CN101942524B - Combined nucleic acid real-time fluorescent detection method for influenza A H1N1 virus and influenza A virus and kit - Google Patents
Combined nucleic acid real-time fluorescent detection method for influenza A H1N1 virus and influenza A virus and kit Download PDFInfo
- Publication number
- CN101942524B CN101942524B CN200910040954A CN200910040954A CN101942524B CN 101942524 B CN101942524 B CN 101942524B CN 200910040954 A CN200910040954 A CN 200910040954A CN 200910040954 A CN200910040954 A CN 200910040954A CN 101942524 B CN101942524 B CN 101942524B
- Authority
- CN
- China
- Prior art keywords
- influenza
- virus
- seq
- pcr
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Abstract
The invention provides a combined nucleic acid real-time fluorescent detection method for simultaneously detecting an influenza A H1N1 virus and an influenza A virus and a kit. The combined nucleic acid real-time fluorescent detection method for the influenza A H1N1 virus and the influenza A virus comprises the following steps of: (1) extracting virus RNA; (2) carrying out fluorescent quantitative PCR (Polymerase Chain Reaction) detection; and (3) judging a detecting result. By carrying out multiple sequence comparison and aiming at a conserved gene fragment of the influenza A virus and the influenza A H1N1 virus (infecting in 2009), a primer and a probe with high specificity are designed and used for real-time fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection. The invention can be used for detecting influenza A virus RNA of human influenza, swine influenza, avian influenza, and other influenza viruses, meanwhile specifically detecting the influenza A H1N1 virus (infecting in 2009) RNA and carrying out double analysis so that a detecting result is more reliable.
Description
Technical field
The invention belongs to biological technical field, relate to a kind of real-time fluorescence detection method and test kit that detects first type and H1N1virus simultaneously.
Background technology
Influenza is called for short influenza, is by first type, B-mode, acute respiratory transmissible disease that three kinds of influenza viruses of third type cause.According to its surface tissue (hemagglutinin H and neuraminidase N) and genetic characteristics is different, influenza A virus can be divided into many hypotypes again, and the blood clotting found of influenza A virus have 16 hypotypes (H1-H16), 9 hypotypes of neuraminidase (N1-N9) so far.H1N1virus is a kind of hypotype wherein, and it causes Influenza A H1N1.
Infected the Influenza A H1N1 epidemic situation from Mexico outburst and the people that spreads to global a plurality of countries in 2009; Be because a kind of H1N1virus of new variation causes; Be called " public health emergency of international concern " by the World Health Organization, reached 6 grades of the highest alarm criteria.
Cause the strain of the influenza virus of this Influenza A H1N1 include the gene fragment of three kinds of influenza viruses such as porcine influenza, bird flu and human influenza (Yu Jianmin. the diagnosis and treatment of Influenza A H1N1 and prevention. Jiangxi medicine, 2009,44 (4)).This Influenza A H1N1 has following characteristics: the one, this epidemic situation is caused by new influenza virus variant, the general susceptible of crowd, caused transnational, stride the continent and propagate.The 2nd, the human-to-human transmission case has appearred.The 3rd, more severe and death have appearred in Mexico.The 4th, but the influenza patient at the morbidity previous day of toxin expelling, some people does not fall ill after infecting, but still has infectivity, the latent infection ratio is quite high.
This year, the popular A (H 1 N 1) virus spread to world many countries, less than one month, and the Influenza A H1N1 case that make a definite diagnosis in the whole world has broken through ten thousand examples, and many cases Introduced cases influenza case has also appearred in China.Caused certain harm for human life's safety, comprise that active and effective prevention and control measure has all been taked in the countries in the world of the Chinese government, with the rapid spread that wards off disease.In the face of the epidemic disease of unexpected outburst, carrying out disease prevention, diagnosis, pathogenesis and treatment research is the emphasis that association area is paid close attention to and studied.
Quantitative fluorescent PCR has sensitivity, accurate, real-time technological merit; Through H1N1 and influenza A virus to current popular; Design different primer and probe; Be assembled into PCR kit for fluorescence quantitative, accurately detect the H1N1virus of influenza A virus and current popular rapidly, so that carry out early stage extensive examination and the bamboo telegraph of control disease effectively.
