CN104450955A - Fluorescence quantification RT-PCR (reverse transcription-polymerase chain reaction) detection kit of Eurasian avian-like type H1N1 swine influenza virus and application thereof - Google Patents
Fluorescence quantification RT-PCR (reverse transcription-polymerase chain reaction) detection kit of Eurasian avian-like type H1N1 swine influenza virus and application thereof Download PDFInfo
- Publication number
- CN104450955A CN104450955A CN201410641147.9A CN201410641147A CN104450955A CN 104450955 A CN104450955 A CN 104450955A CN 201410641147 A CN201410641147 A CN 201410641147A CN 104450955 A CN104450955 A CN 104450955A
- Authority
- CN
- China
- Prior art keywords
- influenza virus
- swine influenza
- type
- eurasian
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a fluorescence quantification RT-PCR (reverse transcription-polymerase chain reaction) detection kit of a Eurasian avian-like type H1N1 swine influenza virus and an application thereof. By virtue of multiple alignments of sequences, and aiming at conserved gene segments of the Eurasian avian-like type H1N1 swine influenza virus, an A(H1N1) (2009) swine influenza virus, a classical type H1N1 swine influenza virus and a human-derived H1N1 swine influenza virus, a primer and a probe with strong specificity for detecting the Eurasian avian-like type H1N1 swine influenza virus are designed and are used for performing real-time fluorescence RT-PCR detection. Experiment results show that by using the kit provided by the invention to detect the Eurasian avian-like type H1N1 swine influenza virus, the specificity is high, and the detection sensitivity to virus RNA (ribonucleic acid) can reach 4.6*10<-7>ng/reaction, so that tissue samples of nasal swabs, lungs, tracheas and the like of a to-be-detected swine herd can be detected, and chick embryo allantoic fluid can also be detected. The kit is simple to operate, easy to popularize and convenient in basic-level operation and application, and can become a useful detection tool for epidemic disease diagnosis of the Eurasian avian-like type H1N1 swine influenza virus and epidemiologic investigations.
Description
Technical field
The present invention relates to the Eurasian class fowl type H1N1 swine influenza virus real-time fluorescence detection method of a kind of qualification and test kit.The invention belongs to biological technical field.
Background technology
Porcine influenza (Swine influenza, SI) is the Acute respiratory infectious disease of the boar caused by influenza A.Popular swine influenza virus (Swine influenza virus all over the world, SIV) 3 kinds of main hypotypes are comprised: H1N1, H3N2 and H1N2 hypotype, wherein comprise again different genotype: classic H1N1 [Classicalswine H1N1 influenza A virus, (CS) H1N1], people source H1N1 influenza virus [Human H1N1 influenza A virus, (hu) H1N1], Eurasian class fowl type H1N1 [Eurasian avian-like swine H1N1, (EA) H1N1], H1N1virus [pandemic (H1N1) 2009, pH1N1/2009], people source H3N2, the H3N2 of gene rearrangement and the H1N2 hypotype etc. of polygene type.Since SIV self-discovery, in China swinery, establish stable genetic pedigree.Swine influenza virus can cause the respiratory tract disease of pig, with high incidence and low actual for feature, is a kind of important transmissible disease having a strong impact on pig industry development.The airway epithelial of pig has the acceptor of human influenza virus and avian influenza virus, is considered to " mixing tank " of influenza virus.Research shows, after the same host of different subtype influenza infection, can the rearrangement of producer fragment, and likely produce highly pathogenic strain and high transmission capacity strain by gene rearrangement.China is animal influenza country occurred frequently, and animals and human beings contact is frequent, and animal influenza virus can be crossed over species barrier under certain condition and be propagated to people, and may adapt to people as host, may cause further interpersonal between propagation.Pig is fowl, pig, the common susceptible host of human influenza virus, is considered to the mixing tank of human influenza virus and avian influenza virus, and these viruses can be reset by producer in pig body.Swine influenza virus HA receptor binding site (RBS) has and people, binding specificity that avian influenza virus acceptor is identical, and determining SIV not only can infected pigs, also has the ability infecting fowl and the mankind simultaneously.The influenza virus of the multiple hypotype of China and same