CN1670220A - Primer and probe series for real time fluorescent RT-PCR detection of bird flu of H7 subtype - Google Patents
Primer and probe series for real time fluorescent RT-PCR detection of bird flu of H7 subtype Download PDFInfo
- Publication number
- CN1670220A CN1670220A CN 200410027813 CN200410027813A CN1670220A CN 1670220 A CN1670220 A CN 1670220A CN 200410027813 CN200410027813 CN 200410027813 CN 200410027813 A CN200410027813 A CN 200410027813A CN 1670220 A CN1670220 A CN 1670220A
- Authority
- CN
- China
- Prior art keywords
- sequence
- primer
- probe
- hypotype
- extreme direction
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
This invention relates to a RT-PCR augmenting primer sequence suitable for high-pathogenicity fowl-influenza H7 hypotype nucleotide fragment and probe sequence, wherein, the primer sequence comprises primer pairs composed by upper primer H7N2pf1292 with its sequence being CGTGTCCAATTAATGACATTTCC and lower primer H7N2pr1202 with its being ATCACAGGCAAATTGAATCGT, complementary sequence GCACAGGTTAATTACTGTAAAGG of the upper one and that GAGGTGTGTGTCGTGTTA of the lower one, the primer sequence and its complementary sequence attained in the area coverage of extending to 10 bases from the upper primer position in 3' end direction and 10 bases from the lower primer position in 3' end direction; the probe sequence comprises sequence TTTGAGCTGATAGACAATGA and its complementary GAGGTGTGTGTCGTGTTA of the probe H7N2pb1247, and the probe sequence and complementary one attained in the area of extending to 10 bases from the said probe in 3' end direction and 10 bases in 5' end direction.
Description
Technical field
The present invention relates to the RT-PCR amplimer and the probe sequence of high pathogenic avian influenza H7 hypotype nucleotide fragment.
Background technology
Bird flu (Avian Influenza, AI) also be European checken pest or fowl plague, it is a kind of acute height contagious disease that causes by A type influenza virus, it is internationally recognized a kind of crushing disease, can give the people through pig or other zoochory, therefore has crucial ecology and public hygienics meaning, especially high pathogenic avian influenza are classified as the category-A transmissible disease by OIE.
Find that in recent years bird flu is the serious harm bird not only, and the harm Mammals, especially can infected person and causing death, greatly threatening human public health security.Avian influenza virus belongs to RNA viruses, and is the same with all RNA viruses, because RNA polymerase lacks correct functioning, higher error rate when transcribing, genome is arranged, and its genome is segmented, very easily reset, so avian influenza virus has the variability of height.The gene fragment of the gene fragment of coding glycoprotein h A and NA and coding non-structural protein NS 1 and NS2 exist than big-difference between different influenza strains, and other gene is conservative relatively in the avian influenza virus genome in its genome.Discover that the virulence of avian influenza virus depends primarily on host and viruses interaction relation, and the different genes fragment of virus also has different effects aspect pathogenic in that decision is viral, what wherein play a major role is the proteic gene of coding HA.By analysis, comparison to a large amount of avian influenza virus HA nucleotide sequences and aminoacid sequence, find the virulence of the aminoacid sequence decision avian influenza virus of HA cracking site, the HA cracking site of high pathogenic avian influenza has 6 successive basic aminoacidss, and the low pathogenicity bird flu has 2 basic aminoacidss.
The real-time fluorescence PCR technology is the high-new detection technique with great development potentiality, has obtained widespread use in a lot of fields, therefore the difficult problem that can utilize its solution many serotypes of avian influenza virus and high variability to cause to clinical detection.The real-time fluorescence quantitative PCR technology was released first in 1996, this technology has not only realized the leap of PCR method from qualitative to quantitative, and compare with conventional PCR, it has that specificity is stronger, sense cycle is shorter, effectively solve the PCR pollution problem, the level of automation advantages of higher, is used widely at present.
(Reverse Transcription Polymerase Chain Reaction is earlier the RNA reverse transcription to be become cDNA RT-PCR) to conventional inverse transcription polymerase chain reaction, utilizes archaeal dna polymerase in the pulsating technology of external rapid amplifying target DNA then.The fluorescence real-time RT-PCR is on the basis of common RT-PCR, adds a specific fluorescent probe again in a pair of primer of adding in amplification reaction system, and this probe is the oligonucleotide of two ends difference mark fluorescent reporter group and fluorescent quenching group.When probe is complete, the reporter group fluorescent signal emitted is absorbed by quenching group, thereby detect the fluorescent signal that is sent less than this fluorescence probe group, and when pcr amplification, 5 ' end 5 prime excision enzyme activity of Taq enzyme is cut degraded with the fluorescent probe enzyme of specific combination on the purpose amplified fragments, the fluorescence report group is free in the reaction system, the shielding effect that has broken away from the fluorescent quenching group, can detect the fluorescent signal of fluorescence report group this moment, and the variation of fluorescent signal amount is directly proportional with the amplified production amount.
Because avian influenza virus has a plurality of hypotypes and variation is fast, both at home and abroad that a situation arises is complicated again for epidemic situation, so press for set up a kind of special sensitivity, accurately and reliably, fast and convenient high pathogenic avian influenza detection method, be used for rapid detection main popular Highly Pathogenic Avian Influenza Virus (HPAIV) hypotype both at home and abroad, thereby satisfy the needs of importing and exporting inspection and quarantine and eqpidemic disease monitoring.
Summary of the invention
The purpose of this invention is to provide the PCR primer and the probe sequence that are used to detect avian influenza virus H7 hypotype.