Summary of the invention
A kind of H1N1virus and influenza A virus combined nucleic acid real-time fluorescence detection method and reagent corresponding box have been the object of the present invention is to provide; Adopt two kinds of probes to detect H1N1virus (popular new variant in 2009) and influenza A virus simultaneously, make the result more stable through double verification; Also can distinguish simultaneously influenza A virus and other virus, and distinguish H1N1virus (popular new variant in 2009) and the susceptible poison of other normal stream.
A kind of H1N1virus of the present invention and influenza A virus combined nucleic acid real-time fluorescence detection method may further comprise the steps:
1) extraction of viral RNA:
A) from the virus-culturing fluid of deactivation, get the 200-400ul Virus Sample and add 0.5ml Trizol, concussion repeatedly, suction is beneficial to virolysis, hatches 5 minutes down for 20-37 ℃;
B) in employing virus cracking liquid, add the chloroform of 0.1ml and shaking to chylosis, 20-37 ℃ of hatching 10 minutes down under 4 ℃ of 12000rpm centrifugal 15 minutes, got supernatant;
C) in supernatant, add the Virahol of 0.1ml, 20-37 ℃ of hatching 10 minutes down, under 4 ℃ of 12000rpm centrifugal 15 minutes, remove supernatant, make deposition dry;
D) add the 75% washing with alcohol deposition of 0.5ml, under 4 ℃ of 7500rpm centrifugal 5 minutes, eliminate supernatant, make deposition dry, this is precipitated as the RNA of Virus Sample;
E) with diethylpyrocarbonate water 20 μ l dissolving RNA deposition, RNA solution is preserved down in-80 ℃;
2) fluorescence quantitative PCR detection:
Adopt the quantitative fluorescent PCR reaction system of 50 μ l;
The H1N1virus detection architecture comprises:
H1N1virus RT-PCR reaction solution 29 μ l,
Enzyme mixed solution 2 μ l,
ROX correcting fluid 1 μ l,
RNA extracting solution 4 μ l;
The influenza A virus detection architecture comprises:
Influenza A virus RT-PCR reaction solution 29 μ l,
Enzyme mixed solution 2 μ l,
ROX correcting fluid 1 μ l,
RNA extracting solution 4 μ l;
The real-time fluorescence quantitative RT-PCR response procedures:
42 ℃ of reverse transcriptions 5 minutes,
95 ℃ of ThermoScript II deactivations 10 seconds,
40 the circulation 95 ℃ 5 seconds, 60 ℃ 31 seconds;
Described H1N1virus RT-PCR reaction solution comprises:
The RT-PCR damping fluid;
A pair of H1N1virus special primer, the sequence of upstream primer are SEQ ID NO.1, the sequence of downstream primer be SEQ ID NO.2 and
, a H1N1virus TaqMan fluorescent probe, sequence is SEQ ID NO.3, and wherein, the fluorophor of 5 ' end is FAM (a 6-Fluoresceincarboxylic acid), and the quencher of 3 ' end is TAMARA (a 6-carboxyl tetramethylrhodamin);
Described influenza A virus RT-PCR reaction solution comprises:
The RT-PCR damping fluid;
A pair of influenza A virus special primer, the sequence of upstream primer are SEQ ID NO.4, the sequence of downstream primer be SEQ ID NO.5 and
, an influenza A virus TaqMan fluorescent probe, sequence is SEQ ID NO.6, and wherein, the fluorophor of 5 ' end is FAM (a 6-Fluoresceincarboxylic acid), and the quencher of 3 ' end is TAMARA (a 6-carboxyl tetramethylrhodamin);
Described enzyme mixed solution is made up of with volume ratio mixing in 1: 1 Taq enzyme 5U/ μ l and reversed transcriptive enzyme 5U/ μ l;
3) detected result is judged:
After the fluorescence quantitative RT-RCR EP, instrument writes down automatically preserves each round-robin fluorescent signal, carry out the threshold value adjustment after, carry out result's judgement through the amplification curve and the Ct value that detect H1N1 and influenza A virus.
The test kit that another object of the present invention is to provide a kind of H1N1virus and influenza A virus combined nucleic acid real-time fluorescence to detect.