hypotype, different genes C-type virus C work in coordination with the epidemic status coexisted be virus further in pig body producer variation or gene resortment provide favourable condition and important place.H1 hypotype swine influenza virus was once the donor of human world flu outbreak strain.1986 so far the whole world have 6 routine people and infect (EA) H1N1 influenza viruses report, wherein China 2010 with within 2012, have two routine people to infect (EA) H1N1 event respectively, not yet cause large popular at present in crowd; But studies have reported that in title crowd, antibody horizontal is not enough to the attack of opposing (EA) H1N1 virus.2005 so far, and in China swinery, sustainability monitors (EA) H1N1 influenza virus, and current and pH1N1/2009 influenza virus is cooperatively popular in the middle of China swinery, is Epidemic Scope advantage strain the most widely.Simultaneously, also occurred in China swinery that (EA) H1N1 and pH1N1/2009 virus producer resets the recombinant virus produced, while these viruses popular causes huge financial loss to the development of China pig industry, also serious threat is caused to the life and health of the mankind, therefore, set up a kind of detection kit for Eurasian class fowl type (EA) H1N1 hypotype swine influenza virus, both can meet the needs of swinery influenza virus monitoring, the early warning that can be again human world flu outbreak provides a kind of effective detection method.Current SIV diagnosis aspect also has large quantifier elimination to report, but research contents is only limitted to general-purpose genetic to be detected and hypotype detection, according to China SI epidemiology survey situation, the H1 hypotype SIV of the different pedigree such as (EA) H1N1, pH1N1/2009, (CS) H1N1 and (Hu) H1N1 is there is in current China swinery, wherein (EA) H1N1, pH1N1/2009 is advantage strain, but can not distinguish (EA) H1N1 and pH1N1/2009 quantitative fluorescent PCR diagnostic method completely at present.The quantitative fluorescent PCR that this research is set up is intended to (EA) H1N1 rapid differential diagnosis supplying method for existing in China swinery.
Summary of the invention
The object of this invention is to provide the Eurasian class fowl type H1N1 swine influenza virus real-time fluorescence detection method of a kind of qualification and test kit.
One of the present invention Eurasian class fowl type H1N1 swine influenza virus fluorescence quantitative RT-PCR detecting kit, it is characterized in that comprising a pair Auele Specific Primer and fluorescent probe, described Auele Specific Primer is made up of upstream primer and downstream primer, described Auele Specific Primer and fluorescent probe sequence as follows:
Upstream primer: 5 '-CTCAGCAAGTCATACACAA-3 '; (SEQ ID NO.1)
Downstream primer: 5 '-CTGGTAGAGGGTTTGTTG-3 '; (SEQ ID NO.2)
Specific probe: 5 '-F – CACCACCCTCCGACCGACAG – Q-3 ', wherein F is fluorescent reporter group, and Q is fluorescent quenching group (SEQ ID NO.3).
In the present invention, preferably, PCR damping fluid is also comprised in described test kit, deoxynucleotide triphosphates mixture, archaeal dna polymerase, reversed transcriptive enzyme and RNA enzyme inhibitors, these components belong to common practise to those skilled in the art, can select as required.
In the present invention, preferably, described reversed transcriptive enzyme is M-MLV reversed transcriptive enzyme.
In the present invention, preferably, also comprise the DNA standard substance of Eurasian class fowl type H1N1 swine influenza virus gene in described test kit, the nucleotide sequence of described standard substance is as follows:
5 ' TCCTATCCTAAGCTCAGCAAGTCATACACAAACAATAAGGGAAAGGAAGTGCTTGT AATTTGGGGAGTGCACCACCCTCCGACCGACAGTGACCAACAAA 3 ' (shown in SEQ ID NO.4).
In the present invention, preferably, in described specific probe F and Q be chosen as one of following group: F is FAM, Q is BHQl; F is VIC, Q is BHQl; F is TAMRA, Q is BHQ2; F is ROX, Q is BHQ2; F is CY5, Q is BHQ3.
Further, the invention allows for the application of test kit in characterization or assistant identification Eurasian class fowl type H1N1 influenza virus reagent described in above any one.
Above-mentioned Specific PCR primers to and the preparation method of TaqMan fluorescent probe also belong to protection scope of the present invention.This preparation method specifically can comprise by described Specific PCR primers to and TaqMan fluorescent probe described in three single stranded DNAs step of individually packing.
Specific PCR primers provided by the present invention to and TaqMan fluorescent probe can detect the class fowl type H1N1 influenza virus of different sources, be especially applicable to detecting Eurasian class fowl type H1N1 swine influenza virus.
Specific PCR primers provided by the present invention to and TaqMan fluorescent probe high for the specificity detecting Eurasian class fowl type H1N1 swine influenza virus, can 4.6 × 10 be reached to viral RNA detection sensitivity
-7ng/ reacts, not only can to the Nasal swabs of swinery to be measured, lungs, the tissue samples such as tracheae detect, also chick embryo allantoic liquid can be detected, simple to operate, easily promote, be convenient to basic unit's operation and application, the useful testing tool of Eurasian class fowl type H1N1 swine influenza virus disease diagnosis and epidemiology survey can be become.
Accompanying drawing explanation
Fig. 1 be Eurasian class fowl type H1N1 Specific PCR primers of the present invention to and the specific detection result of TaqMan fluorescent probe;
1:(EA) H1N1 RNA; 2:(CS) H1N1 RNA; 3:pH1N1/2009, (Hu) H1N1, H1N2, H3N2, H5N1, H9N2, PRRSV RNA and negative control.
Fig. 2 be Eurasian class fowl type H1N1 Specific PCR primers of the present invention to and TaqMan fluorescent probe sensitivity Detection result;
By carrying out 10 times of gradient dilution to 4.6 × 10 to 456ng viral RNA
-7ng/ reacts, and for carrying out sensitivity test, minimumly detects that content is 4.6 × 10
-7the viral RNA of ng/ reaction.
1:(EA) H1N1RNA 456ng/ reacts; 2:45.6ng/ reaction; 3:4.6ng/ reaction; 4:4.6 × 10
-1ng/ reacts; 5:4.6 × 10
-2ng/ reacts; 6:4.6 × 10
-3ng/ reacts; 7:4.6 × 10
-4ng/ reacts; 8:4.6 × 10
-5ng/ reacts; 9:4.6 × 10
-6ng/ reacts; 10:4.6 × 10
-7ng/ reacts
Fig. 3 is the result that the fluorescent quantitative RT-PCR method adopting the present invention to set up detects clinical sample.
Embodiment
Below in conjunction with embodiment to above-mentioned being described in more detail with other technical characteristic and advantage of the present invention.Should be understood that; the embodiment of the following stated; only that the preferred embodiment of the present invention is described; not scope of the present invention is limited; under not departing from the present invention and designing the prerequisite of spirit; the various distortion that those of ordinary skill in the art make technical scheme of the present invention and improvement, all should fall in protection domain that claims of the present invention determines.The experimental technique used in following embodiment if no special instructions, is ordinary method.
Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.
The virus stain information that following embodiment uses is as shown in table 1:
Table 1 strain name and type
Embodiment 1, fluorescence quantitative RT-PCR primer to and fluorescent probe design
The HA gene of Eurasian class fowl type H1N1 swine influenza virus, H1N1 (2009) swine influenza virus, classic H1N1 swine influenza virus and people source H1N1 swine influenza virus has all over the world been downloaded from the NCBI gene pool of the U.S., tetraploid rice has been carried out to it, design primer and the probe of the detection Eurasian class fowl type H1N1 swine influenza virus of high specificity in all influenza virus gene group HA gene regions, sequence is as follows:
Upstream primer: AlikeH1F 5 '-CTCAGCAAGTCATACACAA-3 ' (SEQ ID NO.1)
Downstream primer: AlikeH1R 5 '-CTGGTAGAGGGTTTGTTG-3 ' (SEQ ID NO.2)
Specific probe: AlikeH1MGB probe 5 '-F – CACCACCCTCCGACCGACAG – Q-3 ' (SEQ ID NO.3).
The specific detection that embodiment 2, fluorescence quantitative RT-PCR primer are right
1, Total RNAs extraction
1:(EA) H1N1; 2:(CS) H1N1; 3:pH1N1/2009, (Hu) H1N1, H1N2, H3N2, H5N1, H9N2, PRRS virus.The extraction of viral RNA can conventionally be carried out, and also can adopt (RNeasy Mini Kit, 74104) of German QIAGEN company, or buy other test kits separately; Extract by test kit specification sheets, obtain viral RNA and carry out next step experiment.
2, the specificity of fluorescence quantitative RT-RCR augmentation detection primer pair and probe
Extract testing sample RNA for template with step 1, be hybridly prepared into reaction system with single stage method and following material and carry out PCR reaction: Auele Specific Primer and fluorescent probe, PCR damping fluid, deoxynucleotide triphosphates mixture and archaeal dna polymerase, reversed transcriptive enzyme, RNA enzyme inhibitors; Reaction product is placed in quantitative PCR apparatus and carries out fluoroscopic examination; Described Auele Specific Primer and fluorescent probe sequence as follows: upstream primer: AlikeH1F 5 '-CTCAGCAAGTCATACACAA-3 ', downstream primer: AlikeH1R 5 '-CTGGTAGAGGGTTTGTTG-3 ', specific probe: AlikeH1 MGB probe 5 '-F-CACCACCCTCCGACCGACAG – Q-3 ' wherein F is fluorescent reporter group, and Q is fluorescent quenching group; Described F is FAM; Q is BHQ1.
Select fluoroscopic examination model F AM, fluorescence baseline adjustment gets the fluorescent signal mean value of 3 ~ 15 circulations, and threshold setting is with the vertex of threshold line just above normal negative controls, and sample is typical amplification curve, and increase in good logarithm, be judged as the positive.Without typical amplification curve, be judged as feminine gender.The fluorescence RT-PCR method that the present invention sets up has stronger specificity to Eurasian class fowl H1N1 swine influenza virus, the pH1N1/2009 that the same period is popular, classic H1N1, all no cross reactions (see Fig. 1) such as class human-like H1N1, H1N2, H3N2, H5N1, H9N2 hypotype swine influenza virus and PRRS virus.
Above-mentioned steps (1) sample RNA extraction method adopts the RNeasyMini Kit (74104) of German QIAGEN company, extracts according to test kit specification sheets.
Above-mentioned steps (2) PCR reaction system adopts ABI One-Step RT-PCR Kit reagent (P/N AM1005) to carry out according to following reaction system: step (1) RNA 4 μ l, upstream and downstream primer (10 pmol/ μ l) each 1 μ l, TaqMan probe (5 pmol/ μ l) 0.24 μ l, 25xRT-PCR Enzyme Mix 1 μ l, Detection Enhancer 1 μ l, Nuclease-free Water 2.26 μ l.Real Time RT-PCR reaction conditions: 1:50 DEG C of 30m in; 2:95 DEG C of 10min; 3:95 DEG C of 15s, 60 DEG C of 60s, 40 circulations.Carry out single-point fluoroscopic examination at 60 DEG C, carry out 40 circulations altogether.
3, sensitivity test
To Eurasian class fowl type H1N1 swine influenza virus strain, adopt viral RNA content quantitative, by its 10 times of gradient dilutions, Viral extraction RNA completes according to step (1).Detect with fluorescent quantitative RT-PCR method, result fluorescence PCR method detection sensitivity reaches 4.6 × 10
-7ng/ reacts (see Fig. 2).
4, replica test
Same sample carries out repeating in 5 groups and amplification test between group under the same conditions, measures the repeatability of the method.Through statistical analysis, in repeat amplification protcol test Ct value group, the variation coefficient is 1.1 ± 0.5%, and between-group variation coefficient can be inferred with reference to following content in 1 ± 0.4%, CV value: when CV value is less than 1%, represents that data discrete degree is less; Between 1% ~ 2%, represent that data discrete degree is normal; 2% ~ 3%, represent that data discrete degree still can accept; When being greater than 4%, represent that data discrete degree is larger.This research shows that fluorescent quantitative PCR detection method is reproducible, stability high (table 2).
Repeated experiment result (n=5) in the group of table 2 real-time fluorescence quantitative PCR, between group
5, the detection of clinical sample
Use the fluorescence quantitative RT-RCR diagnostic method that the present invention sets up, to the recent 5 parts of Nasal swabs samples having HA activity in chicken embryo or mdck cell are cultivated, through showing that to HA gene sequencing wherein 5 parts contain (EA) H1, all the other virus purification negative samples detect.Result 1 is (EA) HA positive control as shown in Figure 3, and 2 ~ 6 is that Eurasian class fowl type HA is positive, and 7 ~ No. 16 is Eurasian class fowl type HA negative sample.
Claims (6)
1. an Eurasian class fowl type H1N1 swine influenza virus fluorescence quantitative RT-PCR detecting kit, it is characterized in that comprising a pair Auele Specific Primer and fluorescent probe, described Auele Specific Primer is made up of upstream primer and downstream primer, described Auele Specific Primer and fluorescent probe sequence as follows:
Upstream primer: 5 '-CTCAGCAAGTCATACACAA-3 ';
Downstream primer: 5 '-CTGGTAGAGGGTTTGTTG-3 ';
Specific probe: 5 '-F-CACCACCCTCCGACCGACAG-Q-3 ', wherein F is fluorescent reporter group, and Q is fluorescent quenching group.
2. test kit as claimed in claim 1, characterized by further comprising PCR damping fluid, deoxynucleotide triphosphates mixture, archaeal dna polymerase, reversed transcriptive enzyme and RNA enzyme inhibitors.
3. test kit as claimed in claim 2, is characterized in that described reversed transcriptive enzyme is M-MLV reversed transcriptive enzyme.
4. test kit as claimed in claim 1 or 2, characterized by further comprising the DNA standard substance of Eurasian class fowl type H1N1 swine influenza virus gene, the nucleotide sequence of described standard substance is as shown in SEQ ID NO.4.
5. test kit as claimed in claim 1, is characterized in that be chosen as one of following group of F and Q in described specific probe: F is FAM, Q is BHQl; F is VIC, Q is BHQl; F is TAMRA, Q is BHQ2; F is ROX, Q is BHQ2; F is CY5, Q is BHQ3.
6. the application of the test kit described in any one of claim 1-5 in characterization or assistant identification Eurasian class fowl type H1N1 influenza virus reagent.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410641147.9A CN104450955B (en) | 2014-11-12 | 2014-11-12 | Eurasian class fowl type H1N1 swine influenza virus fluorescence quantitative RT-PCR detecting kit and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410641147.9A CN104450955B (en) | 2014-11-12 | 2014-11-12 | Eurasian class fowl type H1N1 swine influenza virus fluorescence quantitative RT-PCR detecting kit and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104450955A true CN104450955A (en) | 2015-03-25 |
| CN104450955B CN104450955B (en) | 2018-06-15 |
Family
ID=52897700
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410641147.9A Active CN104450955B (en) | 2014-11-12 | 2014-11-12 | Eurasian class fowl type H1N1 swine influenza virus fluorescence quantitative RT-PCR detecting kit and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104450955B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104745713A (en) * | 2015-04-21 | 2015-07-01 | 天津出入境检验检疫局动植物与食品检测中心 | Duplex fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection reagent for nipah virus and swine influenza virus (SIV) as well as preparation method and application of duplex fluorescent RT-PCR detection reagent |
| CN106435036A (en) * | 2016-12-13 | 2017-02-22 | 珠海出入境检验检疫局检验检疫技术中心 | Fluorescent PCR primers and probes for detecting influenza D viruses and detection method |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103571974A (en) * | 2013-09-30 | 2014-02-12 | 广西壮族自治区动物疫病预防控制中心 | RT-PCR (Reverse Transcription-Polymerase Chain Reaction) primer for detecting poultry-like type H1N1 swine influenza virus and kit |
-
2014
- 2014-11-12 CN CN201410641147.9A patent/CN104450955B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103571974A (en) * | 2013-09-30 | 2014-02-12 | 广西壮族自治区动物疫病预防控制中心 | RT-PCR (Reverse Transcription-Polymerase Chain Reaction) primer for detecting poultry-like type H1N1 swine influenza virus and kit |
Non-Patent Citations (2)
| Title |
|---|
| GUANGHUA FU, ET AL.: "Establishment of a multiplex RT-PCR assay to detect different lineages of swine H1 and H3 influenza A viruses", 《VIRUS GENES》 * |
| 王伟利 等: "欧亚类禽Ｈ１Ｎ１与古典Ｈ１Ｎ１亚型猪流感病毒ＮＡ基因遗传进化分析", 《中国兽医学报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104745713A (en) * | 2015-04-21 | 2015-07-01 | 天津出入境检验检疫局动植物与食品检测中心 | Duplex fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection reagent for nipah virus and swine influenza virus (SIV) as well as preparation method and application of duplex fluorescent RT-PCR detection reagent |
| CN106435036A (en) * | 2016-12-13 | 2017-02-22 | 珠海出入境检验检疫局检验检疫技术中心 | Fluorescent PCR primers and probes for detecting influenza D viruses and detection method |
| CN106435036B (en) * | 2016-12-13 | 2020-07-28 | 拱北海关技术中心 | Fluorescent PCR (polymerase chain reaction) primer and probe for detecting influenza D virus and detection method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104450955B (en) | 2018-06-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103045755B (en) | A kind of fluorescent quantitative PCR detection method detecting Ebola virus and primer thereof and test kit | |
| Acevedo et al. | A duplex SYBR Green I-based real-time RT-PCR assay for the simultaneous detection and differentiation of Massachusetts and non-Massachusetts serotypes of infectious bronchitis virus | |
| CN102277454A (en) | Primers, probes and assay kit for detecting transmissible gastroenteritis viruses and porcine epidemic diarrhea viruses | |
| CN103275862A (en) | Fluorescent quantitative reverse transcription-polymerase chain reaction (RT-PCR) kit for detecting influenza A virus subtype H7N9 | |
| CN103757139B (en) | Canine distemper virus and canine parvovirus duplex TaqMan-MGB fluorescent quantitative PCR (polymerase chain reaction) detection kit and detection method thereof | |
| CN102943129B (en) | Multiplex ligation-dependent probe amplification detection kit for simultaneously detecting five swine disease viruses, primers and probes | |
| CN104561374A (en) | Detection reagent and method for identifying porcine pseudorabies virus vaccine strain and wild strain | |
| CN104450956A (en) | Real-time fluorescence RT-PCR detection kit for H1N1 type A swine influenza virus and application of detection kit | |
| CN106636472B (en) | Complete set of reagent and method for detecting avian influenza virus and chicken parvovirus | |
| CN105002301A (en) | Multiple-connection probe amplification detection kit, primer and probe for simultaneously detecting five cow disease viruses | |
| CN109234462A (en) | A kind of reverse transcription recombinase-mediated isothermal amplification detection method of avian influenza virus | |
| CN102352416A (en) | Primer, probe and kit for detecting mouse hantaviruses | |
| CN101649356B (en) | Fluorescent quantitative detection kit of H1N1 influenza virus A and detection method thereof | |
| CN105441586A (en) | A-type H5N6 subtype avian influenza virus dual-channel real-time fluorescence PCR (polymerase chain reaction) detection kit and detection method | |
| CN103255232B (en) | Dual fluorescence RT (Reverse Transcription)-PCR (Polymerase Chain Reaction) detection kit and method for avian influenza H7N9 virus | |
| CN104498629A (en) | Duplex real-time fluorescence quantitative PCR (polymerase chain reaction) detection kit for H3N2 subtype avian influenza virus (AIV) | |
| CN103045754A (en) | One-step process real-time fluorescent quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) method and kit for detecting Z/S subtype ebola viruses | |
| He et al. | Sporadic occurrence of H9N2 avian influenza infections in human in Anhui province, eastern China: A notable problem | |
| Agüero et al. | A fully automated procedure for the high-throughput detection of avian influenza virus by real-time reverse transcription–polymerase chain reaction | |
| CN110656163A (en) | Double-label report fluorescent multiple pathogen nucleic acid detection method | |
| CN109207643A (en) | A kind of real-time fluorescence quantitative RT-PCR detection method of avian influenza virus | |
| CN104450955A (en) | Fluorescence quantification RT-PCR (reverse transcription-polymerase chain reaction) detection kit of Eurasian avian-like type H1N1 swine influenza virus and application thereof | |
| CN101392299B (en) | Equine influenza detection kit and detection method | |
| CN104561383A (en) | Influenza A virus and B virus joint detection primer, probe, kit and application | |
| CN102140557B (en) | Kit for rapidly and synchronously detecting nucleic acids of influenza virus A |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant |