CN1274850C - Turbot reddish body iridovirus virus polymerase chain reaction detection method - Google Patents

Abstract

The present invention relates to a detection method for turbot reddish body iridovirus polymerase chain reaction, which belongs to a virus detection method of fish, and mainly comprises the following contents: 1. a section of specific anucleotide sequence used for identifying the turbot reddish body iridovirus; 2. a pair of PCR primers, MCP-TRBIVF and MCP-TRBIVR, used for detecting the turbot reddish body iridovirus; 3. a PCR method for detecting the turbot reddish body iridovirus by utilizing the primers, the MCP-TRBIVF and the MCP-TRBIVR, wherein the PCR method comprises the specific procedures: the preparation of a reaction template, and the electrophoretic detection and the result estimation of a PCR reaction system, a PCR reaction program and amplified products. The present invention has the characteristics of convenience, rapidness, accuracy and sensitiveness, can detect if the turbot reddish body iridovirus exists in fries, adult turbots and feed, and can be used for surveying epidemic situations of the turbot reddish body iridovirus.

Description

Turbot reddish body iridovirus virus polymerase chain reaction detection method

Technical field

The invention belongs to the fish virus detection techniques, relate to detect a kind of molecular biology method of turbot reddish body iridovirus with polymerase chain reaction.

Background technology

Turbot is to introduce the high-quality marine fish culture kind of China in 1992, has become one of most important batch production marine fish in northern China coastland at present.But it is serious day by day that the turbot disease popularity is cultured by China in recent years, particularly by turbot reddish body iridovirus (turbot reddish bodyiridovirus, abbreviation TRBIV) the viral corpus rubrum that causes, the sound development of this aquaculture industry in serious threat.

Turbot reddish body iridovirus is a kind of fish iridovirus, is that the topmost viral cause of disease of turbot is cultured by China.People such as the Shi Chengyin of Inst of Huanghai Sea Marine Products, Chinese Academy of Aquatic Product Science take the lead in having found in the world should virus, and feature, fine structure that should virus, the research of pathogenic, classification evaluation, gene clone and detection technique have been carried out, prove that this virus is a kind of new fish iridovirus (Shi etal., 2004).Turbot reddish body iridovirus is cultured in the turbot popular rapidly in recent years in China, cause ill turbot mass mortality, loses huge.The grave danger that China's turbot aquaculture industry is caused in view of TRBIV, adopt the novel method new technology to detect TRBIV fast, accurately, delicately, add the detection of strong virus and the quarantine of fish body, thereby the infection of active prevention virus is significant to the sound development of China's turbot aquaculture.

Aspect the irido virus that infects turbot, people such as the Bloch of Denmark reported in 1993 once that irido virus caused the case (Bloch et al., 1993) of Denmark's turbot fry mass mortality.But the turbot irido virus of people such as Bloch report and China's turbot reddish body iridovirus in the size of viral size, target tissue, susceptible fish, there were significant differences for the everyways such as outward appearance performance of associated diseases, so this is the irido virus of two kinds of different infection turbot.In addition, Bloch etc. are not purified into Denmark's turbot irido virus, only by Electronic Speculum this virus are observed aspect detection technique yet, fail to set up the Fast Detection Technique (Bloch et al., 1993) of virus.

Because turbot reddish body iridovirus is a kind of newfound fish iridovirus, at present also very limited to this viral detection means, people's application organizes pathology method such as the Shi Chengyin that Inst of Huanghai Sea Marine Products, Chinese Academy of Aquatic Product Science is only arranged of open report and Electron Microscopy detect this virus (shi et al. in the document, 2004), and the people such as Chen Songlin of Inst of Huanghai Sea Marine Products, Chinese Academy of Aquatic Product Science adopt the method for the flounder embryo cell of inoculation culture to separate and identify this virus (Chen et al., 2004).In these methods, traditional histopathology method can only be made preliminary judgement to the pathological state of turbot, the existence that can not directly detect turbot reddish body iridovirus whether, poor specificity.Though the electron microscope observation method can observe directly the existence of virus particle, complicated operation, sample preparation overlong time, can not be used for the quick diagnosis of turbot reddish body iridovirus and the detection of a large amount of samples.Though the cell culture processes reliability is higher, detection sensitivity is low, and complex operation generally needs the time about a week just can obtain viral detected result.Therefore, above-mentioned method for detecting virus all has significant disadvantages, is not suitable for fast, detects accurately, delicately turbot reddish body iridovirus.

Polymerase chain reaction (polymerase chain reaction, abbreviation PCR) technology is a kind of modern molecular biology technique, can be in external quick, a large amount of amplicon virus DNA fragment specific, have quick, sensitive, characteristic of accurate, can overcome the shortcoming of above-mentioned detection method, be successfully used to the detection of multiple virus.Existing application pcr amplification detects the report of irido virus coe virus in the document, people such as Deng Min as Zhongshan University once detected the mandarin fish irido virus by the little subunit of pcr amplification viral nucleotide reductase enzyme (RNRS), the people such as Chao of Taiwan Guoli Zhongshan Univ. once detected Taiwan grouper irido virus (Deng Min etc., 2000 by pcr amplification; Chao et al., 2002).Above-mentioned mandarin fish irido virus and Taiwan grouper irido virus and turbot reddish body iridovirus belong to Iridoviridae together, but belong to different virus kinds, bigger difference is arranged between its genome, and therefore the PCR detection technique of having reported can not be used for the detection of turbot reddish body iridovirus.Up to now, do not see the report that has the application pcr amplification to detect turbot reddish body iridovirus.

Reference:

1, Deng Min, He Jianguo, left great waves, Weng Shaoping, once fervent, Lv Ling, Zhou Songyu, imperial Qi is new, and 2000.The foundation and the irido virus fresh evidence of mandarin fish infectious spleen and kidney necrosis virus (ISKNV) PCR detection method.The virus journal, 16:365-369.

2、Bloch B.，Larsen J.L.，1993.Aniridovirus-like agent associatedwith systemic infection in cultured turbot，Scophthalmus maximus fryin Denmark.Disease of Aquatic Organism，15：235-240.

3、Chao C.B.，Yang S.C.，Tsai H.Y.，Chen C.Y.，Lin C.S.，Huang H.T.，2002.A nested PCR for the detection of grouper iridovirus in Taiwan(TGIV)in cultured hybrid grouper，Giant Seaperch，and largemouth bass.Journal of Aquatic Animal Health，14：104-113.

4、Chen S.L.，Ren G.C.，Sha Z.X.，Shi C.Y.，2004.Establishmentof a continuous embryonic cell line from Japanese flounder(Paralichthys olivaceus)for virus isolation.Disease of AquaticOrganism，60：241-246.

5、Shi，C.Y.，Wang，Y.G.，Yang，S.L.，Huang，J.，Wang，Q.Y.，2004.The first report of an iridovirus-like agent infection in farmed turbot，Scophthalmus maximus，in China.Aquaculture，236：11-25.

Summary of the invention

The purpose of this invention is to provide a kind of polymerase chain reaction (PCR) detection method, fast, sensitive, easy, exactly turbot reddish body iridovirus (TRBIV) is detected, the detection sensitivity height of this method, effective, can substitute electron microscope and cell cultures detection method.

The present invention realizes by following technical scheme:

The present inventor finds in the research to TRBIV and other fish iridovirus, the main capsid protein gene of TRBIV and near nucleotide sequence thereof and the corresponding sequence of other irido virus have evident difference, this section nucleotide sequence according to TRBIV, can design corresponding PCR primer, set up molecular biology method quick, accurate, that sensitive detects TRBIV.

The invention provides a kind of polyase chain reaction detecting method of turbot reddish body iridovirus, specifically comprise three parts: 1, the specific nucleotide sequence of TRBIV; 2, the PCR of TRBIV detects primer; 3, the PCR detection method of TRBIV.

The content of the present invention's three parts is:

1.TRBIV specific nucleotide sequence

TRBIV specificity nucleotide sequence provided by the invention derives from the main capsid protein gene of TRBIV and near nucleotide sequence thereof, is the linear dsdna sequence (shown in Fig. 1 and No. 1 sequence of sequence table) of 1581 Nucleotide of total length.One of 1419 nucleotide coding of the 58th Nucleotide to the of this TRBIV specificity nucleotide sequence contain 453 amino acid whose protein, i.e. the main capsid protein of TRBIV (shown in No. 2 sequence of sequence table).

This TRBIV specificity nucleotide sequence can use two length to be respectively the linear ssdna of 18 and 19 Nucleotide (shown in No. 3 sequence of sequence table and No. 4 sequence of sequence table) as oligonucleotide primer (following iridoF and the iridoR of abbreviating as respectively), method by the homolgous molecule clone obtains (shown in embodiment 3), perhaps form and arrangement, on business-like automatic dna synthesizer, be synthesized into according to a conventional method by the Nucleotide of known this sequence.

2.TRBIV PCR detect primer

The present invention be used for primer that TRBIV PCR detects be two length be respectively 18 and 20 Nucleotide linear ssdna (shown in No. 5 sequence of sequence table and No. 6 sequence of sequence table, below abbreviate MCP-TRBIVF and MCP-TRBIVR respectively as), the nucleotide sequence with the 304bp-321bp of the nucleotide fragments of main capsid protein gene of TRBIV and near 1581bp thereof and 1084bp-1065bp place is identical or complementary respectively for they, and its nucleotide sequence is respectively: MCP-TRBIVF:5 ' CGTGTTAAGATCCCCTCC 3 ' and MCP-TRBIVR:5 ' TCTCGTAAATGAGTGACACC 3 '.They be the main capsid protein gene of above-mentioned TRBIV and near the nucleotide sequence basis on, (shown in the embodiment 4) that designs by Omiga 2.0 softwares (Oxford Molecular Ltd.).

Above-mentioned PCR primer of the present invention can be formed and arranges according to the Nucleotide of known this sequence, and the DNA synthetic method by routine is synthesized into (for example can use business-like automatic dna synthesizer to synthesize).

Above-mentioned PCR primer of the present invention (MCP-TRBIVF and MCP-TRBIVR) can be to the TRBIV specific amplification, but can not increase the DNA of the lymphocystis disease virus that can not increase (member of Iridoviridae is different from TRBIV) to the turbot tissue DNA.So, utilize above-mentioned PCR primer, by PCR method can be fast, accurately, sensitive detects TRBIV.

3.TRBIV the PCR detection method

TRBIV detection method provided by the present invention, comprise and from testing sample, prepare pcr template, in suitable reaction system, carry out pcr amplification again with above-mentioned PCR primer (MCP-TRBIVF and MCP-TRBIVR), amplification is carried out electrophoresis detection after finishing, if specificity target stripe (dna fragmentation that 780bp is long), then the TRBIV detected result of this sample is positive.Specifically may further comprise the steps:

(1) preparation of PCR detection reaction template

It is an amount of to get testing sample, adopt the extraction and the purifying of Luo Shi diagnostic companies (Roche Diagnostics Ltd.) commercial " the high purity pcr template prepares test kit " (High Pure PCR Template Preparation Kit) tissue nucleic acid, as the template of PCR detection reaction, detail operations is referring to embodiment 1 or this test kit working instructions.

(2) PCR reaction system and PCR response procedures

Get the PCR reaction template of above-mentioned preparation, PCR detection primer MCP-TRBIVF and MCP-TRBIVR together with TRBIV carry out cyclic amplification in the PCR reaction system.This PCR reaction system comprises: template DNA solution 1-2 μ l, Taq archaeal dna polymerase 1U, four kinds of each 250 μ M of dNTP, Tris-HCl (pH 9.0) 10mM, KCl 40mM, MgCl ₂1.5mM each 10pmol of primer MCP-TRBIVF and MCP-TRBIVR, the cumulative volume of final reaction system are 20 μ l.The PCR response procedures is: 94 ℃ 5 minutes, 1 circulation; Then 94 ℃ 2 minutes, 59 ℃ 1 minute, 72 ℃ 1 minute, 30 circulations; Last 72 ℃ 7 minutes, 1 circulation.

(3) electrophoresis detection of amplified production and result judge

After above-mentioned PCR response procedures finishes, in reaction tubes, add 2 μ l, 10 * sample-loading buffer (EDTA50mM, 60% glycerine, the blue FF of 0.1% dimethylbenzene nitrile, 0.1% tetrabromophenol sulfonphthalein), mixing.The amplified production electrophoresis on 1% sepharose that contains 0.5 μ g/ml bromination second pyridine that takes a morsel is observed the segmental amplification situation of purpose.Testing sample if bright DNA band occurs at the 780bp place, is the TRBIV positive then behind PCR reaction and agarose gel electrophoresis, illustrates that this sample carries turbot reddish body iridovirus; Otherwise detected result is negative.

The PCR detection method of above TRBIV from the preparation feedback template, through steps such as preparation reaction system, amplification target nucleic acids, thereby obtains detected result until the electrophoresis detection amplified production, and whole testing process only needs 4-8 hour, and is very convenient, quick.

The sensitivity of TRBIV detection method provided by the present invention, can measure by the following method: get the turbot spleen tissue sample that has infected TRBIV, make gradient dilution after the homogenate, use the high purity pcr template of Luo Shi diagnostic companies to prepare test kit then and prepare PCR reaction template (shown in embodiment 1), adopt primer MCP-TRBIVF and MCP-TRBIVR to carry out pcr amplification and detected through gel electrophoresis (shown in embodiment 6) respectively again.Measurement result shows that PCR detection method provided by the invention can be from being low to moderate 10 ^-7Detect the existence of TRBIV in the sick fish spleen tissue of g, have high sensitivity (as shown in Figure 5).

TRBIV detection method provided by the present invention has following advantage:

(1) easy to be quick.Utilize prior art to detect TRBIV, need the time of a couple of days to several weeks usually, and present method can obtain the detected result of TRBIV in one day time, and can detect simultaneously the dozens of sample.

(2) amount of samples is few, only needs tens of milligrams of samples can finish detection, does not influence the integrity of sample.

(3) accurate, highly sensitive, to being low to moderate 10 ^-7TRBIV in the g sample also can detect.

(4) do not use toxic reagent.

The present invention has following beneficial effect:

Utilize TRBIV specificity nucleotide sequence provided by the invention and according to the PCR primer of this sequences Design,,, can carry out fast the TRBIV in the sample through simple operations by PCR method provided by the invention, sensitive, calibrating accurately.Use aforesaid method and finished the detection of nearly 100 turbot samples and TRBIV sample, the result is accurate, and can obtain detected result within one day, and sensitivity reaches 10 ^-7G fish body tissue, and can detect a plurality of samples simultaneously.

By electron microscopic examination, can in the ultrathin section(ing) of sick fish sample, observe the morphological structure (as shown in Figure 2) of turbot reddish body iridovirus.Comparison and detection is found: compare with the electron microscopic examination method, electron microscopic examination is observed the positive of virus, and the PCR detected result is all positive, and coincidence rate is 100%; And the positive sample of PCR detected result, electron microscopic examination is not observed virus sometimes, illustrates that there is omission in the electron microscopic examination method; Do not find that the electron microscopic examination result is positive, and the negative sample of PCR detected result illustrates this PCR method reliability height.Above comparison and detection the results are shown in Table 1.

Therefore, the detection that the PCR method is used for TRBIV has important and practical meanings, and it can detect TRBIV fast, accurately, delicately, can add the detection of strong virus and the quarantine of fish body, thus the infection of active prevention virus.In addition, this method also can be applicable to the clinical diagnosis of TRBIV, laboratory diagnosis and epidemiology survey.

The PCR of table 1TRBIV detects and electron microscopic examination result contrast

Sample	The electron microscopic examination result	The PCR detected result	Remarks
				Normal turbot	-	-	About the long 25cm of body
Dying turbot	+	+	About the long 20cm of body
				The dead fish of infectable infection	+	+	Adult turbot
Dead turbot	-	+	The outward appearance symptom is not obvious
				Turbot 1	-	+	Mature stage, dying
Turbot 2	+	+	Mature stage, dying
				Turbot 3	-	+	Mature stage, dying
The turbot fry	-	-	Normally, live body
				Forage fiss	-	-	Freezing

Description of drawings

Fig. 1: main capsid protein gene of turbot reddish body iridovirus and near nucleotide sequence structure synoptic diagram thereof, wherein the black matrix part (304bp-321bp and 1084bp-1065bp) with underscore is respectively PCR primer MCP-TRBIVF and the MCP-TRBIVR (complementary sequence) that is used to detect turbot reddish body iridovirus among the present invention.

Fig. 2: the electron microscopic observation of turbot reddish body iridovirus morphological structure in the ultrathin section(ing).

Fig. 3: the negative staining electron microscope of the turbot reddish body iridovirus of purifying is observed from the turbot tissue.

Fig. 4: the specificity test that PCR of the present invention detects, it is the pcr amplification electrophorogram as a result of embodiment 5, wherein 1 is the DL2000DNA molecular weight standard of precious biotechnology (Dalian) company limited, 2 for not infecting the healthy turbot spleen tissue of TRBIV, 3 for having infected the turbot spleen tissue of TRBIV, 4 for having infected the turbot renal tissue of TRBIV, and 5 is lymphocystis disease virus DNA.The right side arrow indication is the pcr amplification target stripe.

Fig. 5: the sensitivity test that PCR of the present invention detects, i.e. the pcr amplification of embodiment 6 electrophorogram as a result, wherein 1 is 10 ^-3G does not infect the healthy turbot spleen tissue of TRBIV, and 2 is the DL2000DNA molecular weight standard of precious biotechnology (Dalian) company limited, and 3-8 is respectively 10 ^-4G, 10 ^-5G, 10 ^-6G, 10 ^-7G, 10 ^-8G, 10 ^-9G has infected the turbot spleen tissue of TRBIV.The right side arrow indication is the pcr amplification target stripe.

Embodiment

Be described in detail technology contents of the present invention in conjunction with the accompanying drawings below by embodiment:

The present invention finishes on the basis of following scientific discovery: since calendar year 2001, culture popular a kind of turbot reddish body that causes culturing the fish mass mortality in the turbot in China.By to researchs such as the purifying of this sick epidemiology, tissue and cytopathology, cause of disease artificial challenge and cell inoculation experiment, virus and molecular biology classification evaluations, the inventor finds first that at home and abroad this sick cause of disease is a kind of new fish iridovirus, and with its called after " turbot reddish body iridovirus " (TRBIV).After two important gene of the clone and the TRBIV that checked order, the inventor finds, the main capsid protein gene of virus and near nucleotide sequence in, TRBIV has and significantly different composition and the arrangements of other irido virus, therefore can be used as the TRBIV characteristic nucleotide sequence, be used for evaluation and the detection of TRBIV.The inventor is according to this characteristic nucleotide sequence, and design has prepared the PCR primer of TRBIV, has set up the PCR detection method of TRBIV, and has finished the present invention on this basis.The TRBIV of this method in can the rapid detection sample, and have high sensitivity and accuracy.

In order to set up the PCR detection method of TRBIV, at first need to obtain the specific nucleotide sequence of TRBIV.This generally includes the contents such as evaluation of the clone of the main capsid protein gene of separation and purification, TRBIV of TRBIV and near Nucleotide thereof and order-checking, TRBIV specificity nucleotide sequence.

The present invention adopts ultracentrifugal method to separate TRBIV, promptly collect turbot spleen and the renal tissue that has infected TRBIV, add phosphoric acid buffer, after the sucrose density gradient ultracentrifugation of homogenate, differential centrifugation and 20%-60%, get middle portion, centrifugal again concentrate can obtain purer TRBIV preparation, and Fig. 3 is the viral photo of the purifying that observes under the Electronic Speculum.

For the main capsid protein gene that obtains TRBIV and near nucleotide sequence thereof, can adopt multiple molecule clone technology.The present invention has adopted the homolgous molecule clone technology to clone the main capsid protein gene of TRBIV and near nucleotide sequence thereof.Promptly at first according near the nucleotide sequence conserved regions the main capsid protein gene of fish iridovirus, with the main capsid protein gene of irido virus is the target area, the synthetic following PCR primer of design, they are two the oligonucleotide sequences (iridoF and iridoR) shown in No. 3 sequence of sequence table and No. 4 sequence of sequence table.Application PCR primer iridoF and iridoR carry out pcr amplification to the TRBIV DNA of purifying, obtain the target dna fragment about 1600bp.Separate by gel electrophoresis, purifying and reclaim this fragment after, mix with pUCm-T cloning vector (available from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd) again, under the ligase enzyme effect, connect and spend the night, transformed into escherichia coli DH5 α competent cell, transformant is screened and identify by reaction of blue hickie and endonuclease reaction, the white that picking contains TRBIV dna fragmentation (about 1600bp) is cloned in LB liquid nutrient medium (1% Tryptones that contains 100 μ g/ml penbritins, 0.5% yeast extract, 1%NaCl) go up overnight incubation, use the order-checking of ABI PRISM TM377 type dna sequencing instrument, obtain the TRBIV nucleotide sequence of 1581bp.Fig. 1 is the structural representation of this nucleotide sequence.

In order to identify that this nucleotide sequence is the specific sequence of TRBIV, this TRBIV nucleotide sequence is input among the public database GenBank, utilization BlastN program is carried out the search and the comparison of nucleotide sequence, find that this sequence is main capsid protein gene of TRBIV and near nucleotide sequence thereof, and this sequence and all openly dna sequence dna is all inequality, so this sequence is the specific nucleotide sequence of TRBIV.The aminoacid sequence of the main capsid protein of TRBIV that is this genes encoding shown in No. 2 sequence of sequence table.

The specific nucleotide sequence of this TRBIV also can be formed and arrangement by the Nucleotide of known this sequence, is synthesized into according to a conventional method on business-like automatic dna synthesizer.

Obtained the main capsid protein of TRBIV and near nucleotide sequence after, can be the target area with the main capsid protein gene of TRBIV just according to the specific nucleotide sequence of this TRBIV, the PCR of design and preparation TRBIV detects primer.Usually can use analysis of biological information software commonly used to design the PCR primer according to a conventional method, as Omiga 2.0 and Primer Primier 5.0 softwares.Preferably, can use Omiga 2.0 softwares.Primer MCP-TRBIVF (5 ' CGTGTTAAGATCCCCTCC 3 ') and MCP-TRBIVR (5 ' TCTCGTAAATGAGTGACACC 3 ') promptly are to use the PCR of the TRBIV that Omiga 2.0 software designs come out to detect primer, they are two oligonucleotide sequences shown in No. 5 sequence of sequence table and No. 6 sequence of sequence table, lay respectively at the 304bp-321bp and the 1084bp-1065bp place of main capsid protein gene of TRBIV and near nucleotide sequence thereof.

The PCR of this TRBIV detects primer (MCP-TRBIVF and MCP-TRBIVR) and can obtain by embodiments of the invention 4 described methods, also can be synthesized into (for example can use business-like automatic dna synthesizer to synthesize) by the Nucleotide composition of known this primer and the DNA synthetic method of arranging by routine.

After the PCR that has prepared TRBIV detected primer, the PCR that just can carry out TRBIV detected.This PCR detection method generally includes contents such as the electrophoresis detection of preparation, PCR reaction system, PCR response procedures, amplified production of reaction template and judgement as a result.

For the PCR that successfully carries out TRBIV detects, the preparation of reaction template is that extraction and the purifying of sample tissue DNA is very crucial.Usually require the reaction template purity height of preparation, do not contain the inhibition that hinders the PCR reaction.In embodiments of the invention 1, adopt the extraction and the purifying of Luo Shi diagnostic companies (Roche Diagnostics Ltd.) commercial " the high purity pcr template prepares test kit " (High Pure PCR TemplatePreparation Kit) tissue nucleic acid, as the template of PCR detection reaction, more detailed operation can be referring to this test kit specification sheets.The sample tissue DNA of purifying can be frozen in-20 ℃ of refrigerators, uses in the several months.

In the present invention, the method of operational preparation feedback template or test kit can be the method or the test kits of any purification of samples tissue DNA, they comprise (but being not limited to): the high purity pcr template of Luo Shi diagnostic companies prepares test kit, and multiple DNA purification kit and conventional phenol/chloroform extraction method homemade or import prepare the tissue DNA method.Preferably, be that the high purity pcr template of Luo Shi diagnostic companies prepares test kit.

The above-mentioned test kit that is used for the purification of samples tissue DNA can be bought and obtain.

The PCR that the present invention adopts following reaction system to carry out TRBIV detects: after having obtained the sample tissue nucleic acid solution of purifying, get the above-mentioned solution of 1-2 μ l, on ice bath, operate, join in the following PCR reaction mixture: Taq archaeal dna polymerase 1U, four kinds of each 250 μ M of dNTP, Tris-HCl (pH9.0) 10mM, KCl 40mM, MgCl ₂1.5mM each 10pmol of primer MCP-TRBIVF and MCP-TRBIVR, the cumulative volume of final reaction system are 20 μ l (seeing embodiments of the invention 5 for details).

When the PCR that carries out TRBIV detects, can adjust the cumulative volume of reaction system within the specific limits, for example the cumulative volume of reaction system can be adjusted into 10-40 μ l, but should keep in the above-mentioned reaction system each component concentrations constant.The reaction system of common 20 μ l is enough to be fit to conventional detection.

The PCR that the present invention adopts following amplification method to carry out TRBIV detects: when carrying out the PCR reaction, with the centrifugal several seconds of above reaction mixture, top covering liquid paraffin body places on the PCR instrument, moves following response procedures: 94 ℃ 5 minutes, 1 circulation; Then 94 ℃ 2 minutes, 59 ℃ 1 minute, 72 ℃ 1 minute, 30 circulations; Last 72 ℃ 7 minutes, 1 circulation (seeing embodiments of the invention 5 for details).

The present invention adopts following method to carry out the detection of amplified production and the judgement of detected result: the PCR response procedures is got 10 μ l pcr amplification products electrophoresis on 1.0% sepharose that contains 0.5 μ g/ml bromination second pyridine after finishing, and observes purpose fragment amplification situation.Testing sample if bright DNA band occurs at the 780bp place, is the TRBIV positive then behind PCR reaction and agarose gel electrophoresis, illustrates that institute's test sample product carry turbot reddish body iridovirus; Otherwise detected result negative (seeing embodiments of the invention 5 and shown in Figure 4 for details).

In order to detect TRBIV more accurately, can carry out the reaction of the positive and negative control simultaneously.Get turbot spleen tissue that TRBIV infects and the healthy turbot spleen tissue that does not infect TRBIV, the high purity pcr template of use Luo Shi diagnostic companies prepares test kit purification of samples tissue DNA, respectively as positive control sample and negative control sample.Positive control sample should occur bright DNA band at the 780bp place behind PCR reaction and agarose gel electrophoresis; The negative control sample should occur without any the DNA band behind PCR reaction and agarose gel electrophoresis.

In embodiments of the invention 6, adopt the sensitivity of following method test TRBIV PCR detection method: at first get the turbot spleen tissue sample 1g that has infected TRBIV and place the fully homogenate of 10ml phosphoric acid buffer, and with 10 times of gradient dilutions of homogenate; After preparing the PCR reaction template respectively by embodiment 1 described method, use primer MCP-TRBIVF and MCP-TRBIVR, the PCR that carries out TRBIV by above-mentioned PCR reaction system and response procedures detects; Get an amount of amplified production electrophoresis on 1.0% sepharose that contains 0.5 μ g/ml bromination second pyridine at last respectively, observe the segmental amplification situation of purpose.

Fig. 5 is the result of PCR detection method of the present invention sensitivity test, can clearly be seen that: the PCR that adopts primer MCP-TRBI VF and MCP-TRBIVR to carry out TRBIV detects 10 ^-4G, 10 ^-5G, 10 ^-6G, 10 ^-7The turbot spleen tissue sample that g has infected TRBIV all is tangible positive reaction, i.e. the sensitivity of this detection method can reach 10 ^-7The sick fish tissue of g.

Narrate technology contents of the present invention with embodiment below:

Embodiment 1: use the high purity pcr template of Luo Shi diagnostic companies to prepare test kit extraction and purification of samples tissue DNA

The concrete operations step that the high purity pcr template of employing Luo Shi diagnostic companies prepares test kit (High Pure PCRTemplate Preparation Kit) extraction and purification of samples tissue DNA is as follows:

(1) gets testing sample and organize 25-50mg (organizing 50mg) as the turbot spleen that has infected TRBIV, place the aseptic centrifuge tube of 1.5ml, shred with eye scissors, each adds the Proteinase K 40 μ l that organize lysate (TissueLysis Buffer) 200 μ l and 20mg/ml, in 55 ℃ of water-baths, digest more than the 1h, until organizing by complete digestion.

(2) add adsorption-buffering liquid (Binding Buffer) 200 μ l, thorough mixing is incubated 10min in 72 ℃ of water-baths.

(3) add Virahol 100 μ l, thorough mixing is inhaled the insolubles that goes in the centrifuge tube then; (High Pure Filter Tube) places on the collection tube (Collection Tube) with the high purity strainer tube, then remaining liq transferred in the high purity strainer tube.

(4) on table model high speed centrifuge with the centrifugal 1min of 8000rpm.

(5) discard filtrate and collection tube, the high purity strainer tube is placed on the new collection tube; In the high purity strainer tube, add inhibition and remove liquid (Inhibitor Removal Buffer) 500 μ l, with the centrifugal 1min of 8000rpm.

(6) discard filtrate and collection tube, the high purity strainer tube is placed on the new collection tube; In the high purity strainer tube, add scavenging solution (Wash Buffer) 500 μ l, with the centrifugal 1min of 8000rpm.

(7) repeating step (6) once.

(8) discard filtrate, the high purity strainer tube is placed on the same collection tube again,, fully remove residual scavenging solution with the centrifugal 10s of 16000rpm.

(9) discard collection tube, the high purity strainer tube is placed on the aseptic centrifuge tube of clean 1.5ml.

(10) elutriant (Elution Buffer) the 40 μ l of 70 ℃ of preheatings of adding in the high purity strainer tube are with the centrifugal 1min of 8000rpm.

(11) contain the purpose nucleic acid samples that is purified in the filtrate, centrifuge tube is placed-20 ℃ standby.

The above organizes lysate, adsorption-buffering liquid, Proteinase K, high purity strainer tube, inhibition to remove liquid, scavenging solution, elutriant, collection tube to prepare test kit by the high purity pcr template of Luo Shi diagnostic companies and provide.

Embodiment 2: the separation of turbot reddish body iridovirus is purified

Below centrifugally all carry out at 4 ℃.Get the sick fish spleen tissue of the turbot 1.7g that is infected by TRBIV, (be called for short PBS, it consists of: 2.68mM KCl, 1.47mM KH with phosphoric acid buffer ₂PO ₄, 0.137MNaCl, 8.06mM Na ₂HPO ₄, pH7.4) washing is 3 times, places glass homogenizer, and (1mmol/L EDTA pH8.0), is fully grinding on ice for 0.1mol/L NaCl, 10mmol/L Tris-HCl to add 15mlTEN solution.Homogenate with the centrifugal 15min of 1500 * g, is abandoned precipitation; Get supernatant liquor again with the centrifugal 30min of 5800 * g (HITACHI P50AT2-721 angle rotor), abandon precipitation; Get the centrifugal supernatant liquor that obtains for the second time,, abandon supernatant through the centrifugal 2h of 36400 * g; To precipitate with TEN solution and suspend fully, be tiled on 20-60% (w/w) the sucrose concentration gradient for preparing in advance, with the HITACHIRPS65T-704 horizontal rotor in 44000 * g ultracentrifugation 2h.Get middle portion,, in the centrifugal 30min of 52600 * g, abandon supernatant then, resolution of precipitate in 0.3ml PBS, can be obtained purer virus formulation with 10 times of dilutions of PBS.

The viral solution of getting a purifying places on the copper mesh that is covered with the formvar film, makes its absorption 3 minutes, dries then, uses 1% phospho-wolframic acid negative staining again, places at last under the JEM-1200EX type transmission electron microscope and observes, takes a picture.Fig. 3 is the photo of the purified virus that observes under the Electronic Speculum.

The preparation of main capsid protein gene of embodiment 3:TRBIV and near nucleotide sequence thereof

1. the sick fish spleen of turbot that contains TRBIV DNA is organized the extraction of nucleic acid

Get the sick fish spleen tissue of the turbot that has infected TRBIV 50mg, adopt the high purity pcr template of Luo Shi diagnostic companies to prepare extraction and purifying that sick fish spleen that test kit contains viral DNA is organized nucleic acid, the concrete operations step is with embodiment 1.

2.TRBIV the pcr amplification of DNA

To the TRBIV DNA sample that extracts, use primer iridoF and iridoR to increase.Get 1 the 200 aseptic centrifuge tube of μ l, on ice bath, operate, add following PCR reacted constituent: PCR reaction template solution 5 μ l, Taq archaeal dna polymerase 2.5U, four kinds of each 250 μ M of dNTP, Tris-HCl (pH9.0) 10mM, KCl 40mM, MgCl ₂1.5mM each 50pmol of primer iridoF and iridoR, the cumulative volume of final reaction system are 100 μ l.With the centrifugal several seconds behind the above reagent mixing, the top covers 50 μ l whiterusss, places on the PCR instrument, carries out PCR reaction by follow procedure: 94 ℃ 5 minutes, 1 circulation; Then 94 ℃ 2 minutes, 57 ℃ 1 minute, 72 ℃ 1 minute, 35 circulations; Last 72 ℃ 7 minutes, 1 circulation.Pcr amplification uses the PCR Express instrument of Britain Thermo Hybaid company to carry out.Reaction is got 10 μ l reaction product electrophoresis on 1.5% sepharose that contains 0.5 μ g/ml bromination second pyridine after finishing, and places and observes the pcr amplification result under the ultraviolet lamp.

3.TRBIV the purifying of pcr amplification product and recovery

Pcr amplification is removed mineral oil after finishing, and gets the pcr amplification product electrophoretic separation target fragment of 80 μ l TRBIV; reclaim test kit with Shanghai China Shun gel and reclaim the 1600bp target fragment; the concrete operations step following (if there are not special instructions, room temperature is centrifugal, and centrifugal speed is 9000 * g):

(1) cuts off the agar sugar that contains DNA, make it as far as possible little, put into the 1.5ml centrifuge tube and weigh.

(2) ratio that adds 300 μ l S1 liquid in every 100mg agarose adds S1 liquid, and is if agar sugar weight is supplemented to 100mg less than 100mg with distilled water, unlikely too little to guarantee the system cumulative volume.Put 50 ℃ of water-baths 10 minutes, the agar sugar is dissolved fully, put upside down mixing once in per 2 minutes.

(3) add the long-pending Virahol of 1/3 S1 liquid, mixing.50 ℃ of water-baths 1 minute, mixing.

The agar liquid glucose that (4) will dissolve moves into adsorption column, leaves standstill 2min, centrifugal 30s.Outwell the liquid in the collection tube, again adsorption column is put into same collection tube.

(5) in adsorption column, add 500 μ l W1 liquid, leave standstill 2min, centrifugal 15s.Outwell the liquid in the collection tube, again adsorption column is put into same collection tube.

(6) repeating step (5) once.

(7) centrifugal 1min.

(8) adsorption column is put into the centrifuge tube of a clean 1.5ml, central authorities add 40 μ l T1 liquid at adsorption film, and 50 ℃ of water bath heat preservations are after 5 minutes, centrifugal 3min.The target DNA that contains recovery in the centrifuge tube.

(9) getting 5 μ l, to reclaim the product electrophoresis quantitative, calculates the concentration that reclaims product.

The above S1 liquid, adsorption column, collection tube, W1 liquid, T1 liquid reclaim test kit by Shanghai China Shun gel and provide.

4.TRBIV the clone of pcr amplification product and order-checking

The clone of pcr amplification product adopts the PCR product cloning test kit of Shanghai Sangon Biological Engineering Technology And Service Co., Ltd to carry out, and the concrete operations step is as follows:

(1) ligation

A. in 10 μ l ligation systems of a standard, target fragment=1: 10), the T4DNA ligase enzyme of 1 μ l 10 * connection damping fluid, 1 μ lPEG4000 and 1 μ l (carrier:, all the other waters are supplied to add the pcr amplification product of 50ng pUCm-T carrier, 0.2pmol.

B. react by following system and undertaken:

Pcr amplification product aseptic double-distilled water T4DNA ligase enzyme behind 10 * connection damping fluid PEG4000 pUCm-T carrier purifying	1μl 1μl 1μl 4μl 2μl 1μl
		Cumulative volume	10μl

Attention: general last adding T4DNA ligase enzyme.

C.16-23 ℃ connection 1h is to spending the night.

(2) transform

A. get 100 μ l E.coliDH5 α competent cells, place on ice, gently cell is evenly suspended after thawing fully.

B. add 5 μ l and connect liquid, mixing gently.Place 30min on ice.

C.42 ℃ water-bath heat shock 35s places 2min on ice.

D. add 400 μ l SOC substratum (2% Tryptones, 0.5% yeast extract, 0.05%NaCl, 2.5mmol/L KCl, 20mmol/L MgCl ₂, 20mmol/L glucose, pH 7.0), 37 ℃, 1h is cultivated in the 200-250rpm concussion.

E. the centrifugal 5min of 4000rpm under the room temperature sops up 400 μ l supernatant liquors with the micropipet suction nozzle, with remaining substratum with cell suspension.

F. bacterium is coated in advance SOB flat board (2% Tryptones with the penbritin that contains 100 μ g/ml of 20 μ l 100mmol/L IPTG and 100 μ l 20mg/mlX-gal coating, 0.5% yeast extract, 1.5% agar, 0.05%NaCl, 2.5mmol/L KCl, 20mmol/L MgCl ₂, pH 7.0) on.

G. dull and stereotyped at the liquid of 37 ℃ of forwards placement 1h with hyperabsorption, be inverted overnight incubation then.

(3) the blue hickie screening of transformant

A. after exogenous dna fragment is inserted among the pUCm-T, because the existence of foreign DNA has changed the coding of LacZ gene, thereby influenced the segmental activity of its product beta-galactosidase enzymes α, so recombinant clone is rendered as white on the IPTG/X-gal flat board, but not recombinant clone is blue.

B. be chosen in the white colony of growing on the I PTG/X-gal flat board, with toothpick choose to the 5ml LB liquid nutrient medium that contains 100 μ g/ml penbritins (1% Tryptones, 0.5% yeast extract, 1%NaCl) in, 37 ℃ of overnight incubation.

(4) enzyme of transformant is cut evaluation

A. each bacterium liquid of overnight incubation is done following processing respectively: get 1.5ml bacterium liquid and place aseptic Eppendorf tube, 4 ℃ of temporary usefulness for order-checking; Get 1.0ml bacterium liquid and place aseptic Eppendorf tube, add the abundant mixing of the aseptic glycerine of 200 μ l, be frozen in-70 ℃ of guarantors and plant; Getting 1.5ml bacterium liquid places aseptic Eppendorf tube to use for the extracting plasmid.

B. prepare plasmid on a small scale with alkaline lysis.The centrifugal 30s of 12000 * g collects thalline, adds the ice-cold solution I of 100 μ l (25mmol/L Tris-HCl, pH8.0,10mmol/L EDTA, 50mmol/L glucose), concuss.(0.2mol/LNaOH 1%SDS), puts upside down centrifuge tube 5 times fast, places on ice to add the new solution II of preparing of 200 μ l again.Add the ice-cold solution III of 150 μ l (3mol/L potassium acetate, 11.5% Glacial acetic acid) again, gentle concussion makes its abundant mixing, places 5min on ice, afterwards the centrifugal 5min of 12000 * g.Supernatant is changed in the new plastic centrifuge tube, add equal amounts of phenolic: chloroform (1: 1), concussion mixing, the centrifugal 2min of 12000 * g.Supernatant is changed in the new plastic centrifuge tube, add 2 times of volume of ethanol in precipitation at room temperature DNA, concussion mixes, and room temperature is placed 2min.In 4 ℃ of centrifugal 5min of 12000 * g, remove supernatant liquor, precipitate in 4 ℃ of washing DNA with 1ml 70% ethanol, at air drying 10min.At last with resolution of precipitate 50 μ l contain the Pancreatic RNase (20 μ g/ml) of no DNA enzyme the TE damping fluid (10mmol/L Tris-HCl, 1mmol/L EDTA, pH7.4) in.C. using restriction enzyme Pst I that plasmid purification is carried out enzyme by following reaction system cuts:

The plasmid aseptic double-distilled water of Pst I 10 * H damping fluid purifying	1μl 2μl 3μl 14μl
		Cumulative volume	20μl

D.37 a ℃ enzyme is cut 1.5h.

E. after endonuclease reaction finishes, in reaction tubes, add 10 * sample-loading buffer (EDTA 50mM, 60% glycerine, the blue FF of 0.1% dimethylbenzene nitrile, 0.1% tetrabromophenol sulfonphthalein) of 2 μ l, stopped reaction.Respectively get 10 μ l reaction product electrophoresis on 1.5% sepharose that contains 0.5 μ g/ml bromination second pyridine, place under the ultraviolet lamp and observe, pick out to contain and insert segmental clone about 1600bp.

(5) inserting fragments sequence measures and analyzes

To contain the segmental transformed bacteria liquid of purpose and offer Shanghai rich inferior biotechnology company limited, use ABIPRISM TM 377 type dna sequencing instrument with M13 universal primer and T7 promoter primer to the two-way order-checking of PCR product and carry out sequence assembly, obtain the TRBIV nucleotide sequence of 1581bp, shown in Fig. 1 and No. 1 sequence of sequence table.This TRBIV nucleotide sequence is input among the public database GenBank, utilization BlastN program is carried out the search and the comparison of dna sequence dna, find that this sequence is main capsid protein gene of TRBIV and near nucleotide sequence thereof, and this sequence and all openly nucleotide sequence is all inequality, be the specific nucleotide sequence of TRBIV.

The above pUCm-T carrier, 10 * connection damping fluid, PEG4000, T4 dna ligase provide by the PCR product cloning test kit of Shanghai Sangon Biological Engineering Technology And Service Co., Ltd; Restriction enzyme Pst I, 10 * H damping fluid are available from precious biotechnology (Dalian) company limited.

The preparation of embodiment 4:PCR primer MCP-TRBIVF and MCP-TRBIVR

Obtain the main capsid protein gene of TRBIV and near the basis of nucleotide sequence on, use this sequence of Omiga 2.0 software analysis, drawing the Nucleotide composition of MCP-TRBIVF and MCP-TRBIVR and arranging (the black matrix part of band underscore as shown in Figure 1, i.e. 304bp-321bp and 1084bp-1065bp place) is the best PCR primer sequence that is used for the TRBIV amplification.Form and arrangement according to the Nucleotide of MCP-TRB IVF and MCP-TRBIVR, on business-like automatic dna synthesizer, carry out chemosynthesis, can obtain the nucleotide sequence shown in No. 5 sequence of sequence table and No. 6 sequence of sequence table.

The PCR detection method of embodiment 5:TRBIV

1.PCR the preparation of template

Get fish each 25-50mg of sample of body tissue to be measured, use the high purity pcr template of Luo Shi diagnostic companies to prepare test kit extraction and purification of samples DNA (with embodiment 1).

2.PCR reaction and electrophoresis detection

Get 4 the 200 aseptic centrifuge tubes of μ l, on ice bath, operate, be formulated as follows the PCR reaction system: each sample dna solution 1-2 μ l, Taq archaeal dna polymerase 1U, four kinds of each 250 μ M of dNTP, Tris-HCl (pH 9.0) 10mM, KCl 40mM, MgCl ₂1.5mM each 10pmol of primer MCP-TRBIVF and MCP-TRBIVR, the cumulative volume of final reaction system are 20 μ l.With the centrifugal several seconds behind the above reagent mixing, the top covers 50 μ l whiterusss, places on the PCR instrument, moves following PCR response procedures: 94 ℃ 5 minutes, 1 circulation; Then 94 ℃ 2 minutes, 59 ℃ 1 minute, 72 ℃ 1 minute, 30 circulations; Last 72 ℃ 7 minutes, 1 circulation.After the EP (end of program), remove mineral oil, add 2 μ l, 10 * sample-loading buffer (EDTA 50mM, 60% glycerine, the blue FF of 0.1% dimethylbenzene nitrile, 0.1% tetrabromophenol sulfonphthalein) in each pipe, mixing.Get 10 μ l mixture point samples electrophoresis on 1% sepharose that contains 0.5 μ g/ml bromination second pyridine, electrophoresis result as shown in Figure 4.

The result of Fig. 4 clearly illustrates: the PCR that adopts primer MCP-TRBIVF and MCP-TRBIVR to carry out TRBIV detects, the turbot spleen and the renal tissue that have infected TRBIV all are positive, and the healthy turbot spleen tissue and the lymphocystis disease virus (another kind of fish iridovirus) that do not infect TRBIV are negative reaction, illustrate that this detection method has specificity, can detect TRBIV clear, accurately and rapidly.

The sensitivity determination that embodiment 6:TRBIV PCR detects

Get the turbot spleen tissue sample 1g that has infected TRBIV, place clean glass homogenizer, add 10ml phosphoric acid buffer (2.68mM KCl, 1.47mM KH ₂PO ₄, 0.137M NaCl, 8.06mM Na ₂HPO ₄, pH 7.4), 10 times of gradient dilutions of phosphoric acid buffer are used in fully homogenate again on trash ice.The healthy turbot spleen tissue 25-50mg that gets homogenate and each gradient dilution liquid 200 μ l then and do not infected by TRBIV, the high purity pcr template of use Luo Shi diagnostic companies prepares test kit and extracts respectively with purification of samples DNA (with embodiment 1).

Get 7 the 200 aseptic centrifuge tubes of μ l, on ice bath, operate, be formulated as follows the PCR reaction system: each sample dna solution 2 μ l, Taq archaeal dna polymerase 1U, four kinds of each 250 μ M of dNTP, Tris-HCl (pH 9.0) 10mM, KCl 40mM, MgCl ₂1.5mM each 10pmol of primer MCP-TRBIVF and MCP-TRBIVR, the cumulative volume of final reaction system are 20 μ l.With the centrifugal several seconds behind the above reagent mixing, the top covers 50 μ l whiterusss, places on the PCR instrument, moves following PCR response procedures: 94 ℃ 5 minutes, 1 circulation; Then 94 ℃ 2 minutes, 59 ℃ 1 minute, 72 ℃ 1 minute, 30 circulations; Last 72 ℃ 7 minutes, 1 circulation.After the EP (end of program), remove mineral oil, add 2 μ l sample solutions (EDTA 50mM, 60% glycerine, the blue FF of 0.1% dimethylbenzene nitrile, 0.1% tetrabromophenol sulfonphthalein) in each pipe, mixing.Get 10 μ l mixture point samples electrophoresis on 1% sepharose that contains 0.5 μ g/ml bromination second pyridine, electrophoresis result as shown in Figure 5.

Can clearly be seen that from the result of Fig. 5: the PCR that adopts primer MCP-TRBIVF and MCP-TRBIVR to carry out TRBIV detects 10 ^-4G, 10 ^-5G, 10 ^-6G, 10 ^-7The turbot spleen tissue sample that g has infected TRBIV all is tangible positive reaction; And 10 ^-3The healthy turbot spleen tissue sample that g the does not infect TRBIV reaction that is negative.Above result shows that this detection method can be from being low to moderate 10 ^-7Detect the existence of TRBIV in the sick fish spleen tissue of g, have high sensitivity.

Sequence table

＜110〉Inst of Huanghai Sea Marine Products, Chinese Academy of Aquatic Product Science

＜120〉turbot reddish body iridovirus virus polymerase chain reaction detection method

<160>6

<170>PatentIn version 3.1

<210>1

<211>1581

<212>DNA

＜213〉turbot reddish body iridovirus (turbot reddish body iridovirus)

<220>

<221>CDS

<222>(58)..(1419)

<223>

<400>1

gtgcaggttt ccagaagaaa aacgaggctg gtcatatata aaagtatcac cgtcatc 57

atg tct gca atc tta ggt gcg aac gta acc agt ggg ttc atc gac atc 105

Met Ser Ala Ile Leu Gly Ala Asn Val Thr Ser Gly Phe Ile Asp Ile

1 5 10 15

tcc gct ttc gat gcg atg gag acc cac ttg tac ggc ggc gac aat gcc 153

Ser Ala Phe Asp Ala Met Glu Thr His Leu Tyr Gly Gly Asp Asn Ala

20 25 30

gtg aca tac ttt gcc cgc gag acc gtg cgt agt tcc tgg tac agc aaa 201

Val Thr Tyr Phe Ala Arg Glu Thr Val Arg Ser Ser Trp Tyr Ser Lys

35 40 45

cta ccc gtc acc ctg tca aaa cag act ggc cat gcc aat ttc ggc cag 249

Leu Pro Val Thr Leu Ser Lys Gln Thr Gly His Ala Asn Phe Gly Gln

50 55 60

gag ttt agt gtg acg gtg gcc agg ggt ggc gac tac ctc att aat gtg 297

Glu Phe Ser Val Thr Val Ala Arg Gly Gly Asp Tyr Leu Ie Asn Val

65 70 75 80

tgg ctg cgt gtt aag atc ccc tcc atc aca tcc agc aag gaa aac agc 345

Trp Leu Arg Val Lys Ile Pro Ser Ile Thr Ser Ser Lys Glu Asn Ser

85 90 95

tac att cgc tgg tgt gat aat ctg atg cac aat ctg gtt gag gag gtg 393

Tyr Ile Arg Trp Cys Asp Asn Leu Met His Asn Leu Val Glu Glu Val

100 105 110

tcg gtg tca ttt aac gac ctg gtg gca cag acc ctg acc agc gag ttc 441

Ser Val Ser Phe Asn Asp Leu Val Ala Gln Thr Leu Thr Ser Glu Phe

115 120 125

ctc gac ttt tgg aac gcc tgc atg atg ccc ggc agc aaa cag tct ggc 489

Leu Asp Phe Trp Asn Ala Cys Met Met Pro Gly Ser Lys Gln Ser Gly

130 135 140

tat aac aag atg att ggc atg cgc agc ggc ctg gtc tcc ggt atc acc 537

Tyr Asn Lys Met Ile Gly Met Arg Ser Gly Leu Val Ser Gly Ile Thr

145 150 155 160

aac ggt cac act atg cct gct acc tac ctc aat ttg ccc atc ccc ctc 585

Asn Gly His Thr Met Pro Ala Thr Tyr Leu Asn Leu Pro Ile Pro Leu

165 170 175

ttc ttc acc cgc gac aca ggc ctt gca ttg ccc acc gtg tct ctg ccg 633

Phe Phe Thr Arg Asp Thr Gly Leu Ala Leu Pro Thr Val Ser Leu Pro

180 185 190

tac aac gag gtg cgc atc cac ttc aag ctg cgg cgc tgg gag gac ctg 681

Tyr Asn Glu Val Arg Ile His Phe Lys Leu Arg Arg Trp Glu Asp Leu

195 200 205

ctc atc agc cag agc acc cag gcc gac atg gcc atc tcg acc gtc acc 729

Leu Ile Ser Gln Ser Thr Gln Ala Asp Met Ala Ile Ser Thr Val Thr

210 215 220

ctg gcc aac att agc aat gta gca ccc gcg ttg acc aac gtt tcc gtg 777

Leu Ala Asn Ile Ser Asn Val Ala Pro Ala Leu Thr Asn Val Ser Val

225 230 235 240

atg ggc acc tac gct gtg ctg aca agt gag gag cgc gag gtg gtg gcc 825

Met Gly Thr Tyr Ala Val Leu Thr Ser Glu Glu Arg Glu Val Val Ala

245 250 255

cag tct agc cgt agc atg ctc att gaa cag tgc cag gtg gcg cct cgt 873

Gln Ser Ser Arg Ser Met Leu Ile Glu Gln Cys Gln Val Ala Pro Arg

260 265 270

gtg ccc gtc aca ccc gca gac aat tcc ttg gtg cat ctg gac ctc agg 921

Val Pro Val Thr Pro Ala Asp Asn Ser Leu Val His Leu Asp Leu Arg

275 280 285

ttc agt cat ccc gtc aag gcc ttg ttc ttt gca gta aag aac gtc acc 969

Phe Ser His Pro Val Lys Ala Leu Phe Phe Ala Val Lys Asn Val Thr

290 295 300

cac cgc aac gtg caa agc aat tac acc gcg gcc agt ccc gtg tat gtc l017

His Arg Asn Val Gln Ser Asn Tyr Thr Ala Ala Ser Pro Val Tyr Val

305 310 315 320

aac aac aag gtc aat ctg cct ttg ctg gcc acc aat ccc ctg tcc gag 1065

Asn Asn Lys Val Asn Leu Pro Leu Leu Ala Thr Asn Pro Leu Ser Glu

325 330 335

gtg tca ctc att tac gag aac acc cct cgg ctc cac cag atg gga gta 1113

Val Ser Leu Ile Tyr Glu Asn Thr Pro Arg Leu His Gln Met Gly Val

340 345 350

gac tac ttc aca tcc gtc gac ccc tac tac ttt gcg ccc agc atg cct 1161

Asp Tyr Phe Thr Ser Val Asp Pro Tyr Tyr Phe Ala Pro Ser Met Pro

355 360 365

gag atg gac ggt gtt atg acc tac tgc tat acc ctg gac atg ggc aat 1209

Glu Met Asp Gly Val Met Thr Tyr Cys Tyr Thr Leu Asp Met Gly Asn

370 375 380

atc aac ccc atg ggc tcg acc aac tac ggc cgc ctg tcc aac gtc acc 1257

Ile Asn Pro Met Gly Ser Thr Asn Tyr Gly Arg Leu Ser Asn Val Thr

385 390 395 400

ctg tca tgt aag gtg tcg gac aac gcc aag aaa aca gca gcg ggc ggc 1305

Leu Ser Cys Lys Val Ser Asp Asn Ala Lys Lys Thr Ala Ala Gly Gly

405 410 415

gga acc aac ggc agc ggc tac acg gtc gcc caa aag ttt gaa ctg gtc 1353

Gly Thr Asn Gly Ser Gly Tyr Thr Val Ala Gln Lys Phe Glu Leu Val

420 425 430

gtt att gca gtc aac cac aac atc atg aag att gct gac ggc gct gca 1401

Val Ile Ala Val Asn His Asn Ile Met Lys Ile Ala Asp Gly Ala Ala

435 440 445

ggc ttc cct atc ctg taa gcaatggact gcccagtgtg tctggcagcc 1449

Gly Phe Pro Ile Leu

450

atgtcggagc cgtatgtatt aaattgcggc catagcgtat gcaaggcatg ctgtgataag 1509

cttgggccca cgtgttgtgt gtgccgcact gtcatcacaa gcagagccac caactatgcg 1569

ttacgtacca tg 1581

<210>2

<211>453

<212>PRT

＜213〉turbot reddish body iridovirus (turbot reddish body iridovirus)

<400>2

Met Ser Ala Ile Leu Gly Ala Asn Val Thr Ser Gly Phe Ile Asp Ile

1 5 10 15

Ser Ala Phe Asp Ala Met Glu Thr His Leu Tyr Gly Gly Asp Asn Ala

20 25 30

Val Thr Tyr Phe Ala Arg Glu Thr Val Arg Ser Ser Trp Tyr Ser Lys

35 40 45

Leu Pro Val Thr Leu Ser Lys Gln Thr Gly His Ala Asn Phe Gly Gln

50 55 60

Glu Phe Ser Val Thr Val Ala Arg Gly Gly Asp Tyr Leu Ile Asn Val

65 70 75 80

Trp Leu Arg Val Lys Ile Pro Ser Ile Thr Ser Ser Lys Glu Asn Ser

85 90 95

Tyr Ile Arg Trp Cys Asp Asn Leu Met His Asn Leu Val Glu Glu Val

100 105 110

Ser Val Ser Phe Asn Asp Leu Val Ala Gln Thr Leu Thr Ser Glu Phe

115 120 125

Leu Asp Phe Trp Asn Ala Cys Met Met Pro Gly Ser Lys Gln Ser Gly

130 135 140

Tyr Asn Lys Met Ile Gly Met Arg Ser Gly Leu Val Ser Gly Ile Thr

145 150 155 160

Asn Gly His Thr Met Pro Ala Thr Tyr Leu Asn Leu Pro Ile Pro Leu

165 170 175

Phe Phe Thr Arg Asp Thr Gly Leu Ala Leu Pro Thr Val Ser Leu Pro

180 185 190

Tyr Asn Glu Val Arg Ile His Phe Lys Leu Arg Arg Trp Glu Asp Leu

195 200 205

Leu Ile Ser Gln Ser Thr Gln Ala Asp Met Ala Ile Ser Thr Val Thr

210 215 220

Leu Ala Asn Ile Ser Asn Val Ala Pro Ala Leu Thr Asn Val Ser Val

225 230 235 240

Met Gly Thr Tyr Ala Val Leu Thr Ser Glu Glu Arg Glu Val Val Ala

245 250 255

Gln Ser Ser Arg Ser Met Leu Ile Glu Gln Cys Gln Val Ala Pro Arg

260 265 270

Val Pro Val Thr Pro Ala Asp Asn Ser Leu Val His Leu Asp Leu Arg

275 280 285

Phe Ser His Pro Val Lys Ala Leu Phe Phe Ala Val Lys Asn Val Thr

290 295 300

His Arg Asn Val Gln Ser Asn Tyr Thr Ala Ala Ser Pro Val Tyr Val

305 310 315 320

Asn Asn Lys Val Asn Leu Pro Leu Leu Ala Thr Asn Pro Leu Ser Glu

325 330 335

Val Ser Leu Ile Tyr Glu Asn Thr Pro Arg Leu His Gln Met Gly Val

340 345 350

Asp Tyr Phe Thr Ser Val Asp Pro Tyr Tyr Phe Ala Pro Ser Met Pro

355 360 365

Glu Met Asp Gly Val Met Thr Tyr Cys Tyr Thr Leu Asp Met Gly Asn

370 375 380

Ile Asn Pro Met Gly Ser Thr Asn Tyr Gly Arg Leu Ser Asn Val Thr

385 390 395 400

Leu Ser Cys Lys Val Ser Asp Asn Ala Lys Lys Thr Ala Ala Gly Gly

405 410 415

Gly Thr Asn Gly Ser Gly Tyr Thr Val Ala Gln Lys Phe Glu Leu Val

420 425 430

Val Ile Ala Val Asn His Asn Ile Met Lys Ile Ala Asp Gly Ala Ala

435 440 445

Gly Phe Pro Ile Leu

450

<210>3

<211>18

<212>DNA

＜213〉turbot reddish body iridovirus (turbot reddish body iridovirus)

<400>3

gtgcaggttt ccagaaga 18

<210>4

<211>19

<212>DNA

＜213〉turbot reddish body iridovirus (turbot reddish body iridovirus)

<400>4

catggtacgt aacgcatag 19

<210>5

<211>18

<212>DNA

＜213〉turbot reddish body iridovirus (turbot reddish body iridovirus)

<400>5

cgtgttaaga tcccctcc 18

<210>6

<211>20

<212>DNA

＜213〉turbot reddish body iridovirus (turbot reddish body iridovirus)

<400>6

tctcgtaaat gagtgacacc 20

Claims (4)

1. turbot reddish body iridovirus virus polymerase chain reaction detection method is characterized in that its method comprises following three parts:

1). provide one section to be used to the specificity nucleotide sequence of differentiating that this is viral, this sequence is the main capsid protein gene of turbot reddish body iridovirus and near nucleotide sequence thereof, is the linear dsdna sequence that one section total length is 1581 Nucleotide; One of 1419 nucleotide coding of the 58th Nucleotide to the of this sequence contain 453 amino acid whose protein, main capsid protein that promptly should virus; This specificity nucleotides sequence is classified as:

GTGCAGGTTT CCAGAAGAAA AACGAGGCTG GTCATATATA AAAGTATCAC CGTCATCATG

TCTGCAATCT TAGGTGCGAA CGTAACCAGT GGGTTCATCG ACATCTCCGC TTTCGATGCG

ATGGAGACCC ACTTGTACGG CGGCGACAAT GCCGTGACAT ACTTTGCCCG CGAGACCGTG

CGTAGTTCCT GGTACAGCAA ACTACCCGTC ACCCTGTCAA AACAGACTGG CCATGCCAAT

TTCGGCCAGG AGTTTAGTGT GACGGTGGCC AGGGGTGGCG ACTACCTCAT TAATGTGTGG

CTGCGTGTTA AGATCCCCTC CATCACATCC AGCAAGGAAA ACAGCTACAT TCGCTGGTGT

GATAATCTGA TGCACAATCT GGTTGAGGAG GTGTCGGTGT CATTTAACGA CCTGGTGGCA

CAGACCCTGA CCAGCGAGTT CCTCGACTTT TGGAACGCCT GCATGATGCC CGGCAGCAAA

CAGTCTGGCT ATAACAAGAT GATTGGCATG CGCAGCGGCC TGGTCTCCGG TATCACCAAC

GGTCACACTA TGCCTGCTAC CTACCTCAAT TTGCCCATCC CCCTCTTCTT CACCCGCGAC

ACAGGCCTTG CATTGCCCAC CGTGTCTCTG CCGTACAACG AGGTGCGCAT CCACTTCAAG

CTGCGGCGCT GGGAGGACCT GCTCATCAGC CAGAGCACCC AGGCCGACAT GGCCATCTCG

ACCGTCACCC TGGCCAACAT TAGCAATGTA GCACCCGCGT TGACCAACGT TTCCGTGATG

GGCACCTACG CTGTGCTGAC AAGTGAGGAG CGCGAGGTGG TGGCCCAGTC TAGCCGTAGC

ATGCTCATTG AACAGTGCCA GGTGGCGCCT CGTGTGCCCG TCACACCCGC AGACAATTCC

TTGGTGCATC TGGACCTCAG GTTCAGTCAT CCCGTCAAGG CCTTGTTCTT TGCAGTAAAG

AACGTCACCC ACCGCAACGT GCAAAGCAAT TACACCGCGG CCAGTCCCGT GTATGTCAAC

AACAAGGTCA ATCTGCCTTT GCTGGCCACC AATCCCCTGT CCGAGGTGTC ACTCATTTAC

GAGAACACCC CTCGGCTCCA CCAGATGGGA GTAGACTACT TCACATCCGT CGACCCCTAC

TACTTTGCGC CCAGCATGCC TGAGATGGAC GGTGTTATGA CCTACTGCTA TACCCTGGAC

ATGGGCAATA TCAACCCCAT GGGCTCGACC AACTACGGCC GCCTGTCCAA CGTCACCCTG

TCATGTAAGG TGTCGGACAA CGCCAAGAAA ACAGCAGCGG GCGGCGGAAC CAACGGCAGC

GGCTACACGG TCGCCCAAAA GTTTGAACTG GTCGTTATTG CAGTCAACCA CAACATCATG

AAGATTGCTG ACGGCGCTGC AGGCTTCCCT ATCCTGTAAG CAATGGACTG CCCAGTGTGT

CTGGCAGCCA TGTCGGAGCC GTATGTATTA AATTGCGGCC ATAGCGTATG CAAGGCATGC

TGTGATAAGC TTGGGCCCAC GTGTTGTGTG TGCCGCACTG TCATCACAAG CAGAGCCACC

AACTATGCGT TACGTACCAT G；

2). a pair of this viral PCR primer sequence that is used to detect is provided, and promptly length is respectively two linear ssdna sequences of 18 and 20 Nucleotide, called after MCP-TRBIVF and MCP-TRBIVR; MCP-TRBIVF and MCP-TRBIVR are that the nucleotide sequence at the 304bp-321bp of the main capsid protein gene of 1581bp and near nucleotide fragments thereof and 1084bp-1065bp place is identical or complementary with this viral total length respectively, and its nucleotide sequence is respectively: MCP-TRBIVF:5 ' CGTGTTAAGATCCCCTCC 3 ' and MCP-TRBIVR:5 ' TCTCGTAAATGAGTGACACC 3 ';

3). a kind of PCR detection method that should virus is provided, and promptly preparation feedback template from testing sample is at first prepared the PCR reaction system then, utilizes the PCR response procedures that reaction template is increased again, carries out the result by the electrophoresis detection amplified production at last and judges.

2, turbot reddish body iridovirus virus polymerase chain reaction detection method according to claim 1 is characterized in that described PCR reaction system is: template DNA solution 1-2 μ l, Taq archaeal dna polymerase 1U, four kinds of each 250 μ M of dNTP, the Tris-HCl 10mM of pH 9.0, KCl 40mM, MgCl ₂1.5mM each 10pmol of primer MCP-TRBIVF and MCP-TRBIVR, the cumulative volume of final reaction system are 20 μ l.

3, turbot reddish body iridovirus virus polymerase chain reaction detection method according to claim 1 is characterized in that described PCR response procedures is: 94 ℃ 5 minutes, 1 circulation; Then 94 ℃ 2 minutes, 59 ℃ 1 minute, 72 ℃ 1 minute, 30 circulations; Last 72 ℃ 7 minutes, 1 circulation.

4, turbot reddish body iridovirus virus polymerase chain reaction detection method according to claim 1, it is characterized in that described determination methods as a result is: with pcr amplification product electrophoresis in the sepharose that contains the pyridine of bromination second, if the specificity target stripe of 780 base pairs, then the turbot reddish body iridovirus detected result of this sample is positive.

Images