The present invention is by the following technical solutions: analyze the bird flu H7 subtype gene group sequence that all have been reported, design primer and fluorescent probe respectively.On the basis of conventional RT-PCR detection technique, the nucleotide probe of two fluorophors that added a mark, fluorescence report group (R) is marked at 5 ' end of probe, fluorescent quenching group (Q) is marked at 3 ' end of probe, both constitute the energy transfer organization, and promptly fluorescence report group institute emitted fluorescence can be absorbed by the fluorescent quenching group, when the two is far away apart from change, restraining effect weakens, and the reporter group fluorescent signal strengthens.In the amplified reaction process, probe is hybridized with the purpose amplified fragments on the template, because having 5 ', the Taq enzyme holds the 3 ' 5 prime excision enzyme activity of holding, in the amplification extension stage probe is cut off, the restraining effect of fluorescent quenching group (Q) disappears, the reporter group fluorescent signal strengthens, thereby carries out the detection of bird flu H7 hypotype.Real-time fluorescence RT-PCR detection reaction principle is seen Fig. 1.
The amplification oligonucleotide that is used to detect bird flu H7 hypotype comprises with primer sequence and probe sequence:
1. be that CGTGTCCAATTAATGACATTTCC and complementary sequence are GCACAGGTTAATTACTGTAAAGG by upstream primer H7N2pf1292 sequence, downstream primer H7N2pr1202 sequence is that ATCACAGGCAAATTGAATCGT and complementary sequence are that the primer formed of TAGTGTCCGTTTAACTTAGCA is right, and 10 bases are extended to 5 ' extreme direction, primer sequence and complementary sequence that the downstream primer position is extended 10 bases, obtained to 3 ' extreme direction in the right upstream primer position of this primer in 5 ' extreme direction extends 10 base zone scopes; Probe H7N2pb1247 sequence is that TTTGAGCTGATAGACAATGA and complementary sequence are AAACTCGACTATCTGTTACT, and this probe probe sequence from 10 base zone scopes to 3 ' extreme direction and the complementary sequence that extend 10 bases and obtain in 5 ' extreme direction extends.
2. be that CTCATTCCTGTAGCCARAAGGAG and complementary sequence are GAGTAAGGACATCGGTYTTCCTC by upstream primer H7N2pf1010 sequence, downstream primer H7N2pr828 sequence is that CCCCTGACAGGGCAAGTTT and complementary sequence are that the primer formed of GGGGACTGTCCCGTTCAAA is right, and 10 bases are extended to 5 ' extreme direction, primer sequence and complementary sequence that the downstream primer position is extended 10 bases, obtained to 3 ' extreme direction in the right upstream primer position of this primer in 5 ' extreme direction extends 10 base zone scopes; Probe H7N2pb945 sequence is that 5TGCCATTCCAAAACAT and complementary sequence are ACGGTAAGGTTTTGTA, probe sequence from 10 base zone scopes to 3 ' extreme direction and complementary sequence that this probe extends 10 bases and obtains in 5 ' extreme direction extends.
3. be that TTCAATGGGGCATTCATAGC and complementary sequence are AAGTTACCCCGTAAGTATCG by upstream primer H7N2pf810 sequence, downstream primer H7N2pr944 sequence is that the primer of GTTGATGTTTTGGAATGGCAG and complementary sequence CAACTACAAAACCTTACCGTC composition is right, and 10 bases are extended to 5 ' extreme direction, primer sequence and complementary sequence that the downstream primer position is extended 10 bases, obtained to 3 ' extreme direction in the right upstream primer position of this primer in 5 ' extreme direction extends 10 base zone scopes; Probe H7N2pb830 sequence is that CCTGACAGGGCAAGTTT and complementary sequence are GGACTGTCCCGTTCAAA, probe sequence from 10 base zone scopes to 3 ' extreme direction and complementary sequence that this probe extends 10 bases and obtains in 5 ' extreme direction extends.
4. be that GCCATTGCAATGGGCCT and complementary sequence are CGGTAACGTTACCCGGA by upstream primer H7Nxpf1664 sequence, downstream primer H7Nxpr1736 sequence is that AGTAGAAACAAGGGTGTTTTTTCCA and complementary sequence are that the primer formed of TCATCTTTGTTCCCACAAAAAAGGT is right, and 10 bases are extended to 5 ' extreme direction, primer sequence and complementary sequence that the downstream primer position is extended 10 bases, obtained to 3 ' extreme direction in the right upstream primer position of this primer in 5 ' extreme direction extends 10 base zone scopes; Probe H7Nxpb1712 sequence is that CGGTGCACTATTTGTATA and complementary sequence are GCCACGTGATAAACATAT, probe sequence from 10 base zone scopes to 3 ' extreme direction and complementary sequence that this probe extends 10 bases and obtains in 5 ' extreme direction extends.
5. be that AAGATGTGATACTTTGGTTTAGCTTCG and complementary sequence are TTCTACACTATGAAACCAAATCGAAGC by upstream primer H7Nxpf1614 sequence, downstream primer H7Nxpr1701 sequence is that GTGCACCGCATGTTTCCAT and complementary sequence are that the primer formed of CACGTGGCGTACAAAGGTA is right, and 10 bases are extended to 5 ' extreme direction, primer sequence and complementary sequence that the downstream primer position is extended 10 bases, obtained to 3 ' extreme direction in the right upstream primer position of this primer in 5 ' extreme direction extends 10 base zone scopes; Probe H7Nxpb1665 sequence is that CCATTGCAATGGGCCT and complementary sequence are GGTAACGTTACCCGGA, probe sequence from 10 base zone scopes to 3 ' extreme direction and complementary sequence that this probe extends 10 bases and obtains in 5 ' extreme direction extends.Primer and probe design: by respectively all avian influenza virus H7 subtype gene group sequences of having reported being compared analysis, select the Nucleotide section design of no secondary structure and high conservative many to primer and probe, primer length is generally about 20 bases, between primer and primer in no complementary sequence.Optimum primer, probe sequence are as follows:
H7N2pf1292：5’-CGTGTCCAATTAATGACATTTCC-3’
H7N2pr1202：5’-ATCACAGGCAAATTGAATCGT-3’
H7N2pb1247：5’-TTTGAGCTGATAGACAATGA-3’
H7Nxpf1664：5’-GCCATTGCAATGGGCCT-3’
H7Nxpr1736：5’-AGTAGAAACAAGGGTGTTTTTTCCA-3’
H7Nxpb1712：5’-CGGTGCACTATTTGTATA-3’
After above-mentioned primer, probe sequence optimum combination, set up the real-time fluorescent RT-PCR method for detecting that detects bird flu H7 hypotype, and make the real-time fluorescent RT-PCR detection reagent box that is used to detect bird flu H7 hypotype.
The method that bird flu H7 hypotype real-time fluorescence RT-PCR detects adopts following steps:
(1) chooses primer described in the claim 1-20 and probe;
(2) prepare template to be measured, extract the geneome RNA of avian influenza virus in the sample of various sources;
(3) foundation of reaction system, is determined best primer concentration at a; B, determine magnesium ion concentration; C, determine ThermoScript II (AMVRnaseXL) consumption; D, determine Taq archaeal dna polymerase (Taq enzyme) consumption; E, determine dNTPs concentration; F, definite
Best concentration and probe concentration;
(4) sense channel of selection instrument;
(5) go up machine testing.
The preparation of the template to be measured in the bird flu H7 hypotype real-time fluorescent RT-PCR method for detecting can adopt the extracting method of method QIAampViral RNA Mini kit or Trizol nucleic acid extraction agent to extract the geneome RNA of avian influenza virus in the sample of various sources.
Distinguishing feature of the present invention is: fully use the efficient amplification of round pcr, the good specificity of nucleic acid hybridization and the quick susceptibility of detection technique of fluorescence, have reliable results and detect advantages such as cost, raising detection efficiency with accurate sensitive, simple to operate, time saving and energy saving, reduction.
Description of drawings
The real-time fluorescence RT-PCR of Fig. 1 Taqman probe detects schematic diagram.
Fig. 2 bird flu H7 hypotype real-time fluorescence RT-PCR detection curve figure.
The specificity test detection curve figure of Fig. 3 bird flu H7 hypotype real-time fluorescence RT-PCR method.
The sensitivity test detection curve figure of Fig. 4 bird flu H7 hypotype real-time fluorescence RT-PCR method.
Embodiment
The foundation of reaction system and optimization:
The foundation and the optimization of bird flu H7 hypotype real-time fluorescence RT-PCR reaction system: the avian influenza virus H7 hypotype strain that utilizes deactivation is as sample to be checked, utilize the extracting method of QIAamp Viral RNA Mini kit or Trizol nucleic acid extraction agent to extract virus genome RNA, be stored in after the packing respectively-20 ℃ standby.
(1) under the optimization of the primer concentration situation that other condition is identical in reaction system, the primer concentration of H7 is done the multiple proportions serial dilution from 0.1 μ mol/L to 1.6 μ mol/L respectively, analysis by test-results is compared, and determines that best primer final concentration is 0.4 μ mol/L.
(2) under the optimization of the magnesium ion concentration situation that other condition is identical in reaction system, with MgCl
2Concentration increase progressively with 1mmol/L from 1mmol/L to 10mmol/L, be magnesium ion concentration in the test kit reaction system through the selected 5mmol/L of repeated experiments repeatedly.
(3) optimization of ThermoScript II (AMV RnaseXL) consumption is compared through the test-results of using different concns AMV RNaseXL, and selected 5U is as the consumption of AMV RnaseXL in the test kit reaction system.
(4) optimization of Taq archaeal dna polymerase (Taq enzyme) consumption is by comparing the optimization experiment result of Taq enzyme dosage (in the Unit of unit), and selected 5U is as the consumption of Taq enzyme in the test kit reaction system.
(5) optimization of dNTPs concentration detects by the dNTPs that uses different concns, selects the usage quantity of 1mmol/L as dNTPs in the test kit reaction system after the comprehensive assessment.
(6) under the optimization of the concentration and probe concentration situation that other condition is identical in reaction system, the concentration and probe concentration of bird flu H7 hypotype is done to detect after the multiple proportions serial dilution from 0.1 μ mol/L to 0.5 μ mol/L respectively, analysis by test-results is compared, and determines that best probe final concentration is 0.2 μ mol/L.
Utilize above-mentioned primer and probe to carry out the foundation of reaction system, determine that at last the bird flu H7 hypotype real-time fluorescence RT-PCR reaction system that adopts is 25 μ l systems, required each component and respective concentration see Table 1.
Each component situation in the reaction of table 1 bird flu H7 hypotype real-time fluorescence RT-PCR
| Component | Consumption/final concentration |
| ????10×Buffer | ????1× |
| ????25mmol/L?MgCl 2 | ????5mmol/L |
| ????dNTP?Mixture | ????1mmol/L |
| ????RNase?Inhibitor | ????40Unit |
| Primer | ????0.4μmol/L?each |
| Probe | ????0.2μmol/L |
| Template | ????10μl |
| ????AMV?RNaseXL | ????5Unit |
| ????AMV?Taq | ????5Unit |
Annotate: 1. at the multiplex real-time reverse transcriptase PCR reaction volume not simultaneously, each reagent should be adjusted in proportion.
2. the instrument difference of Shi Yonging should be done reaction parameter suitably to adjust.
3. different according to detecting the sample source, should suitably adjust the template dosage.
The selection of instrument detecting passage:
When carrying out the reaction of fowl stream H7 hypotype real-time fluorescence RT-PCR, the collection of tackling reaction tubes fluorescent signal in the used instrument is provided with, and the fluorescence detection channel of selection is consistent with the fluorescence report group of probe institute mark.Concrete method to set up is different because of instrument, should be with reference to the instrument working instructions.
Embodiment 1
(1) preparation of template to be measured
Method one utilizes QIAamp Viral RNA Mini kit to extract the geneome RNA of avian influenza virus in the sample of various sources, and the concrete operations step is as follows:
A. get 560 μ l and contain the AVL damping fluid of vector rna to the Eppendorf tube of 1.5ml;
B. the PBS scavenging solution that adds 140 μ l blood plasma, serum, urine sample, cell culture supernatant or swab, vortex vibration 15sec;
C. under room temperature (15-25 ℃), hatch 10min;
D. instantaneous centrifugal in case with the centrifugal that covers to centrifuge tube;
E. add 560 μ l dehydrated alcohols again, vortex vibration 15sec, instantaneous centrifugal, with the centrifugal that covers to centrifuge tube;
F. carefully draw 630 μ l aforesaid liquids and to the centrifugal post of QIAamp, (place in the collection tube of 2ml) mouth of pipe edge of not getting wet, the centrifugal 1min of 8000rpm.Discard the collection tube that contains liquid, the centrifugal post of QIAamp is positioned in the collection tube of another 2ml;
G. carefully open the centrifugal post lid of QIAamp, repeating step f;
H. carefully open the centrifugal post lid of QIAamp, add the AW1 damping fluid of 500 μ l, the centrifugal 1min of 8000rpm.The centrifugal post of QIAamp is positioned on the collection tube of another clean 2ml, discards the collection tube that contains liquid;
I. carefully open the centrifugal post lid of QIAamp, add the AW2 damping fluid of 500 μ l, the centrifugal 3min of 14000rpm.The centrifugal post of QIAamp is positioned on the collection tube of another 2 clean ml, discards the collection tube that contains liquid, once more the centrifugal 1min of 14000rpm;
J. the centrifugal post of QIAamp is positioned in the centrifuge tube of a clean 1.5ml, carefully opens the post lid, add 60 μ lAVE elution buffers, behind the incubated at room 1min, the centrifugal 1min of 8000rpm promptly obtains viral RNA, and-20 ℃ store for future use.
The method two extracting method of Trizol nucleic acid extraction agent
A. gather in the crops the allantoic fluid of the deadly chicken embryo of avian influenza virus, the centrifugal removal macromole of 12000rpm impurity.100 μ l supernatant liquors are added in the centrifuge tube of 1.5ml, organize extract to the TrizoL that wherein adds 300 μ l again, fully vibration on vibrator.The centrifugal 15min of 13000rpm moves to supernatant in the centrifuge tube of 1.5ml then;
B. the pre-cold isopropanol that adds 400 μ l in supernatant liquor is after fully vibrating on the vibrator;
C.13000rpm centrifugal 10min is so that obtain the RNA precipitation;
D. carefully outwell supernatant, add 600 μ l75% ethanol, with putting upside down washing for several times on hand down.(note: can not thermal agitation, prevent to be difficult to precipitate again behind the fracture of RNA and the RNA resolution of precipitate);
E.13000rpm centrifugal 10min slowly inhales and abandons supernatant, and the about 25min of drying at room temperature treats to add 25-40 μ l after ethanol volatilizees fully and do not have the water dissolution of RNA enzyme (abundant springing mixing, or blow and beat repeatedly with rifle), and-20 ℃ store for future use.
(2) amplification condition of bird flu H7 hypotype real-time fluorescence RT-PCR reaction
According to table 1 application of sample, will add excellent PCR pipe and be placed in the fluorescent PCR instrument, after being set, corresponding phosphor collection condition increases, and response procedures is as follows:
50 ℃ of 30min carry out the reverse transcription of RNA, 95 ℃ of 3min deactivation ThermoScript II;
95 ℃ of 15sec sex change, 55 ℃ of 30sec annealing, 72 ℃ of 1min extend, and so repeat 5 circulations and increase in advance;
95 ℃ of 10sec sex change, 60 ℃ of 40sec anneal, extend, and so repeat 40 circulations and carry out the segmental augmentation detection of purpose, and test-results can be monitored in real time.
(3) detected result of bird flu H7 hypotype real-time fluorescence RT-PCR
In 25 μ l reaction systems, utilize Auele Specific Primer and probe to carry out real-time fluorescence RT-PCR at bird flu H7 hypotype, detect the positive that contains avian influenza virus H7 subtype gene group RNA, the result can obtain specific fluorescence curve (Fig. 2).
Above test-results shows, the primer of the present invention's design and probe is special and serviceability is good, and set up the method that bird flu H7 hypotype real-time fluorescence RT-PCR detects.
Embodiment 2
The specificity test of bird flu H7 hypotype real-time fluorescence RT-PCR method:
In 25 μ l reaction systems, the geneome RNA that adds avian influenza virus H5, H7, H9 hypotype simultaneously is as template, utilization is carried out the real-time fluorescence RT-PCR detection at primer, the probe of bird flu H7 hypotype, the result has to the specificity fluorescent curve of H7 hypotype, show that this method only has specific amplification to the H7 hypotype, H5, H9 hypotype are not had amplification, confirm that the primer at bird flu H7 hypotype, the probe that the present invention relates to have very strong specificity (Fig. 3).
Embodiment 3
The sensitivity test of bird flu H7 hypotype real-time fluorescence RT-PCR method:
In 25 μ l bird flu H7 hypotype real-time fluorescence RT-PCR reaction systems, the geneome RNA of avian influenza virus H7 hypotype is done 10 times of serial dilutions, carry out real-time fluorescence RT-PCR sensitivity Detection, obtain diluting gradient series amplification curve (Fig. 4) at the H7 hypotype.
Above test-results shows that the bird flu H7 hypotype real-time fluorescence RT-PCR method susceptibility that the present invention relates to is very high, can detect the bird flu H7 hypotype that trace exists in the sample.
The use that is used to detect bird flu H7 fluorescent probe provided by the invention has further improved the specificity that detects, thereby can reach time saving and energy saving, reduce the purpose that detects cost, improves detection speed and efficient.
The present invention is 10 to the detection sensitivity of bird flu H7 hypotype
-5, can satisfy the detection requirement of various samples.
Utilize the present invention to detect, easy and simple to handlely generally can about 2 hours, finish fast, and can be in testing process monitoring result in real time, do not need to carry out the electrophoresis observation of amplified production, EB is to the pollution of environment when having avoided pollution between the amplified production and electrophoresis observation.
The H7 sequence table
Sequence table
＜110〉Shenzhen Taitai Genetic Engineering Co., Ltd.
Shenzhen Exit and Entrance Inspection Guarantine Bureau, PRC
＜120〉be used for primer and the probe sequence that bird flu H7 hypotype real-time fluorescence RT-PCR detects
<140>200410027813.6
<141>2004-06-25
<160>30
<170>PatentIn?version?3.3
<210>1
<211>23
<212>DNA
＜213〉artificial sequence
<400>1
cgtgtccaat?taatgacatt?tcc?????????????????????????????????????????????23
<210>2
<211>21
<212>DNA
＜213〉artificial sequence
<400>2
atcacaggca?aattgaatcg?t???????????????????????????????????????????????21
<210>3
<211>23
<212>DNA
＜213〉artificial sequence
<400>3
gcacaggtta?attactgtaa?agg?????????????????????????????????????????????23
<210>4
<211>21
<212>DNA
＜213〉artificial sequence
<400>4
tagtgtccgt?ttaacttagc?a???????????????????????????????????????????????21
<210>5
<211>20
<212>DNA
＜213〉artificial sequence
<400>5
The H7 sequence table
tttgagctga?tagacaatga?????????????????????????????????????????????????20
<210>6
<211>20
<212>DNA
＜213〉artificial sequence
<400>6
aaactcgact?atctgttact?????????????????????????????????????????????????20
<210>7
<211>23
<212>DNA
＜213〉artificial sequence
<400>7
ctcattcctg?tagccaraag?gag?????????????????????????????????????????????23
<210>8
<211>19
<212>DNA
＜213〉artificial sequence
<400>8
cccctgacag?ggcaagttt??????????????????????????????????????????????????19
<210>9
<211>23
<212>DNA
＜213〉artificial sequence
<400>9
gagtaaggac?atcggtyttc?ctc?????????????????????????????????????????????23
<210>10
<211>19
<212>DNA
＜213〉artificial sequence
<400>10
ggggactgtc?ccgttcaaa??????????????????????????????????????????????????19
<210>11
<211>16
<212>DNA
＜213〉artificial sequence
<400>11
tgccattcca?aaacat?????????????????????????????????????????????????????16
The H7 sequence table
<210>12
<211>16
<212>DNA
＜213〉artificial sequence
<400>12
acggtaaggt?tttgta?????????????????????????????????????????????????????16
<210>13
<211>20
<212>DNA
＜213〉artificial sequence
<400>13
ttcaatgggg?cattcatagc?????????????????????????????????????????????????20
<210>14
<211>21
<212>DNA
＜213〉artificial sequence
<400>14
gttgatgttt?tggaatggca?g???????????????????????????????????????????????21
<210>15
<211>20
<212>DNA
＜213〉artificial sequence
<400>15
aagttacccc?gtaagtatcg?????????????????????????????????????????????????20
<210>16
<211>21
<212>DNA
＜213〉artificial sequence
<400>16
caactacaaa?accttaccgt?c???????????????????????????????????????????????21
<210>17
<211>17
<212>DNA
＜213〉artificial sequence
<400>17
cctgacaggg?caagttt????????????????????????????????????????????????????17
<210>18
The H7 sequence table
<211>17
<212>DNA
＜213〉artificial sequence
<400>18
ggactgtccc?gttcaaa????????????????????????????????????????????????????17
<210>19
<211>17
<212>DNA
＜213〉artificial sequence
<400>19
gccattgcaa?tgggcct????????????????????????????????????????????????????17
<210>20
<211>25
<212>DNA
＜213〉artificial sequence
<400>20
agtagaaaca?agggtgtttt?ttcca???????????????????????????????????????????25
<210>21
<211>17
<212>DNA
＜213〉artificial sequence
<400>21
cggtaacgt?t?acccgga???????????????????????????????????????????????????17
<210>22
<211>25
<212>DNA
＜213〉artificial sequence
<400>22
tcatctttgt?tcccacaaaa?aaggt???????????????????????????????????????????25
<210>23
<211>18
<212>DNA
＜213〉artificial sequence
<400>23
cggtgcacta?tttgtata???????????????????????????????????????????????????18
<210>24
<211>18
<212>DNA
The H7 sequence table
＜213〉artificial sequence
<400>24
gccacgtgat?aaacatat???????????????????????????????????????????????????18
<210>25
<211>27
<212>DNA
＜213〉artificial sequence
<400>25
aagatgtgat?actttggttt?agcttcg?????????????????????????????????????????27
<210>26
<211>19
<212>DNA
＜213〉artificial sequence
<400>26
gtgcaccgca?tgtttccat??????????????????????????????????????????????????19
<210>27
<211>27
<212>DNA
＜213〉artificial sequence
<400>27
ttctacacta?tgaaaccaaa?tcgaagc?????????????????????????????????????????27
<210>28
<211>19
<212>DNA
＜213〉artificial sequence
<400>28
cacgtggcgt?acaaaggta??????????????????????????????????????????????????19
<210>29
<211>16
<212>DNA
＜213〉artificial sequence
<400>29
ccattgcaat?gggcct?????????????????????????????????????????????????????16
<210>30
<211>16
<212>DNA
＜213〉artificial sequence
The H7 sequence table
<400>30
ggtaacgtta?cccgga?????????????????????????????????????????????????????16
Claims (20)
1, a kind of primer sequence that is used for the detection of bird flu H7 hypotype real-time fluorescence RT-PCR, it is characterized in that it is that CGTGTCCAATTAATGACATTTCC and downstream primer H7N2pr1202 sequence are that the primer formed of ATCACAGGCAAATTGAATCGT is right that described primer sequence comprises by upstream primer H7N2pf1292 sequence, and the complementary sequence TAGTGTCCGTTTAACTTAGCA of the complementary sequence GCACAGGTTAATTACTGTAAAGG of upstream primer and downstream primer.
2, the primer sequence that is used for the detection of bird flu H7 hypotype real-time fluorescence RT-PCR according to claim 1, it is characterized in that described primer sequence comprises by upstream primer H7N2pf1292 position to 10 bases of 3 ' extreme direction extension, 10 bases are extended to 3 ' extreme direction in downstream primer H7N2pr1202 position, the primer sequence and the complementary sequence that obtain in 5 ' extreme direction extends 10 base zone scopes.
3, a kind ofly be used for the probe sequence that bird flu H7 hypotype real-time fluorescence RT-PCR detects, it is characterized in that described probe H7N2pb1247 sequence is TTTGAGCTGATAGACAATGA, with and complementary sequence be AAACTCGACTATCTGTTACT.
4, the probe sequence that is used for the detection of bird flu H7 hypotype real-time fluorescence RT-PCR according to claim 3 is characterized in that described probe sequence comprises probe sequence and the complementary sequence that is extended 10 bases and obtain to 3 ' extreme direction by probe H7N2pb1247 in 5 ' extreme direction extends 10 base zone scopes.
5, a kind of primer sequence that is used for the detection of bird flu H7 hypotype real-time fluorescence RT-PCR, it is characterized in that it is that CTCATTCCTGTAGCCARAAGGAG and downstream primer H7N2pr828 sequence are that the primer formed of CCCCTGACAGGGCAAGTTT is right that described primer sequence comprises by upstream primer H7N2pf1010 sequence, and the complementary sequence GGGGACTGTCCCGTTCAAA of the complementary sequence GAGTAAGGACATCGGTYTTCCTC of upstream primer and downstream primer.
6, the primer sequence that is used for the detection of bird flu H7 hypotype real-time fluorescence RT-PCR according to claim 5, it is characterized in that described primer sequence comprises by upstream primer H7N2pf1010 position to 10 bases of 3 ' extreme direction extension, 10 bases are extended to 3 ' extreme direction in downstream primer H7N2pr828 position, the primer sequence and the complementary sequence that obtain in 5 ' extreme direction extends 10 base zone scopes.
7, a kind ofly be used for the probe sequence that bird flu H7 hypotype real-time fluorescence RT-PCR detects, it is characterized in that described probe H7N2pb945 sequence is TGCCATTCCAAAACAT, with and complementary sequence be ACGGTAAGGTTTTGTA.
8, the probe sequence that is used for the detection of bird flu H7 hypotype real-time fluorescence RT-PCR according to claim 7 is characterized in that described probe sequence comprises probe sequence and the complementary sequence that is extended 10 bases and obtain to 3 ' extreme direction by probe H7N2pb945 in 5 ' extreme direction extends 10 base zone scopes.
9, a kind of primer sequence that is used for the detection of bird flu H7 hypotype real-time fluorescence RT-PCR, it is characterized in that it is that TTCAATGGGGCATTCATAGC and downstream primer H7N2pr944 sequence are that the primer formed of GTTGATGTTTTGGAATGGCAG is right that described primer sequence comprises by upstream primer H7N2pf810 sequence, and the complementary sequence CAACTACAAAACCTTACCGTC of the complementary sequence AAGTTACCCCGTAAGTATCG of upstream primer and downstream primer.
10, the primer sequence that is used for the detection of bird flu H7 hypotype real-time fluorescence RT-PCR according to claim 9, it is characterized in that described primer sequence comprises by upstream primer H7N2pf810 position to 10 bases of 3 ' extreme direction extension, 10 bases are extended to 3 ' extreme direction in downstream primer H7N2pr944 position, the primer sequence and the complementary sequence that obtain in 5 ' extreme direction extends 10 base zone scopes.
11, a kind ofly be used for the probe sequence that bird flu H7 hypotype real-time fluorescence RT-PCR detects, it is characterized in that described probe H7N2pb830 sequence is CCTGACAGGGCAAGTTT, with and complementary sequence be GGACTGTCCCGTTCAAA.
12, the probe sequence that is used for the detection of bird flu H7 hypotype real-time fluorescence RT-PCR according to claim 11 is characterized in that described probe sequence comprises probe sequence and the complementary sequence that is extended 10 bases and obtain to 3 ' extreme direction by probe H7N2pb830 in 5 ' extreme direction extends 10 base zone scopes.
13, a kind of primer sequence that is used for the detection of bird flu H7 hypotype real-time fluorescence RT-PCR, it is characterized in that it is that GCCATTGCAATGGGCCT and downstream primer H7Nxpr1736 sequence are that the primer formed of AGTAGAAACAAGGGTGTTTTTTCCA is right that described primer sequence comprises by upstream primer H7Nxpf1664 sequence, and the complementary sequence TCATCTTTGTTCCCACAAAAAAGGT of the complementary sequence CGGTAACGTTACCCGGA of upstream primer and downstream primer.
14, the primer sequence that is used for the detection of bird flu H7 hypotype real-time fluorescence RT-PCR according to claim 13, it is characterized in that described primer sequence comprises by H7Nxpf1664 position, upstream to 10 bases of 3 ' extreme direction extension, 10 bases are extended to 3 ' extreme direction in downstream primer H7Nxpr1736 position, the primer sequence and the complementary sequence that obtain in 5 ' extreme direction extends 10 base zone scopes.
15, a kind ofly be used for the probe sequence that bird flu H7 hypotype real-time fluorescence RT-PCR detects, it is characterized in that described probe H7Nxpb1712 sequence is CGGTGCACTATTTGTATA, with and complementary sequence be GCCACGTGATAAACATAT.
16, the probe sequence that is used for the detection of bird flu H7 hypotype real-time fluorescence RT-PCR according to claim 15 is characterized in that described probe sequence comprises probe sequence and the complementary sequence that is extended 10 bases and obtain to 3 ' extreme direction by probe H7Nxpb1712 in 5 ' extreme direction extends 10 base zone scopes.
17, a kind of primer sequence that is used for the detection of bird flu H7 hypotype real-time fluorescence RT-PCR, it is characterized in that it is that AAGATGTGATACTTTGGTTTAGCTTCG and downstream primer H7Nxpr1701 sequence are that the primer formed of GTGCACCGCATGTTTCCAT is right that described primer sequence comprises by upstream primer H7Nxpf1614 sequence, and the complementary sequence CACGTGGCGTACAAAGGTA of the complementary sequence TTCTACACTATGAAACCAAATCGAAGC of upstream primer and downstream primer.
18, the primer sequence that is used for the detection of bird flu H7 hypotype real-time fluorescence RT-PCR according to claim 17, it is characterized in that described primer sequence comprises by upstream primer H7Nxpf1614 position to 10 bases of 3 ' extreme direction extension, 10 bases are extended to 3 ' extreme direction in downstream primer H7Nxpr1701 position, the primer sequence and the complementary sequence that obtain in 5 ' extreme direction extends 10 base zone scopes.
19, a kind ofly be used for the probe sequence that bird flu H7 hypotype real-time fluorescence RT-PCR detects, it is characterized in that described probe H7Nxpb1665 sequence is CCATTGCAATGGGCCT, with and complementary sequence be GGTAACGTTACCCGGA.
20, the probe sequence that is used for the detection of bird flu H7 hypotype real-time fluorescence RT-PCR according to claim 19 is characterized in that described probe sequence comprises probe sequence and the complementary sequence that is extended 10 bases and obtain to 3 ' extreme direction by probe H7Nxpb1665 in 5 ' extreme direction extends 10 base zone scopes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2004100278136A CN100381578C (en) | 2004-06-25 | 2004-06-25 | Primer and probe series for real time fluorescent RT-PCR detection of bird flu of H7 subtype |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2004100278136A CN100381578C (en) | 2004-06-25 | 2004-06-25 | Primer and probe series for real time fluorescent RT-PCR detection of bird flu of H7 subtype |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1670220A true CN1670220A (en) | 2005-09-21 |
| CN100381578C CN100381578C (en) | 2008-04-16 |
Family
ID=35041655
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2004100278136A Expired - Fee Related CN100381578C (en) | 2004-06-25 | 2004-06-25 | Primer and probe series for real time fluorescent RT-PCR detection of bird flu of H7 subtype |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100381578C (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102108418B (en) * | 2009-12-25 | 2012-10-03 | 中国科学院广州生物医药与健康研究院 | Loop-mediated isothermal amplification detection method and kit for H1N1 influenza A viruses |
| CN101942524B (en) * | 2009-07-08 | 2012-10-03 | 中国科学院广州生物医药与健康研究院 | Combined nucleic acid real-time fluorescent detection method for influenza A H1N1 virus and influenza A virus and kit |
| CN103276109A (en) * | 2013-05-10 | 2013-09-04 | 浙江省疾病预防控制中心 | Avian influenza H7N9 virus RT-PCR (reverse transcription-polymerase chain reaction) detecting kit and detecting method |
| CN103320528A (en) * | 2013-06-03 | 2013-09-25 | 深圳太太基因工程有限公司 | Primer pair and probe for detecting avian influenza virus in sample by fluorescence RT-PCR and kit containing primer pair and probe |
| CN103320527A (en) * | 2013-06-03 | 2013-09-25 | 深圳太太基因工程有限公司 | Primer pair and probe for detecting avian influenza virus in sample by fluorescence RT-PCR and kit containing primer pair and probe |
| CN103320529A (en) * | 2013-06-03 | 2013-09-25 | 深圳太太基因工程有限公司 | Primer pair and probe for detecting avian influenza virus in sample by fluorescence RT-PCR and kit containing primer pair and probe |
| CN106834540A (en) * | 2017-02-10 | 2017-06-13 | 华南农业大学 | For reagent, the methods and applications of highly pathogenic H7 avian flu virus detections |
-
2004
- 2004-06-25 CN CNB2004100278136A patent/CN100381578C/en not_active Expired - Fee Related
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101942524B (en) * | 2009-07-08 | 2012-10-03 | 中国科学院广州生物医药与健康研究院 | Combined nucleic acid real-time fluorescent detection method for influenza A H1N1 virus and influenza A virus and kit |
| CN102108418B (en) * | 2009-12-25 | 2012-10-03 | 中国科学院广州生物医药与健康研究院 | Loop-mediated isothermal amplification detection method and kit for H1N1 influenza A viruses |
| CN103276109A (en) * | 2013-05-10 | 2013-09-04 | 浙江省疾病预防控制中心 | Avian influenza H7N9 virus RT-PCR (reverse transcription-polymerase chain reaction) detecting kit and detecting method |
| CN103320528A (en) * | 2013-06-03 | 2013-09-25 | 深圳太太基因工程有限公司 | Primer pair and probe for detecting avian influenza virus in sample by fluorescence RT-PCR and kit containing primer pair and probe |
| CN103320527A (en) * | 2013-06-03 | 2013-09-25 | 深圳太太基因工程有限公司 | Primer pair and probe for detecting avian influenza virus in sample by fluorescence RT-PCR and kit containing primer pair and probe |
| CN103320529A (en) * | 2013-06-03 | 2013-09-25 | 深圳太太基因工程有限公司 | Primer pair and probe for detecting avian influenza virus in sample by fluorescence RT-PCR and kit containing primer pair and probe |
| CN103320528B (en) * | 2013-06-03 | 2014-12-10 | 深圳太太基因工程有限公司 | Primer pair and probe for detecting avian influenza virus in sample by fluorescence RT-PCR and kit containing primer pair and probe |
| CN106834540A (en) * | 2017-02-10 | 2017-06-13 | 华南农业大学 | For reagent, the methods and applications of highly pathogenic H7 avian flu virus detections |
Also Published As
| Publication number | Publication date |
|---|---|
| CN100381578C (en) | 2008-04-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1670221A (en) | Primer, probe series and method for multiple real time fluorescent RT-PCR detection of H5, H7 and H9 subtype bird flu | |
| CN1183259C (en) | Genotyping kit for diagnosis of human papillomavirus infection | |
| CN1258604C (en) | Reagent box used for detecting non pathogenic or pathogenic A type influenze virus H5 subtype virus | |
| CN1286989C (en) | Biochip for detecting pathogenesis fungus | |
| CN1814805A (en) | H5, H7, H9 subtype auian flu virus real-time fluo rescent quantixative PCR detecting method | |
| CN1827780A (en) | Oligonucleotide primers for efficient detection of hepatitis c virus (HCV) and methods of use thereof | |
| CN1646705A (en) | Amplification-hybridisation method for detecting and typing human papillomavirus | |
| CN1718742A (en) | Nucleic acid hybrid film strip and reagent box used for diagnosing beta mediterranean sea thalassemia | |
| CN1828299A (en) | Nucleotide sequence, reagent kit and checking method for detecting fowl influenza virus | |
| CN1303216C (en) | Multiplex PCR primer set for human glucokinase gene amplification | |
| CN1670220A (en) | Primer and probe series for real time fluorescent RT-PCR detection of bird flu of H7 subtype | |
| CN1384203A (en) | Low temperature circulating DNA extending reaction method with high extension specificity | |
| CN1495255A (en) | Method for obtaining non-occluded baculovirus | |
| CN1690223A (en) | Human papilomavirus typing gene chip detecting system | |
| CN1969048A (en) | Method for study of the genetic and functional variability of HIV and kit for using it | |
| CN1680593A (en) | Norovirus detection reagent | |
| CN1724686A (en) | Target sequence used for detecting mycoplasma pnoumoniae and reagent box | |
| CN100351395C (en) | Norwalk virus expression detecting kit and its special primer and probe | |
| CN1537954A (en) | Expressing genetic analysis method and probe reagent box for expressing genetic analysng | |
| CN1269966C (en) | Method for the amplification and detection of HBV DNA using a transcription based amplification | |
| CN1174104C (en) | Artificial sequence template primer collection and its use | |
| CN1670219A (en) | Primer and probe series for real time fluorescent RT-PCR detection of bird flu H9 subtype | |
| CN1247796C (en) | Quantitative measuring transgene component in transgene rapeseed and processed product | |
| CN1281763C (en) | Process for detecting Enterobacter sakazakii by employing fluorescence PCR technology | |
| CN1274850C (en) | Turbot reddish body iridovirus virus polymerase chain reaction detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20080416 Termination date: 20150625 |
|
| EXPY | Termination of patent right or utility model |