The test kit that a kind of influenza A virus of the present invention and H1N1virus combined nucleic acid real-time fluorescence detect; Comprise ROX correcting fluid, diethylpyrocarbonate water, negative control, first type positive control, H1N1 positive control; It is characterized in that, also comprise following composition:
H1N1virus RT-PCR reaction solution comprises:
The RT-PCR damping fluid;
A pair of H1N1virus special primer, the sequence of upstream primer are SEQ ID NO.1, and the sequence of downstream primer is SEQ ID NO.2; And
, a H1N1virus TaqMan fluorescent probe, sequence is SEQ ID NO.3, and wherein, the fluorophor of 5 ' end is FAM (a 6-Fluoresceincarboxylic acid), and the quencher of 3 ' end is TAMARA (a 6-carboxyl tetramethylrhodamin);
And
Influenza A virus RT-PCR reaction solution comprises:
The RT-PCR damping fluid;
A pair of influenza A virus special primer, the sequence of upstream primer are SEQ ID NO.4, and the sequence of downstream primer is SEQ ID NO.5; And
, an influenza A virus TaqMan fluorescent probe, sequence is SEQ ID NO.6, and wherein, the fluorophor of 5 ' end is FAM (a 6-Fluoresceincarboxylic acid), and the quencher of 3 ' end is TAMARA (a 6-carboxyl tetramethylrhodamin);
And
The enzyme mixed solution is made up of with volume ratio mixing in 1: 1 Taq enzyme 5U/ μ l and reversed transcriptive enzyme 5U/ μ l.
Characteristics of the present invention and advantage are: on the basis of the H1N1 sequential analysis of influenza A virus and current popular; Choose the conservative gene fragment of the H1N1virus of influenza A virus and current popular, use primer Express software design primer and probe; Adopt the Trizol method of improvement to extract Influenza Virus RNA, simultaneously, utilize the real-time fluorescence quantitative RT-PCR technology that influenza virus is detected.After nucleic acid extraction finishes, directly nucleic acid is joined in the RT-PCR reaction solution, synthetic and the PCR of cDNA are reflected in the same pipe and carry out, and need not increase extra step.Detection method according to the invention and test kit have not only shortened the running time, have reduced labour intensity, and directly reduced the cost of detection under the situation that does not influence sensitivity, accuracy.The present invention can be used for detecting Influenza Virus RNA such as first type human influenza, porcine influenza, bird flu, can detect H1N1 (2009 is popular) Influenza Virus RNA specifically simultaneously, carries out double analysis and makes detected result more reliable.
Embodiment
Embodiment one: to influenza A virus and the Auele Specific Primer of H1N1virus and the design of probe
At NCBI
Http:// www.ncbi.nlm.nih.gov/genomes/FLU/Database/request.cgiIn find out the MP gene fragment order of all influenza A viruss, through multiple ratio to finding out the conservative section of influenza A virus.Adopt Express Primer on its conservative fragments, to design primer and probe.
Through PA gene fragment order, adopt Express Primer design primer and probe to H1N1 (2009 is popular).Institute's designed primer and probe and all virus sequences are compared, find out the strongest primer of variability and probe.
The total length PA gene order of above-mentioned H1N1 (2009 popular) derives from NCBI (＞gi|227831814|gb|FJ966977.1|InfluenzaAvirus (A/California/07/2009 (H1N1)) segment 3 polymerase PA (PA) gene, complete cds)
Design result is:
The Auele Specific Primer of influenza A virus
Upstream primer: GGGRATTTTAGGATTTGTGTTCAC SEQ ID NO.1
Downstream primer: CCCATTWAGGGCATTTTGGA SEQ ID NO.2
TaqMan probe: SEQ ID NO.3
5’-FAM-ACCGTGCCCAGTGAGCGAGG-TAMARA-3’
The Auele Specific Primer of H1N1virus
Upstream primer: TCAAAAGAAGTGAACGCCAAAA SEQ ID NO.4
Downstream primer: CAGGAACTTTGACCGCTGATG SEQ ID NO.5
TaqMan probe: SEQ ID NO.6
5’-FAM-ACGACACCACGCCCCCTCAGATT-TAMARA-3’
The TaqMan fluorescent probe is a kind of oligonucleotide probe, and fluorophor is connected 5 ' end of probe, and quencher is then at 3 ' end.Among the present invention, fluorophor adopts FAM (6-Fluoresceincarboxylic acid), and quencher adopts TAMARA (6-carboxyl tetramethylrhodamin).
Embodiment two: quantitative PCR reaction system and the condition of setting up and optimize influenza A virus and H1N1virus
Foundation has 50 μ l reaction systems of following concentration of component: 2 times of RT-PCR damping fluid 25 μ l, Taq enzyme 5U, ThermoScript II 5U, each 0.2 μ M of upstream and downstream primer, probe 0.15 μ M, ROX correcting fluid 1 μ l (TaKaRa company), the RNA 4 μ l of extraction;
Establish following reaction conditions: 42 ℃ 5 minutes → 95 ℃ 10 seconds → 95 ℃ 5 seconds → 60 ℃ 31 seconds, wherein 95 ℃ 5 seconds → 60 ℃ were carried out 40 circulations between 31 seconds, selected the FAM on the fluorescent PCR appearance to detect.
Rt and real-time fluorescence quantitative PCR amplification
Get RNA that 2 μ l or 4 μ l extract template, add simultaneously in RT-PCR reaction solution to the eight couplet pipe of 20 μ l or 50 μ l and carry out the RT-PCR amplification as the RT-PCR reaction
The preparation of one step real-time fluorescence quantitative RT-PCR reaction solution:
The preparation of first type RT-PCR reaction solution:
Reagent usage quantity (μ l) usage quantity (μ l)
First type RT-PCR reaction solution 11.6 29
Enzyme mixed solution 0.8 2
ROX correcting fluid 0.4 1
Negative control/first type positive control/total RNA 24
DEPC water 5.2 14
TV 20 50
The preparation of H1N1 RT-PCR reaction solution:
Reagent usage quantity (μ l) usage quantity (μ l)
H1N1 RT-PCR reaction solution 11.6 29
Enzyme mixed solution 0.8 2
ROX correcting fluid 0.4 1
Negative control/H1N1 positive control/total RNA 24
DEPC water 5.2 14
TV 20 50
B) a step real-time fluorescence quantitative RT-PCR response procedures:
Fs, 42 ℃ of 5min reverse transcriptions
Subordinate phase, the deactivation of 95 ℃ of 10s ThermoScript II
Phase III, [95 ℃ of 5s; 60 ℃ of 31s] * 40 circulations
The final step reaction times decides according to employing PCR appearance.
Embodiment three: the foundation of real-time fluorescence detection method
The instrument that the present invention adopted has:
Thermal?Cycler?DiceTM?Real?Time?System(TaKaRa)
Smart
System(Cepheid)
ABI?PRISM?7000/7700/7900HT，7300/7500?Real-Time?PCR?System，7500Fast?Real-Time?PCR?System(Applied?Biosystems)
Line-Gene (Bioer, rich day of Hangzhou)
LightCycler(Roche?Diagnostics)
Other various Real Time pcr amplification appearance of Mx3000P (Stratagere).
The result judges:
To use the ABI7300 quantitative real time PCR Instrument to be example, on other instruments, operate and carry out with reference to each instrument specification sheets.
Reaction finishes the back according to analyzing the Start value that the back image is regulated Baseline, and the amplification curve of adjustment negative control is straight or be lower than threshold line, clicks Analysis and obtains analytical results automatically.
Reference value (term of reference):
Ct value≤32, decidable influenza A virus H1N1 is positive;
The Ct value be 0 or＞35, decidable influenza A virus H1N1 is negative;
32＜Ct value≤35 are invalid.
The explanation of assay:
All do not have logarithm rise period or Ct value＞35 if detect the amplification curve of sample in RT-PCR reaction system first type and H1N1, but judgement sample is the influenza A virus feminine gender;
If detect the amplification curve of sample in RT-PCR reaction system first type and H1N1 increased logarithmic phase and Ct value≤32 are arranged all, but judgement sample is H1N1 (2009 is popular) the influenza virus positive;
If detecting sample has increased logarithmic phase and Ct value≤32 and does not have logarithm rise period and Ct value＞35 at the amplification curve of RT-PCR reaction system H1N1 at the amplification curve of RT-PCR reaction system first type; It is positive that but judgement sample is an influenza A virus, and H1N1 (2009 is popular) influenza virus is negative;
If detecting sample does not have logarithm rise period and Ct value＞35 and at the amplification curve of RT-PCR reaction system H1N1 increased logarithmic phase and Ct value≤32 is arranged at the amplification curve of RT-PCR reaction system first type; Test-results is invalid; Check whole experiment flow, again test.
Quality control standard:
Negative quality control product: amplification curve does not have logarithm rise period or Ct value＞35;
Positive quality control product: amplification curve has obvious increased logarithmic phase, and Ct value≤30;
Need more than to require in once testing, satisfying simultaneously, otherwise this experiment is invalid, need carry out again.
Embodiment four: first type and H1N1 (2009) influenza virus combined nucleic acid real-time fluorescence detection kit
The test kit that influenza A virus of the present invention and H1N1virus combined nucleic acid real-time fluorescence detect; Comprise ROX correcting fluid, diethylpyrocarbonate (DEPC) water, negative control (irrelevant DNA; Like the human gene group DNA), first type positive control (clone has the plasmid PMD18-T of influenza A virus MP full length fragment), H1N1 positive control (clone has the plasmid PMD18-T of H1N1virus PA full length fragment), also comprise following composition:
(1) H1N1virus RT-PCR reaction solution comprises:
The RT-PCR damping fluid;
A pair of H1N1virus special primer,
Upstream primer: GGGRATTTTAGGATTTGTGTTCAC SEQ ID NO.1
Downstream primer: CCCATTWAGGGCATTTTGGA SEQ ID NO.2
TaqMan probe: SEQ ID NO.3
5’-FAM-ACCGTGCCCAGTGAGCGAGG-TAMARA-3’
(2) influenza A virus RT-PCR reaction solution comprises:
The RT-PCR damping fluid;
Upstream primer: TCAAAAGAAGTGAACGCCAAAA SEQ ID NO.4
Downstream primer: CAGGAACTTTGACCGCTGATG SEQ ID NO.5
TaqMan probe: SEQ ID NO.6
5’-FAM-ACGACACCACGCCCCCTCAGATT-TAMARA-3’
The TaqMan fluorescent probe is a kind of oligonucleotide probe, and fluorophor is connected 5 ' end of probe, and quencher is then at 3 ' end.Among the present invention, fluorophor adopts FAM (6-Fluoresceincarboxylic acid), and quencher adopts TAMARA (6-carboxyl tetramethylrhodamin).
(3) enzyme mixed solution is made up of with volume ratio mixing in 1: 1 Taq enzyme 5U/ μ l and reversed transcriptive enzyme 5U/ μ l.
Embodiment five: use ABI7300 fluorescent PCR appearance to positive quality control product in the test kit and negative quality control product detection method and result
1) take out test kit (seeing embodiment four), thaw in 4 ℃, each reagent is in for use with preceding 1000 rev/mins of low-speed centrifugals 1 minute
2) by following component preparing RT-PCR reaction solution (the reaction solution preparation is please carried out on ice).
The preparation of first type RT-PCR reaction solution:
Reagent usage quantity μ l
First type RT-PCR reaction solution 29
Enzyme mixed solution 2
ROX correcting fluid 1
Negative control/first type positive control 4
DEPC water 14
TV 50 μ l
The preparation of H1N1 RT-PCR reaction solution:
Reagent usage quantity μ l
H1N1 RT-PCR reaction solution 29
Enzyme mixed solution 2
ROX correcting fluid 1
Negative control/H1N1 positive control 4
DEPC water 14
TV 50 μ l
3) carry out real-time fluorescence single stage method RT-PCR reaction.
Set the PCR response procedures: 42 ℃ 5 minutes → 95 ℃ 10 seconds → 95 ℃ 5 seconds → 60 ℃ 31 seconds, wherein 95 ℃ 5 seconds → 60 ℃ were carried out 40 circulations between 31 seconds, selected the FAM on the fluorescent PCR appearance to detect.Used fluorescent PCR appearance is ABI7300.
4) test-results and analysis
The negative quality control product Ct of first type value is 0, and positive quality control product Ct value is 21, and the negative quality control product Ct of H1N1 value is 0, and positive quality control product Ct value is 21, the accord with expectation expectation, and test kit can be used for the detection of actual sample.
Embodiment six: use the detection of test kit of the present invention to actual sample
1) strain and source thereof
A/ws/33 (H1N1), A/hongkong/8/68 (H3N2) is provided by Chinese Academy of Sciences's Guangzhou biological medicine and health research institute; A/P2/8/34 (H1N1), Type B are that clinical isolated strain is provided by Guangzhou Inst. of Respiratory Diseases; H1N1 is provided by centers for disease control and prevention of the united states (CDC).Can above strain information be passed through http://www.ncbi.nlm.nih.gov/genomes/FLU/Database/select.cgi? Go=1 searches.
2) viral RNA extracts
A) the 200-400ul sample adds 0.5ml Trizol (throat swab source or virus-culturing fluid), concussion repeatedly, and suction is beneficial to lysis, and hatching is 5 minutes under the room temperature;
B) add the chloroform of 0.1ml and shaking to chylosis, hatching is 10 minutes under the room temperature, and under 4 ℃ of 12000rpm centrifugal 15 minutes, get supernatant, be transferred to another 1.5ml EP pipe;
C) add the Virahol of 0.1ml, hatching is 10 minutes under the room temperature, and under 4 ℃ of 12000rpm centrifugal 15 minutes, remove supernatant, pipe is upside down on the thieving paper, air-dry a little;
D) add 75% ethanol (the water preparation that DEPC handles) the washing RNA of 0.5ml, under 4 ℃ of 7500rpm centrifugal 5 minutes, be inverted on the thieving paper, remove after the supernatant and left standstill 5 minutes under the room temperature;
E) with DEPC water 20ul. dissolving RNA
F) measure RNA concentration and A260/A280.
Should be noted that whole leaching process carries out in Biohazard Safety Equipment, reagent is in precooling on ice; If RNA needs to use repeatedly, multigelation is avoided in the packing of please trying one's best.
3) using the ABI7300 quantitative real time PCR Instrument detects
A) take out test kit, thaw in 4 ℃, each reagent is in for use with preceding 1000 rev/mins of low-speed centrifugals 1 minute;
B) by following component preparing RT-PCR reaction solution (the reaction solution preparation is please carried out on ice).
The preparation of first type RT-PCR reaction solution:
Reagent uses μ l
First type RT-PCR reaction solution 29
Enzyme mixed solution 2
ROX correcting fluid 1
Negative control/first type positive control/total RNA 4
DEPC water 14
TV 50 μ l
The preparation of H1N1 RT-PCR reaction solution:
Reagent uses μ l
H1N1 RT-PCR reaction solution 29
Enzyme mixed solution 2
ROX correcting fluid 1
Negative control/H1N1 positive control/total RNA 4
DEPC water 14
TV 50 μ l
C) carry out Real Time One Step RT-PCR reaction.
Set the PCR response procedures: 42 ℃ 5 minutes → 95 ℃ 10 seconds → 95 ℃ 5 seconds → 60 ℃ 31 seconds, wherein 95 ℃ 5 seconds → 60 ℃ were carried out 40 circulations between 31 seconds, selected the FAM on the fluorescent PCR appearance to detect.Used fluorescent PCR appearance is ABI7300.
4) test-results and analysis
The Ct value that the first type detects A/ws/33/H1N1, A/hongkong/8/68 (H3N2), A/P2/8/34 (H1N1), H1N1, the clinical sample separation of Type B is respectively 20,23,28,26,0; It is positive to explain that the first type detects A/ws/33/H1N1, A/hongkong/8/68 (H3N2), A/P2/8/34 (H1N1), H1N1; It is negative to detect the Type B influenza virus, the expectation of test-results accord with expectation.
The Ct value that H1N1 detects A/ws/33/H1N1, A/hongkong/8/68 (H3N2), A/P2/8/34 (H1N1), the clinical sample separation of Type B is 0 respectively; It is 25 that H1N1 detects H1N1 Ct value; It is negative to explain that H1N1 detects A/ws/33/H1N1, A/hongkong/8/68 (H3N2), A/P2/8/34 (H1N1), Type B influenza virus; The detection H1N1 is positive, the expectation of test-results accord with expectation.
Sequence table (SEQUENCE LISTING)
< 110>Chinese Academy of Sciences Guangzhou Institute of Biomedicine and Health
< 120>H1N1virus and influenza A virus combined nucleic acid real-time fluorescence detection method and test kit
<130>
<160>6
<170>PatentIn?version?3.4
<210>1
<211>24
<212>DNA
< 213>synthetic
<400>1
gggratttta?ggatttgtgt?tcac 24
<210>2
<211>20
<212>DNA
< 213>synthetic
<400>2
cccattwagg?gcattttgga 20
<210>3
<211>20
<212>DNA
< 213>synthetic
<400>3
accgtgccca?gtgagcgagg 20
<210>4
<211>22
<212>DNA
< 213>synthetic
<400>4
tcaaaagaag?tgaacgccaa?aa 22
<210>5
<211>21
<212>DNA
< 213>synthetic
<400>5
caggaacttt?gaccgctgat?g 21
<210>6
<211>23
<212>DNA
< 213>synthetic
<400>6
acgacaccac gccccctcag?att ?23
Claims (1)
1. the test kit that detects of influenza A virus and H1N1virus combined nucleic acid real-time fluorescence; Comprise ROX correcting fluid, diethylpyrocarbonate water, negative control, influenza A virus positive control, H1N1 positive control; It is characterized in that, also comprise following composition:
H1N1 influenza virus by RT-PCR reaction solution comprises:
The RT-PCR damping fluid;
A pair of H1N1virus special primer, the sequence of upstream primer are SEQ ID NO.1, and the sequence of downstream primer is SEQ ID NO.2; And
, a H1N1virus TaqMan fluorescent probe, sequence is SEQ ID NO.3, and wherein, the fluorophor of 5 ' end is the 6-Fluoresceincarboxylic acid, and the quencher of 3 ' end is a 6-carboxyl tetramethylrhodamin;
And
Influenza A virus RT-PCR reaction solution comprises:
The RT-PCR damping fluid;
A pair of influenza A virus special primer, the sequence of upstream primer are SEQ ID NO.4, and the sequence of downstream primer is SEQ ID NO.5; And
, an influenza A virus TaqMan fluorescent probe, sequence is SEQ ID NO.6, and wherein, the fluorophor of 5 ' end is the 6-Fluoresceincarboxylic acid, and the quencher of 3 ' end is a 6-carboxyl tetramethylrhodamin;
And
The enzyme mixed solution is made up of with volume ratio 1:1 mixing Taq enzyme 5U/ μ l and reversed transcriptive enzyme 5U/ μ l.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910040954A CN101942524B (en) | 2009-07-08 | 2009-07-08 | Combined nucleic acid real-time fluorescent detection method for influenza A H1N1 virus and influenza A virus and kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910040954A CN101942524B (en) | 2009-07-08 | 2009-07-08 | Combined nucleic acid real-time fluorescent detection method for influenza A H1N1 virus and influenza A virus and kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101942524A CN101942524A (en) | 2011-01-12 |
| CN101942524B true CN101942524B (en) | 2012-10-03 |
Family
ID=43434730
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN200910040954A Expired - Fee Related CN101942524B (en) | 2009-07-08 | 2009-07-08 | Combined nucleic acid real-time fluorescent detection method for influenza A H1N1 virus and influenza A virus and kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101942524B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102586475B (en) * | 2012-01-18 | 2013-08-07 | 深圳市普瑞康生物技术有限公司 | Preparation method and application of gene chip for detecting important respiratory pathogenic viruses |
| CN103103287B (en) * | 2012-12-25 | 2014-11-26 | 中国疾病预防控制中心病毒病预防控制所 | Multigene-based influenza C virus real-time fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection reagent |
| CN110656163A (en) * | 2019-07-11 | 2020-01-07 | 北京金豪制药股份有限公司 | Double-label report fluorescent multiple pathogen nucleic acid detection method |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002033128A2 (en) * | 2000-10-18 | 2002-04-25 | Pharmasset Limited | Multiplex quantification of nucleic acids in diseased cells |
| CN1670219A (en) * | 2004-06-25 | 2005-09-21 | 深圳太太基因工程有限公司 | Primer and probe series for real time fluorescent RT-PCR detection of bird flu H9 subtype |
| CN1670220A (en) * | 2004-06-25 | 2005-09-21 | 深圳太太基因工程有限公司 | Primer and probe series for real time fluorescent RT-PCR detection of bird flu of H7 subtype |
| CN101363063A (en) * | 2007-08-10 | 2009-02-11 | 程小雯 | Primer, probe, kit and method for detecting A, B and H5 subtype influenza virus by triple fluorescent quantitative RT-PCR |
-
2009
- 2009-07-08 CN CN200910040954A patent/CN101942524B/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002033128A2 (en) * | 2000-10-18 | 2002-04-25 | Pharmasset Limited | Multiplex quantification of nucleic acids in diseased cells |
| CN1670219A (en) * | 2004-06-25 | 2005-09-21 | 深圳太太基因工程有限公司 | Primer and probe series for real time fluorescent RT-PCR detection of bird flu H9 subtype |
| CN1670220A (en) * | 2004-06-25 | 2005-09-21 | 深圳太太基因工程有限公司 | Primer and probe series for real time fluorescent RT-PCR detection of bird flu of H7 subtype |
| CN101363063A (en) * | 2007-08-10 | 2009-02-11 | 程小雯 | Primer, probe, kit and method for detecting A, B and H5 subtype influenza virus by triple fluorescent quantitative RT-PCR |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101942524A (en) | 2011-01-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111074011B (en) | Compositions, kits, methods and uses for detecting and typing viruses causing respiratory tract infections | |
| Bulterys et al. | Comparison of a laboratory-developed test targeting the envelope gene with three nucleic acid amplification tests for detection of SARS-CoV-2 | |
| CN101608242A (en) | A kind of H3 subtype flu quick-detecting type classifying method based on the RT-LAMP technology | |
| JP2018511339A (en) | Means for diagnosing, predicting or monitoring Pneumocystis pneumonia | |
| CN101633964B (en) | RNA detection kit for influenza A H1N1 virus | |
| CN102108418A (en) | Loop-mediated isothermal amplification detection method and kit for H1N1 influenza A viruses | |
| CN102337351A (en) | Typing detection kit for influenza virus | |
| Viedma et al. | Optimization of qRT-PCR assay for zika virus detection in human serum and urine | |
| Chagvardieff et al. | Prospective comparative study of characteristics associated with influenza A and B in adults | |
| CN101942524B (en) | Combined nucleic acid real-time fluorescent detection method for influenza A H1N1 virus and influenza A virus and kit | |
| CN102534051B (en) | Kit for detecting enterovirus | |
| CN101921870B (en) | Nucleotide sequence, method and kit for detecting human influenza A virus | |
| TW202018093A (en) | Method for influenza a virus and influenza b virus detection | |
| CN102206713B (en) | Triple fluorescence quantitative reverse transcription-polymerase chain reaction (RT-PCR) detection kit and use thereof | |
| CN101649356A (en) | Fluorescent quantitative detection kit of H1N1 influenza virus A and detection method thereof | |
| CN102251061A (en) | Nucleic acid dual fluorescence PCR (Polymerase Chain Reaction) detection kit for influenza A/B virus | |
| WO2015171510A2 (en) | Circulatory micrornas (mirnas) as biomarkers for diabetic retinopathy (dr) and age-related macular degeneration (amd) | |
| CN101886139A (en) | Double-color fluorescence polymerase chain reaction (PCR) detection method of novel influenza A virus H1N1 subtype and kit thereof | |
| CN102146474A (en) | T2DM (Type 2 Diabetes Mellitus) detection primer group, PCR (Polymerase Chain Reaction) chip and detection method for human and monkeys | |
| CN101942387A (en) | Nucleic acid nano-gold biosensor for detecting influenza A viruses and influenza A (H1N1) viruses | |
| CN104593486A (en) | Primer, probe and kit all used for detecting blood fluke | |
| CN104593357A (en) | Nucleic acid for enterovirus detection, and applications thereof | |
| CN102230023A (en) | Dual fluorescence quantification RT-PCR detection kit and application thereof | |
| CN104450955B (en) | Eurasian class fowl type H1N1 swine influenza virus fluorescence quantitative RT-PCR detecting kit and its application | |
| CN101886136B (en) | Kit for detecting H1N1 influenza A virus by real-time fluorescence RT-PCR |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20121003 Termination date: 20140708 |
|
| EXPY | Termination of patent right or utility model |