CN104450955B - Eurasian class fowl type H1N1 swine influenza virus fluorescence quantitative RT-PCR detecting kit and its application - Google Patents
Eurasian class fowl type H1N1 swine influenza virus fluorescence quantitative RT-PCR detecting kit and its application Download PDFInfo
- Publication number
- CN104450955B CN104450955B CN201410641147.9A CN201410641147A CN104450955B CN 104450955 B CN104450955 B CN 104450955B CN 201410641147 A CN201410641147 A CN 201410641147A CN 104450955 B CN104450955 B CN 104450955B
- Authority
- CN
- China
- Prior art keywords
- influenza virus
- swine influenza
- eurasian
- fowl type
- class fowl
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of Eurasian class fowl type H1N1 swine influenza virus fluorescent quantitation RT PCR detection kits and its applications.The present invention is compared by multiple sequence, for the conservative gene segment of Eurasian class fowl type H1N1 swine influenza virus, H1N1 (2009) swine influenza virus, classic H1N1 swine influenza virus and people source H1N1 swine influenza virus, the primer and probe of the Eurasian class fowl type H1N1 swine influenza virus of detection of high specificity is designed, is detected for real-time fluorescence RT PCR.The experimental results showed that detecting Eurasian class fowl type H1N1 swine influenza virus using kit provided by the present invention, specificity is high, to viral RNA detection sensitivity up to 4.6 × 10‑7Ng/ reacts, Nasal swabs, lungs that not only can be to swinery to be measured, the tissue samples such as tracheae are detected, also detectable chick embryo allantoic liquid, easy to operate, easy popularization, it operates and applies convenient for base, the useful detection instrument of Eurasian class fowl type H1N1 swine influenza virus disease diagnosis and epidemiological survey can be become.
Description
Technical field
The present invention relates to a kind of Eurasian class fowl type H1N1 swine influenza virus real-time fluorescence detection method of identification and kits.This
Invention belongs to biotechnology.
Background technology
Swine flu (Swine influenza, SI) is the acute respiration road transmission of a boar as caused by influenza A
Disease.Popular swine influenza virus (Swine influenza virus, SIV) is including 3 kinds of main hypotypes all over the world：H1N1、
H3N2 and H1N2 hypotypes, wherein again including different genotype：Classic H1N1 [Classical swine H1N1
Influenza A virus, (CS) H1N1], people source H1N1 influenza viruses [Human H1N1 influenza A virus,
(hu) H1N1], Eurasia class fowl type H1N1 [Eurasian avian-like swine H1N1, (EA) H1N1], H1N1 stream
Influenza Virus [pandemic (H1N1) 2009, pH1N1/2009], people source H3N2, the H3N2 of gene rearrangement and polygene type
H1N2 hypotypes etc..Since SIV self-discoveries, stable genetic pedigree has been established in China swinery.Swine influenza virus can be led
Cause pig breathing problem, characterized by high incidence and low actual, be seriously affect pig breeding industry development it is a kind of important
Infectious disease.The airway epithelial of pig has the receptor of human influenza virus and avian influenza virus, it is considered to be " the mixing of influenza virus
Device ".Research shows that after the same host of different subtype influenza infection, can gene weight be passed through with the rearrangement of producer segment
Row is it is possible that generate highly pathogenic strain and high transmission capacity strain.China is animal influenza country occurred frequently, and animals and human beings contact
Frequently, animal influenza virus can be broadcast to people across species barrier under certain condition, and can adapt to people as host, into
One step may cause it is interpersonal between propagation.Pig is fowl, pig, the common susceptible host of human influenza virus, it is considered to be the stream of people is susceptible
The mixer of poison and avian influenza virus, these viruses can producer rearrangements in pig body.Swine influenza virus HA Binding site of receptor
Point (RBS) has the binding specificity identical with people, avian influenza virus receptor, determine SIV not only can infected pigs, while also have
There are infection fowl and the ability of the mankind.The influenza virus of a variety of hypotypes in China and same hypotype, the collaboration of different genotype virus
The epidemic status coexisted for virus further in pig body producer become exclusive or gene resortment provide advantage with it is important
Place.H1 hypotypes swine influenza virus was once the donor of human world flu outbreak strain.1986 so far the whole world share 6 people
Infect (EA) H1N1 influenza viruses report, wherein China 2010 with there is within 2012 two people to infect (EA) H1N1 events respectively,
Not yet cause big prevalence in crowd at present；But studies have reported that antibody level is insufficiently resistant to (EA) H1N1 diseases in title crowd
Poison attack.2005 so far, and sustainability monitors (EA) H1N1 influenza viruses in China swinery, at present and pH1N1/2009
Influenza virus is cooperatively popular in China swinery, is the widest advantage strain of Epidemic Scope.Meanwhile in China swinery
Also there is (EA) H1N1 and reset the recombinant virus generated with pH1N1/2009 viruses producer, the prevalence of these viruses is to me
While state's pig breeding industry development causes huge economic loss, serious threat also is caused to the life and health of the mankind,
Therefore, a kind of detection kit for Eurasian class fowl type (EA) H1N1 hypotype swine influenza virus is established, can both meet swinery stream
The needs of Influenza Virus monitoring, and a kind of effective detection method can be provided for the early warning of human world flu outbreak.SIV is diagnosed at present
Aspect also has a large amount of research report, but research contents is only limitted to general-purpose genetic detection and hypotype detection, is flowed according to China SI
Row disease learns investigation, there are the differences such as (EA) H1N1, pH1N1/2009, (CS) H1N1 and (Hu) H1N1 in China swinery at present
The H1 hypotype SIV of pedigree, wherein (EA) H1N1, pH1N1/2009 is advantage strain, but currently without (EA) can be distinguished completely
H1N1 and pH1N1/2009 quantitative fluorescent PCR diagnostic methods.The quantitative fluorescent PCR that this research is established in China swinery it is intended that deposit
(EA) H1N1 rapid differential diagnosis providing methods.
Invention content
The object of the present invention is to provide a kind of Eurasian class fowl type H1N1 swine influenza virus real-time fluorescence detection method of identification and
Kit.
A kind of Eurasian class fowl type H1N1 swine influenza virus fluorescence quantitative RT-PCR detecting kits of the present invention, feature exist
In including a pair of of specific primer and fluorescence probe, the specific primer is made of sense primer and downstream primer, the spy
Specific primer and fluorescence probe sequence are as follows：
Sense primer：5’-CTCAGCAAGTCATACACAA-3’；(SEQ ID NO.1)
Downstream primer：5’-CTGGTAGAGGGTTTGTTG-3’；(SEQ ID NO.2)
Specific probe：5 '-F-CACCACCCTCCGACCGACAG-Q-3 ', wherein F are fluorescent reporter group, and Q is fluorescence
Quenching group (SEQ ID NO.3).
In the present invention, it is preferred to, further include PCR buffer solutions in the kit, deoxynucleotide triphosphates mixture,
Archaeal dna polymerase, reverse transcriptase and RNase inhibitor, these components belong to common knowledge to those skilled in the art,
It can select as needed.
In the present invention, it is preferred to, the reverse transcriptase is M-MLV reverse transcriptases.
In the present invention, it is preferred to, the DNA of Eurasian class fowl type H1N1 swine influenza virus genes is further included in the kit
Standard items, the nucleotide sequence of the standard items are as follows：
5’TCCTATCCTAAGCTCAGCAAGTCATACACAAACAATAAGGGAAAGGAAGTGCTTGTAATTTGGGGAG
TGCACCACCCTCCGACCGACAGTGACCAACAAA 3 ' (shown in SEQ ID NO.4).
In the present invention, it is preferred to, one of following group of selected as of F and Q in the specific probe：F is FAM, and Q is
BHQl；F is VIC, Q BHQl；F is TAMRA, Q BHQ2；F is ROX, Q BHQ2；F is CY5, Q BHQ3.
Further, the invention also provides the kit described in any of the above item is preparing identification or auxiliary identification Eurasia
Application in class fowl type H1N1 influenza virus reagents.
