC is available from BIO BASICINC company; Agarose is available from BIO BASIC INC company; Ethidium bromide is available from magnificent Bioisystech Co., Ltd; (dithiothreitol (DTT) is 0.1M) available from Invitrogen company for M-MLV reversed transcriptive enzyme, DTT; Random primer, dNTP mixture, GG I type primer and probe, GG II type primer and probe are given birth to worker biotech company by Shanghai and are synthesized; The UNG enzyme is available from Invitrogen company; Quantitative fluorescent PCR reagent is available from ABgene company; Competence bacterium (DH5 α), standard substance (GG I type, GG II): self-control; Taq enzyme, Oligo (dT), T-carrier, regular-PCR amplification kit are available from Takara company; DNA purification kit, plasmid extract reagent available from the clean biochemical technology of Hangzhou Wei Te company limited; 1-15K type trace high speed low temperature centrifugal machine, 2-5 type low speed normal temperature whizzer are available from German Sigma company; The hypervelocity refrigerated centrifuge is available from German Hettich company, 3111 type thermostat(t)ed water shell type CO
2Incubator is available from U.S. Forma company; Ultralow Temperature Freezer is available from Japanese SANYO company; Bechtop is available from the sincere biological plant of Shanghai intelligence company; Biometra PCR instrument is available from Biometra company; ABI7000 type real-time fluorescence quantitative PCR instrument, sequencing reagent, 377 sequenators, available from U.S. Applied Biosystems company.
(2), primer and probe design and synthetic
With norwalk virus (GG I and GG II type) full length cDNA sequence is template, use ABI7000 type real-time fluorescence quantitative PCR instrument (U.S. Applied Biosystems company) accompanying software to analyze TaqMan primer and probe site, consider virus genome RNA sequence situation simultaneously, therefrom select best of breed.
GG I standard substance primer sequence is identical with the PCR primer sequence with detection, and the upstream and downstream primer sequence is respectively:
P1:5’CCATGTTCCGYTGGATGCGNTTYC-3’;
P2:5’TGGGGCGTCCTTAGACGCCATCAT-3’
The fluorescent probe sequence is: 5 '-FAM-GACAGGAGATYGCGATCTCCTGYCC-TAMRA-3 ', and synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
GG II standard substance primer sequence is identical with the PCR primer sequence with detection, and the upstream and downstream primer sequence is respectively:
P1:5’-TGCCCAGACAAGAGTCAATGTTTA-3’;
P2:5’-AGCAGCGTCATTCGACGCCATCT-3’
The fluorescent probe sequence is: 5 '-FAM-CTAAGCACATGGGAGGGCGATCGCAA-TAMRA-3 ', and synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
(3), the water of the no RNA enzyme of preparation:
Add DEPC (diethylpyrocarbonate) to deionized water, to final concentration be 0.05% (V/V), place after 2 hours for 37 ℃, 121 ℃, high pressure 20min, standby.
(4), standard substance preparation
1. the extraction of viral RNA: utilize kit method of the present invention to concentrate to have made a definite diagnosis and cause patient's faecal samples (deriving from CDC) of diarrhoea and extract viral RNA by norwalk virus.
2. reverse transcription reaction:
(1) with each component mixing in the RT test kit, of short duration centrifugal.
(2) prepare the RNA/ primer mixture in 0.5ml PCR pipe, form is as follows:
Table 3
Composition | Sample |
Total RNA dNTP mixture reverse transcriptase primer does not have the water of RNA enzyme | 2μg 1μl 1μl To 13μl |
Hatch 5min for (3) 65 ℃, ice chest is placed 1min at least.
(4) centrifuge tube that DTT, M-MLV and reverse transcription damping fluid will be housed takes out from-20 ℃, place treat on the ice chest that it slowly melts after, of short duration centrifugal, DTT and reverse transcription damping fluid all added in the M-MLV pipe be mixed with mixed solution, mixing, of short duration centrifugal, place on the ice chest standby
(5) add the above-mentioned mixed solution of 7 μ l, mixing, of short duration centrifugal collection to the every pipe of RNA/ primer mixture.
(6) 25 ℃, hatch 5min; 37 ℃ afterwards, hatch 50min.
(7) 70 ℃, 15min termination reaction, cooled on ice or-20 ℃ of preservations.
3.PCR amplification (GG I and GG II type increase simultaneously)
Prepare the PCR reaction solution by following composition:
Table 4
Reverse transcription product 10 * buffer | 10ul 5.0ul |
DNTPmix upstream and downstream primer Taq enzyme water | 4.0ul 3.0ul 0.5ul 27.5ul |
The PCR reaction conditions: 94 ℃ 3 minutes; (94 ℃ 30 seconds, 56 ℃ 30 seconds, 72 ℃ 50 seconds, 35 circulations); 72 ℃ 7 minutes.
4. the acquisition of amplified production:
(1) preparation 1.2% sepharose with gained PCR product electrophoresis, cuts the agar that contains target DNA under ultraviolet lamp, and after drying with paper handkerchief, chopping is weighed, and determines the volume of glue according to the ratio of 100mg=100 μ l.
(2) add DE-A liquid according to the ratio in the DNA gel extraction kit specification sheets, 60 ℃ are heated to fusing fully.
(3) add 0.5 times of volume in the DE-B of DE-A liquid liquid, mixing; Add Virahol, making its final concentration is 20%.
(4) aforesaid liquid is changed in the preparation pipe, the centrifugal 1min of 5500rpm abandons filtrate.
(5) behind the adding 0.5ml buffer W1, the centrifugal 1min of 5500rpm abandons filtrate.
(6) add 0.7ml buffer W2, the centrifugal 1min of 5500rpm abandons filtrate.
(7) add 0.7ml buffer W2 again, the centrifugal 1min of 5500rpm abandons filtrate; 12000rpm, centrifugal 1min is to dry filter membrane matrix.
(8) will prepare pipe and place new 1.5ml centrifuge tube, central authorities add 25 μ l water at the silica film, after room temperature leaves standstill 1min, and 12000rpm, centrifugal 1min eluted dna.
5. the clone of amplified production and evaluation:
(1) structure of recombinant cloning vector
In the 10 μ l systems, add 1 μ l T carrier, 4 μ l DNA samples add 5 μ l and connect buffer, 16 ℃ spend the night (10-14 hour).
Get 5ul and connect product, join in the 100 μ l competent cells, ice bath 40min behind the mixing places 42 ℃ of water heat-shocked 90s, ice bath 2min.
The LB substratum 400 μ l that add antibiotic-free after mixing jolting 45min with the speed of 150rpm on 37 ℃ of shaking tables, coat liquid in the centrifuge tube on the LA flat board equably, 37 ℃ keep flat 20min after, be inverted and cultivated 10-14 hour.
(2) evaluation of recombinant vectors (extracting method of plasmid/PCR identifies)
A. observe the bacterium colony on the LA flat board, the picking bacterium colony preferably of looking goes to respectively in the Boiling tube that 5ml LA substratum is housed at random, and in the rearmounted 37 ℃ of shaking tables of numbering, 250rpm is about jolting 8-14 hour, to OD600 ≈ 0.4.
B. get the 1.5ml culture to centrifuge tube, 4 ℃, the centrifugal 30s of 11000rpm abandons most supernatant liquor.
C.100 the resuspended precipitation of alkaline lysis liquid I of μ l precooling adds the alkaline lysis liquid II of the new configuration of 200 μ l behind the thermal agitation mixing, behind the mixing, ice bath 3min adds the alkaline lysis liquid III of 150 μ l precoolings again, puts upside down ice bath 3-5min behind the mixing; 4 ℃, behind the centrifugal 5min of 11000rpm supernatant is transferred in another centrifuge tube.
D. add isopyknic phenol/chloroform (1: 1), vibrate back 4 ℃, the centrifugal 2min of 11000rpm is transferred to supernatant another centrifuge tube again.
E. add 3M NaAc solution and 2.5 times of dehydrated alcohols of 1/10 volume, behind the mixing, room temperature leaves standstill 10min, 4 ℃, abandons supernatant behind the centrifugal 10min of 11000rpm.
F. add 1ml 70% ethanol, the vibration rinsing after 4 ℃, the centrifugal 2min of 11000rpm; Discard supernatant liquid.
G. add a small amount of dehydrated alcohol, 4 ℃, the centrifugal 2min of 11000rpm, discard ethanol after, room temperature is inverted 10min, adds 30 μ l dissolved in distilled water plasmid DNA.
H. get an amount of DNA and carry out pcr amplification, determine by electrophoretic image whether the bacterium colony of getting is desired purpose bacterium colony.
6. plasmid order-checking
Through the 377 sequenators order-checking of U.S. Applied Biosystems company, its sequence of the standard substance of preparation conforms to fully with expection, standard substance sequence following (for inserting the fragment in the T carrier):
GG I type:
1 CCATGTTCCG CTGGATGCGT TTCCATGATC TGAGTTTGTG GACAGGAGAT CGCGATCTCC
61TGCCCGATTA TGTAAATGAT GATGGCGTCT AAGGACGCCC CA
GG II type:
1 TGCCCAGACA AGAGTCAATG TTTAGGTGGA TGAGGTTCTC AGATCTAAGC ACATGGGAGG
61GCGATCGCAA TCTGGCTCCC AGTTTTGTGA ATGAAGATGG CGTCGAATGA CGCTGCT
(5), the preparation of positive reference substance and negative control product
Positive reference substance is for containing the RNA sample of GG I and GG II type norwalk virus RNA respectively, and the negative control product are not for containing the RNA sample of GG I and GG II type norwalk virus RNA, and the RNA extracting method is identical with aforesaid method.
(6), press the concentration requirement preparation sample pre-treatments liquid A in the summary of the invention, sample pre-treatments liquid B, sample pre-treatments liquid C, sample pre-treatments liquid D, reverse transcriptase primer, the reverse transcription damping fluid, the dNTP mixture, 0.1M DTT, reversed transcriptive enzyme is preserved liquid, GG I type PCR reaction solution, GG II type PCR reaction solution, GG I type probe, GG II type probe, GG I type UNG enzyme is preserved liquid, GG II type UNG enzyme is preserved liquid, GG I type standard substance, GG II type standard substance, GG I type quality control product, GG II type quality control product.
(7), by the specification of test kit of the present invention above-mentioned each component is carried out packing.
The application of embodiment 2. test kits
One, sample detects
60 parts in oyster sample, dysentery human faecal mass 20 people, 10 parts in normal people's ight soil; Use test kit of the present invention and carry out sample pre-treatments and viral RNA extraction, get 8 μ l RNA, after in 20 μ l total reaction systems, carrying out reverse transcription, use downstream primer and probe in the enterprising performing PCR amplifications of ABI company 7000 type quantitative PCR instrument (GG I and GG II type detect simultaneously) with detection, while application standard product production standard curve, the result handles through corresponding software, calculates the expression amount that detects the sample viral RNA.
Two, experimental result
1.GG I type: the standard substance detected result is seen Fig. 1, and typical curve is seen Fig. 2.
2.GG II type: the standard substance detected result is seen Fig. 3, and typical curve is seen Fig. 4.
3. oyster sample detection result: have 10 positively in 30 oyster samples, all the other 20 samples are negative, and concrete outcome sees the following form:
Table 5
Sample number into spectrum | Example weight (g shells) | Quantitative result (copie/g) | |
1 7 8 9 12 16 18 21 23 28 | 69 75 80 76 73 72 74 75 78 72 | 3.2×10 3 1.3×10 4 2.5×10 3 6.5×10 4 4.2×10 3 3.7×10 3 3.8×10 4 1.5×10 3 2.9×10 5 7.3×10 2 | GG I type GG I type GG II type GG II type GG II type GG II type GG I type+GG II type GG I type GG II type GG II type |
4. human faecal mass sample detection result: 20 routine dysentery philtrums have 13 examples positive, and all the other 7 examples are negative; 10 routine normal people's ight soil are all negative, the results are shown in following table:
Table 6
Sample number into spectrum | Example weight (g) | Quantitative result (copie/g) | |
1 2 6 7 9 10 11 13 15 16 17 19 20 | 0.1 0.1 0.1 0.1 0.1 0.1 0.1 0.1 0.1 0.1 0.1 0.1 0.1 | 3.6×10 5 3.7×10 4 5.0×10 4 2.2×10 5 1.2×10 3 7.3×10 4 2.4×10 5 2.9×10 6 1.4×10 4 2.9×10 5 5.5×10 4 8.3×10 4 1.9×10 3 | GG II type GG II type GG I type GG I type GG II type GG II type GG II type GG II type GG II type GG I type GG II type GG II type GG I type |
Sequence table
<110〉Nutrition and Food Safety Office of China Disease Prevention and control Centre
<120〉Norwalk virus expression detecting kit and primer special thereof and probe
<130>
<160>8
<170>PatentIn version 3.3
<210>1
<211>24
<212>DNA
<213〉synthetic
<220>
<221>misc_feature
<222>(12)..(12)
<223>n is a,c,g,or t,y is t/u or c
<400>1
ccatgttccg ytggatgcgn ttyc 24
<210>2
<211>24
<212>DNA
<213〉synthetic
<400>2
tggggcgtcc ttagacgcca tcat 24
<210>3
<211>25
<212>DNA
<213〉synthetic
<400>3
gacaggagat ygcgatctcc tgycc 25
<210>4
<211>102
<212>DNA
<213〉synthetic
<400>4
ccatgttccg ctggatgcgt ttccatgatc tgagtttgtg gacaggagat cgcgatctcc 60
tgcccgatta tgtaaatgat gatggcgtct aaggacgccc ca 102
<210>5
<211>24
<212>DNA
<213〉synthetic
<400>5
tgcccagaca agagtcaatg ttta 24
<210>6
<211>23
<212>DNA
<213〉synthetic
<400>6
agcagcgtca ttcgacgcca tct 23
<210>7
<211>26
<212>DNA
<213〉synthetic
<400>7
ctaagcacat gggagggcga tcgcaa 26
<210>8
<211>117
<212>DNA
<213〉synthetic
<400>8
tgcccagaca agagtcaatg tttaggtgga tgaggttctc agatctaagc acatgggagg 60
gcgatcgcaa tctggctccc agttttgtga atgaagatgg cgtcgaatga cgctgct 117
Claims (3)
1. detect the primer and the probe of norwalk virus, have following nucleotide sequence:
(1)CCATGTTCCGYTGGATGCGNTTYC;
(2)TGGGGCGTCCTTAGACGCCATCAT;
(3)TGCCCAGACAAGAGTCAATGTTTA;
(4)AGCAGCGTCATTCGACGCCATCT;
(5)GACAGGAGATYGCGATCTCCTGYCC;
(6)CTAAGCACATGGGAGGGCGATCGCAA;
Wherein N is A, C, G, or T; Y is T/U or C;
(1) and (2) to be that GG I type norwalk virus detects primer right;
(3) and (4) to be that GG II type norwalk virus detects primer right;
(5) be GG I type norwalk virus detection probes;
(6) be GG II type norwalk virus detection probes.
2. norwalk virus fluorescence quantitative RT-PCR detecting kit, it is characterized in that: described test kit comprises:
(1) sample pre-treatments liquid A is the glycine buffer of 0.05M, contains glycine, the 0.15mol NaCI of 0.05mol among the pH 9.5:1000ml, and solvent is a water;
(2) sample pre-treatments liquid B is 16% polyethylene glycol 6000 solution: contain PEG6000, the NaCI of 0.3mol of 160 grams among the 1000ml, solvent is a water;
(3) sample pre-treatments liquid C is the Na of 0.15M
2HPO
4Solution contains the Na of 0.15mol among the pH 9.0:1000ml
2HPO
4, solvent is a water;
(4) sample pre-treatments liquid D is the PBS damping fluid: the KH that contains 1.47mmol among the 1000ml
2PO
4, 136.9mmol KCl, the Na of 7.96mmol of NaCl, 2.68mmol
2HPO
412H
2O, solvent are water;
(5) RNA extracts reagent: be Trizol reagent;
(6) water of no RNA enzyme;
(7) reverse transcriptase primer: be random primer six primers, be dissolved into the use liquid of 100 μ mol/L with deionized water;
(8) reverse transcription damping fluid: contain the Tris-HCl of 250mmol among the 1000ml, the KCl of pH 8.3,375mmol, the MgCl of 15mmol
2, solvent is a water;
(9) dNTP mixture: contain dATP, dCTP, each 10mmol of dGTP, dTTP among the 1000ml, solvent is a water, pH7.0-7.5;
(10) reversed transcriptive enzyme is preserved liquid: contain the Tris-HCl of 20mmol among the 1000ml, the glycerine of DTT, the 500ml of the NaCl of pH 7.5,100mmol, the EDTA of 0.1mmol, 1.0mmol, the Nonidet p-40,2.0 * 10 of 0.1ml
8The reversed transcriptive enzyme of U, water;
(11) GG I type PCR reaction solution: contain the Tris-HCI of 20mmol among the 1000ml, the MgCI of pH8.3,3.0mmol
2, the KCI of 100mmol, upstream and downstream primer/L, 1.0 * 10 of 0.4 μ mol
5The dGTP of dCTP, the 400nmol of the Taq enzyme of U, dATP, the 400nmol of 400nmol, the dUTP of 800nmol, solvent are water;
The upstream and downstream primer sequence is respectively:
P1:5’-CCATGTTCCGYTGGATGCGNTTYC-3’
P2:5’-TGGGGCGTCCTTAGACGCCATCAT-3’
(12) GGII type PCR reaction solution: contain the Tris-HCI of 20mmol among the 1000ml, the MgCI of pH8.3,3.0mmol
2, 100mmol upstream and downstream primer/L, 1.0 * 10 of KCI, 0.4pmol
5The dGTP of dCTP, the 400nmol of the Taq enzyme of U, dATP, the 400nmol of 400nmol, the dUTP of 800nmol, solvent are water;
The upstream and downstream primer sequence is respectively:
P1:5’-TGCCCAGACAAGAGTCAATGTTTA-3’
P2:5’-AGCAGCGTCATTCGACGCCATCT-3’
(13) GG I type probe is a fluorescence labeling probe, and its sequence is:
5’-FAM-GACAGGAGATYGCGATCTCCTGYCC-TAMRA-3’;
(14) GG II type probe is a fluorescence labeling probe, and its sequence is:
5’-FAM-CTAAGCACATGGGAGGGCGATCGCAA-TAMRA-3’;
(15) GG I type UNG enzyme: contain the glycerine of 50ml, the Tris-HCl of 30mmol among the 1000ml, the Tween 20,1.0 * 10 of DTT, the 0.5ml of EDTA, the 1.0mmol of NaCl, the 1.0mmol of 7.5,25 ℃ of pH, 150mmol
6The UNG enzyme of U, solvent are water;
(16) GG II type UNG enzyme: contain the glycerine of 50ml, the Tris-HCl of 30mmol among the 1000ml, the Tween 20,1.0 * 10 of DTT, the 0.5ml of the NaCl of pH 7.5,150mmol, the EDTA of 1.0mmol, 1.0mmol
6The UNG enzyme of U, solvent are water;
(17) sequence of GG I type standard substance is:
1 CCATGTTCCG CTGGATGCGT TTCCATGATC TGAGTTTGTG GACAGGAGAT CGCGATCTCC
61 TGCCCGATTA TGTAAATGAT GATGGCGTCT AAGGACGCCC CA
(18) sequence of GG II type standard substance is:
1 TGCCCAGACA AGAGTCAATG TTTAGGTGGA TGAGGTTCTC AGATCTAAGC ACATGGGAGG
61 GCGATCGCAA TCTGGCTCCC AGTTTTGTGA ATGAAGATGG CGTCGAATGA CGCTGCT;
(19) GG I type quality control product is divided into positive quality control product and negative quality control product, and positive quality control product is the sample that contains GG I type RNA, and negative quality control product is not for containing the sample of GG I type RNA;
(20) GG II type quality control product is divided into positive quality control product and negative quality control product, and positive quality control product is the sample that contains GG II type RNA, and negative quality control product is not for containing the sample of GG II type RNA.
3. norwalk virus fluorescence quantitative RT-PCR detecting kit according to claim 2, it is characterized in that: the preparation method of the water of described (6) no RNA enzyme is: add diethylpyrocarbonate to deionized water, to final concentration be 0.05%V/V, placed 2 hours for 37 ℃, 121 ℃, the 20min high pressure, standby.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CNB200510127520XA CN100351395C (en) | 2005-12-05 | 2005-12-05 | Norwalk virus expression detecting kit and its special primer and probe |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CNB200510127520XA CN100351395C (en) | 2005-12-05 | 2005-12-05 | Norwalk virus expression detecting kit and its special primer and probe |
Publications (2)
Publication Number | Publication Date |
---|---|
CN1814807A CN1814807A (en) | 2006-08-09 |
CN100351395C true CN100351395C (en) | 2007-11-28 |
Family
ID=36907163
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CNB200510127520XA Expired - Fee Related CN100351395C (en) | 2005-12-05 | 2005-12-05 | Norwalk virus expression detecting kit and its special primer and probe |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN100351395C (en) |
Families Citing this family (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101153341B (en) * | 2007-09-21 | 2010-12-15 | 珠海市疾病预防控制中心 | Primer, detection method and detection reagent kit for detecting type G2 norovirus |
CN102605103B (en) * | 2012-03-15 | 2013-12-04 | 东莞出入境检验检疫局检验检疫综合技术中心 | Primer, probe and method for detecting Norwalk virus nucleotide |
CN103131798A (en) * | 2013-02-25 | 2013-06-05 | 湖北朗德医疗科技有限公司 | Norovirus real-time fluorescent RT-PCR detection kit and application thereof |
-
2005
- 2005-12-05 CN CNB200510127520XA patent/CN100351395C/en not_active Expired - Fee Related
Non-Patent Citations (2)
Title |
---|
两株诺瓦克样病毒新亚型的鉴定 戴迎春等.第一军医大学学报,第24卷第9期 2004 * |
太平洋牡蛎中诺瓦克样病毒的RT-PCR法检测和病毒聚合酶区部分序列的分析 汪俊等.中国水产科学,第11卷第6期 2004 * |
Also Published As
Publication number | Publication date |
---|---|
CN1814807A (en) | 2006-08-09 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN1286989C (en) | Biochip for detecting pathogenesis fungus | |
CN1814805A (en) | H5, H7, H9 subtype auian flu virus real-time fluo rescent quantixative PCR detecting method | |
CN1896284A (en) | Method for identifying allelic gene type | |
CN1940087A (en) | Method for inspecting hepatitis and AIDS virus nucleic acid by synchronous amplification and its reagent kit | |
CN1670221A (en) | Primer, probe series and method for multiple real time fluorescent RT-PCR detection of H5, H7 and H9 subtype bird flu | |
CN100351395C (en) | Norwalk virus expression detecting kit and its special primer and probe | |
CN1495190A (en) | Polynuleotide fragment of white-spot disease baculovirus and method for detecting virus by using it | |
CN1824801A (en) | Real-time fluorescent PCR testing primer, probe and immobilized kit for citrus ulcer bacteria and testing process thereof | |
CN1724686A (en) | Target sequence used for detecting mycoplasma pnoumoniae and reagent box | |
CN1786197A (en) | Method of detecting bioterror related pathogen bacteria and its special DNA chip | |
CN1274848C (en) | Nucleic acid primers of acid alicyclic acid bacterium and method of identifying acid alicyclic acid bacterium | |
CN1188530C (en) | Gene detection reagent kit for SARS virus and its detection method | |
CN1670220A (en) | Primer and probe series for real time fluorescent RT-PCR detection of bird flu of H7 subtype | |
CN1557966A (en) | Internal standard gene suitable to exogenous gene detection such as transgene cotton and application thereof | |
CN1274850C (en) | Turbot reddish body iridovirus virus polymerase chain reaction detection method | |
CN1154410A (en) | Method and kit for quantitation and detection of microorganisms | |
CN101074449A (en) | Gene chip for analyzing microbial group structure and function under acid environment | |
CN1710097A (en) | Insitu method for rapid qualitative identification of red tide micro algae | |
CN1809638A (en) | Method of detecting beta 3 adrenaline receptor mutant gene and nucleic acid probe and kit therefor | |
CN100335651C (en) | Probe sequence for qualitatively detecting transgenic crop containing Pat gene using fluorescence PCR and reagent case | |
CN1295349C (en) | One step RT-PCR kit for testing pear virus and testing method | |
CN1405320A (en) | Artificial sequence template primer collection and its use | |
CN1281763C (en) | Process for detecting Enterobacter sakazakii by employing fluorescence PCR technology | |
CN1272447C (en) | Method of discriminating corn cytoplasm male sterality material cytoplasm kind | |
CN1536091A (en) | Quick quantitative detection of genetic marker of skeletonema costatum japonicum and its method |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
C17 | Cessation of patent right | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20071128 Termination date: 20101205 |