The preparation method of above-mentioned Specific PCR primers pair and TaqMan fluorescence probes also belongs to protection scope of the present invention.
The preparation method specifically may include three single stranded DNAs point described in the Specific PCR primers pair and TaqMan fluorescence probes
The step of not packing not individually.
Specific PCR primers pair and TaqMan fluorescence probe provided by the present invention can detect the class fowl type of separate sources
H1N1 influenza viruses are especially suitable for the Eurasian class fowl type H1N1 swine influenza virus of detection.
Specific PCR primers pair and TaqMan fluorescence probe provided by the present invention is used to detect Eurasian class fowl type H1N1 pigs
The specificity of influenza virus is high, to viral RNA detection sensitivity up to 4.6 × 10-7Ng/ reacts, not only can be to swinery to be measured
Nasal swabs, the tissue samples such as lungs, tracheae be detected, also detectable chick embryo allantoic liquid, easy to operate, easy popularization,
It operates and applies convenient for base, the useful of Eurasian class fowl type H1N1 swine influenza virus disease diagnosis and epidemiological survey can be become
Detection instrument.
Description of the drawings
Fig. 1 is the specificity inspection of the Eurasian class fowl type H1N1 Specific PCR primers pair and TaqMan fluorescence probes of the present invention
Survey result；
1：(EA)H1N1 RNA；2：(CS)H1N1 RNA；3：pH1N1/2009、(Hu)H1N1、H1N2、H3N2、H5N1、
H9N2, PRRSV RNA and negative control.
Fig. 2 is the Eurasian class fowl type H1N1 Specific PCR primers pair of the present invention and TaqMan fluorescence probe sensitivity Detections
As a result；
By carrying out 10 times of gradient dilutions to 4.6 × 10 to 456ng viral RNAs-7Ng/ reacts, for carrying out sensibility examination
It tests, minimum detectable content is 4.6 × 10-7The viral RNA of ng/ reactions.
1：(EA) H1N1RNA 456ng/ react；2：45.6ng/ reacts；3：4.6ng/ reaction；4：4.6×10-1Ng/ is anti-
It should；5：4.6×10-2Ng/ reacts；6：4.6×10-3Ng/ reacts；7：4.6×10-4Ng/ reacts；8：4.6×10-5Ng/ reacts；
9：4.6×10-6Ng/ reacts；10：4.6×10-7Ng/ reacts
Fig. 3 is the result that the fluorescent quantitative RT-PCR method established using the present invention is detected clinical sample.
Specific embodiment
The forgoing and additional technical features and advantages are described in more detail with reference to embodiments.It should
Understand, embodiments discussed below is only described the preferred embodiment of the present invention, not to the present invention's
Range is defined, and under the premise of design spirit of the present invention is not departed from, those of ordinary skill in the art are to the technology of the present invention
The various modifications and improvement that scheme is made should all be fallen into the protection domain that claims of the present invention determines.Following embodiments
Used in experimental method unless otherwise specified, be conventional method.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
Virus stain information is as shown in table 1 used in following embodiments:
1 strain name of table and type
Embodiment 1, fluorescence quantitative RT-PCR primer pair and fluorescence probe design
Eurasian class fowl type H1N1 swine influenza virus, H1N1 all over the world has been downloaded from the NCBI gene pools in the U.S.
(2009) the HA genes of swine influenza virus, classic H1N1 swine influenza virus and people source H1N1 swine influenza virus, carry out it
Tetraploid rice designs the detection Eurasia class fowl type H1N1 pigs stream of high specificity in all influenza virus gene group HA gene regions
The primer and probe of Influenza Virus, sequence are as follows：
Sense primer：AlikeH1F 5’-CTCAGCAAGTCATACACAA-3’(SEQ ID NO.1)
Downstream primer：AlikeH1R 5’-CTGGTAGAGGGTTTGTTG-3’(SEQ ID NO.2)
Specific probe：5 '-F-CACCACCCTCCGACCGACAG-Q-3 ' of AlikeH1MGB probes (SEQ ID NO.3).
Embodiment 2, the specific detection of fluorescence quantitative RT-PCR primer pair
1st, Total RNAs extraction
1：(EA)H1N1；2：(CS)H1N1；3：pH1N1/2009、(Hu)H1N1、H1N2、H3N2、H5N1、H9N2、PRRS
Virus.The extraction of viral RNA can be carried out conventionally, and (the RNeasy Mini of German QIAGEN companies can also be used
Kit, 74104) other kits or are separately bought；It is extracted by kit specification, obtains viral RNA and carry out next step experiment.
2nd, fluorescence quantitative RT-RCR augmentation detection primer pair and the specificity of probe
Sample to be tested RNA is extracted as template using step 1, reaction system is configured to following material mixing with one-step method and carries out
PCR reacts：Specific primer and fluorescence probe, PCR buffer solutions, deoxynucleotide triphosphates mixture and archaeal dna polymerase, reverse transcription
Enzyme, RNase inhibitor；Reaction product is placed in quantitative PCR apparatus and carries out fluoroscopic examination；The specific primer and fluorescence probe sequence
It is as follows：Sense primer：AlikeH1F 5 '-CTCAGCAAGTCATACACAA-3 ', downstream primer：AlikeH1R 5’-
CTGGTAGAGGGTTTGTTG-3 ', specific probe：5 '-F-CACCACCCTCCGACCGACAG-Q- of AlikeH1 MGB probes
3 ' wherein F are fluorescent reporter group, and Q is fluorescent quenching group；The F is FAM；Q is BHQ1.
Fluoroscopic examination model F AM is selected, the adjustment of fluorescence baseline takes the fluorescence signal average value of 3~15 cycles, and threshold value is set
The fixed peak that normal negative controls are just above with threshold line, sample are in typical amplification curve, and in good logarithm
Increase, be judged as the positive.Without typical amplification curve, it is judged as feminine gender.The fluorescence RT-PCR method that the present invention establishes is to Eurasia
Class fowl H1N1 swine influenza virus has stronger specificity, and the pH1N1/2009 of same period prevalence, classic H1N1, class is human-like
The no cross reaction (see Fig. 1) such as H1N1, H1N2, H3N2, H5N1, H9N2 hypotype swine influenza virus and PRRS viruses.
Above-mentioned steps (1) sample RNA extraction method uses the RNeasyMini Kit (74104) of QIAGEN companies of Germany,
It is carried out according to kit specification extraction.
Above-mentioned steps (2) PCR reaction systems using ABI One-Step RT-PCR Kit reagents (P/N AM1005) according to
Following reaction system carries out：4 μ l of step (1) RNA, each 1 μ l of upstream and downstream primer (10 pmol/ μ l), TaqMan probe (5
pmol/μl)0.24μl、25xRT-PCR Enzyme Mix 1μl、Detection Enhancer 1μl、Nuclease-free
Water 2.26μl.Real Time RT-PCR reaction conditions：1:50℃30m in；2:95℃10min；3:95 DEG C of 15s, 60 DEG C
60s, 40 cycles.Single-point fluoroscopic examination is carried out at 60 DEG C, carries out 40 cycles altogether.
3rd, sensitivity tests
To Eurasian class fowl type H1N1 swine influenza virus strains, using viral RNA content quantitative, by its 10 times of gradient dilutions,
Viral extraction RNA is completed according to step (1).It is detected with fluorescent quantitative RT-PCR method, as a result fluorescence PCR method detection is quick
Perception reaches 4.6 × 10-7Ng/ is reacted (see Fig. 2).
4th, repetitive test
Same sample carries out repeating to expand experiment between group in 5 groups under the same conditions, measures the repeatability of this method.
By statistical analysis, the coefficient of variation is 1.1 ± 0.5% in repeat amplification protcol experiment Ct value groups, between-group variation coefficient 1 ±
0.4%, CV value can refer to the following contents and inferred：When CV values are less than 1%, represent that data discrete degree is smaller；1%~
Between 2%, represent that data discrete degree is normal；2%~3%, represent that data discrete degree still receives；When more than 4%, represent
Data discrete degree is larger.The study show that fluorescent quantitative PCR detection method is reproducible, stability is high (table 2).
The group of 2 real-time fluorescence quantitative PCR of table is interior, repeated experiment result (n=5) between group
5th, the detection of clinical sample
With the fluorescence quantitative RT-RCR diagnostic method established of the present invention, in the recent period in chicken embryo or mdck cell culture
There are 5 parts of Nasal swabs samples of HA activity, by showing HA gene sequencing wherein 5 parts containing (EA) H1, remaining virus purification
Negative sample is detected.It 1 is (EA) HA positive controls that the results are shown in Figure 3, and 2~6 is positive for Eurasian class fowl type HA, 7~16
Number for Eurasian class fowl type HA negative samples.
Claims (6)
1. a kind of Eurasia class fowl type H1N1 swine influenza virus fluorescence quantitative RT-PCR detecting kits, it is characterised in that including a pair
Specific primer and fluorescence probe, the specific primer are made of sense primer and downstream primer, the specific primer and
Fluorescence probe sequence is as follows：
Sense primer：5’-CTCAGCAAGTCATACACAA-3’；
Downstream primer：5’-CTGGTAGAGGGTTTGTTG-3’；
Specific probe：5 '-F-CACCACCCTCCGACCGACAG-Q-3 ', wherein F are fluorescent reporter group, and Q is fluorescent quenching
Group.
2. kit as described in claim 1, it is characterised in that further include PCR buffer solutions, deoxynucleotide triphosphates mixture,
Archaeal dna polymerase, reverse transcriptase and RNase inhibitor.
3. kit as claimed in claim 2, it is characterised in that the reverse transcriptase is M-MLV reverse transcriptases.
4. kit as claimed in claim 1 or 2, it is characterised in that further include Eurasian class fowl type H1N1 swine influenza virus genes
DNA standard items, the nucleotide sequence of the standard items is as shown in SEQ ID NO.4.
5. kit as described in claim 1, it is characterised in that in the specific probe following group of the selected as of F and Q it
One：F is FAM, Q BHQl；F is VIC, Q BHQl；F is TAMRA, Q BHQ2；F is ROX, Q BHQ2；F is CY5, and Q is
BHQ3。
6. claim 1-5 any one of them kit is preparing identification or the Eurasian class fowl type H1N1 influenza viruses of auxiliary identification
Application in reagent.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410641147.9A CN104450955B (en) | 2014-11-12 | 2014-11-12 | Eurasian class fowl type H1N1 swine influenza virus fluorescence quantitative RT-PCR detecting kit and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410641147.9A CN104450955B (en) | 2014-11-12 | 2014-11-12 | Eurasian class fowl type H1N1 swine influenza virus fluorescence quantitative RT-PCR detecting kit and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104450955A CN104450955A (en) | 2015-03-25 |
| CN104450955B true CN104450955B (en) | 2018-06-15 |
Family
ID=52897700
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410641147.9A Active CN104450955B (en) | 2014-11-12 | 2014-11-12 | Eurasian class fowl type H1N1 swine influenza virus fluorescence quantitative RT-PCR detecting kit and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104450955B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104745713A (en) * | 2015-04-21 | 2015-07-01 | 天津出入境检验检疫局动植物与食品检测中心 | Duplex fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection reagent for nipah virus and swine influenza virus (SIV) as well as preparation method and application of duplex fluorescent RT-PCR detection reagent |
| CN106435036B (en) * | 2016-12-13 | 2020-07-28 | 拱北海关技术中心 | Fluorescent PCR (polymerase chain reaction) primer and probe for detecting influenza D virus and detection method |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103571974A (en) * | 2013-09-30 | 2014-02-12 | 广西壮族自治区动物疫病预防控制中心 | RT-PCR (Reverse Transcription-Polymerase Chain Reaction) primer for detecting poultry-like type H1N1 swine influenza virus and kit |
-
2014
- 2014-11-12 CN CN201410641147.9A patent/CN104450955B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103571974A (en) * | 2013-09-30 | 2014-02-12 | 广西壮族自治区动物疫病预防控制中心 | RT-PCR (Reverse Transcription-Polymerase Chain Reaction) primer for detecting poultry-like type H1N1 swine influenza virus and kit |
Non-Patent Citations (2)
| Title |
|---|
| Establishment of a multiplex RT-PCR assay to detect different lineages of swine H1 and H3 influenza A viruses;Guanghua Fu, et al.;《Virus Genes》;20100811;第41卷(第2期);第236页摘要，第238页表2 * |
| 欧亚类禽Ｈ１Ｎ１与古典Ｈ１Ｎ１亚型猪流感病毒ＮＡ基因遗传进化分析;王伟利 等;《中国兽医学报》;20140415;第34卷(第4期);第536-540页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104450955A (en) | 2015-03-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2021196498A1 (en) | Primer, probe and kit for detecting novel coronavirus | |
| CN111074011B (en) | Compositions, kits, methods and uses for detecting and typing viruses causing respiratory tract infections | |
| Corman et al. | Performance and clinical validation of the RealStar® MERS-CoV Kit for detection of Middle East respiratory syndrome coronavirus RNA | |
| CN110257562A (en) | Primer and probe combination for RAA-LFD detection of avian infectious laryngotracheitis virus and application thereof | |
| CN102277454A (en) | Primers, probes and assay kit for detecting transmissible gastroenteritis viruses and porcine epidemic diarrhea viruses | |
| CN103275862A (en) | Fluorescent quantitative reverse transcription-polymerase chain reaction (RT-PCR) kit for detecting influenza A virus subtype H7N9 | |
| CN101633964B (en) | RNA detection kit for influenza A H1N1 virus | |
| CN106636472B (en) | Complete set of reagent and method for detecting avian influenza virus and chicken parvovirus | |
| CN105112559A (en) | Kit for detecting coronavirus and application of kit | |
| CN103757139A (en) | Canine distemper virus and canine parvovirus duplex TaqMan-MGB fluorescent quantitative PCR (polymerase chain reaction) detection kit and detection method thereof | |
| Laamiri et al. | Accurate detection of avian respiratory viruses by use of multiplex PCR-based luminex suspension microarray assay | |
| CN105349697A (en) | GeXP quick detection kit capable of identifying eight different human-infected hypotype avian influenza virus HA genes at same time and application of GeXP quick detection kit | |
| CN103740863B (en) | RT-LAMP (Reverse Transcription Loop-Mediated Isothermal Amplification) kit for detecting avian influenza virus subtype H7N9 | |
| CN103255232B (en) | Dual fluorescence RT (Reverse Transcription)-PCR (Polymerase Chain Reaction) detection kit and method for avian influenza H7N9 virus | |
| CN104450956A (en) | Real-time fluorescence RT-PCR detection kit for H1N1 type A swine influenza virus and application of detection kit | |
| CN101649356A (en) | Fluorescent quantitative detection kit of H1N1 influenza virus A and detection method thereof | |
| CN104450955B (en) | Eurasian class fowl type H1N1 swine influenza virus fluorescence quantitative RT-PCR detecting kit and its application | |
| CN101392299B (en) | Equine influenza detection kit and detection method | |
| CN103320530B (en) | H1N1/H5N1 type avian influenza virus detection kit and application thereof | |
| Li et al. | Simultaneous detection of eight avian influenza A virus subtypes by multiplex reverse transcription-PCR using a GeXP analyser | |
| CN104561383A (en) | Influenza A virus and B virus joint detection primer, probe, kit and application | |
| CN103215389B (en) | Porcine reproductive and respiratory syndrome and porcine Japanese B encephalitis dual one-step RT-PCR (Reverse Transcription-Polymerase Chain Reaction) diagnosis kit | |
| CN103103287A (en) | Multigene-based influenza C virus real-time fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection reagent | |
| CN102230023A (en) | Dual fluorescence quantification RT-PCR detection kit and application thereof | |
| CN102676697A (en) | Primers and probe for detecting peste des petits ruminants virus and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant |