CN104745713A - Duplex fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection reagent for nipah virus and swine influenza virus (SIV) as well as preparation method and application of duplex fluorescent RT-PCR detection reagent - Google Patents

Duplex fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection reagent for nipah virus and swine influenza virus (SIV) as well as preparation method and application of duplex fluorescent RT-PCR detection reagent Download PDF

Info

Publication number
CN104745713A
CN104745713A CN201510191679.1A CN201510191679A CN104745713A CN 104745713 A CN104745713 A CN 104745713A CN 201510191679 A CN201510191679 A CN 201510191679A CN 104745713 A CN104745713 A CN 104745713A
Authority
CN
China
Prior art keywords
virus
gene
swine influenza
seq
influenza virus
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201510191679.1A
Other languages
Chinese (zh)
Inventor
赵祥平
王建华
董志珍
肖妍
王玉玲
赵丹
张俊哲
王乃福
陈小金
陈本龙
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tianjin Entry Exit Inspection and Quarantine Bureau of Animals Plants and Food Inspection Center
Original Assignee
Tianjin Entry Exit Inspection and Quarantine Bureau of Animals Plants and Food Inspection Center
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tianjin Entry Exit Inspection and Quarantine Bureau of Animals Plants and Food Inspection Center filed Critical Tianjin Entry Exit Inspection and Quarantine Bureau of Animals Plants and Food Inspection Center
Priority to CN201510191679.1A priority Critical patent/CN104745713A/en
Publication of CN104745713A publication Critical patent/CN104745713A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a duplex fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection reagent for Nipah virus and swine influenza virus (SIV) as well as a preparation method and application of the duplex fluorescent RT-PCR detection reagent. Two sets of specific primers and Taqman probes which are respectively used for an M gene of the Nipah virus and an M virogene of the SIV as well as positive control are designed and synthesized; a duplex fluorescent RT-PCR detection system with the advantages of quickness, simplicity, convenience, high specificity and high sensitivity is established by using the two sets of primers and probes; the duplex fluorescent RT-PCR detection system can be used for simultaneously detecting nucleic acids of the Nipah virus and the SIV quickly, accurately, specifically, safely, simply and conveniently from a detected sample within 3 to 4 hours, and simultaneously detecting nucleic acids of trace Nipah virus and the SIV from a domestic pig and a correlated sample of the domestic pig.

Description

Bifluorescence RT-PCR detection reagent of Nipah virus and swine influenza virus and preparation method thereof and purposes
Technical field
The invention belongs to biological technical field, bifluorescence RT-PCR detection reagent being specifically related to a kind of Nipah virus and swine influenza virus and preparation method thereof and purposes.
Background technology
Nipah virus is the pathogenic agent of zoonosis-Buddhist nun's handkerchief disease of a kind of serious harm people and pig health, and clinical manifestation is with neural system and respiratory system disease for feature, and the pig clinical symptom of different ages is also different.People directly contacts mainly through the secretory product of wound and infected pigs, movement and infects, and also infects by air, causes morbidity dead.Therefore, Nipah infection pig is the important contagium of Buddhist nun's handkerchief disease of people.Porcine influenza is caused by influenza A that the one of pig or people is acute, infecting both domestic animals and human respiratory infectious disease.Because Buddhist nun's handkerchief of pig is sick similar in clinical manifestation with porcine influenza, only be not easily distinguishable with clinical symptom, therefore the clinical doubtful Nipah virus of morbidity pig and the discriminating of swine influenza virus are detected, for finding early and controlling this two kinds of animal epidemics, and then prevent the generation of the sick and influenza of Buddhist nun's handkerchief of people and popular there is important using value.Multi-fluorescence RT-PCR method can detect multiple cause of disease nucleic acid simultaneously, has the advantage that multiple cause of disease just can be differentiated and detect to a RT-PCR reaction easy, rapidly, can meet the requirement of various diseases diagnosis simultaneously.Fluorescence RT-PCR method and the publication of the single Nipah virus of current detection and swine influenza virus all have report, and can the bifluorescence quantitative RT-PCR detecting agent simultaneously detecting Nipah virus and swine influenza virus and preparation method thereof and application, also rare report.
Summary of the invention
Technical problem to be solved by this invention is, bifluorescence RT-PCR detection reagent that a kind of Nipah virus and swine influenza virus are provided and preparation method thereof and purposes, be specifically related to a kind of respectively with the detection reagent that Nipah virus M gene and swine influenza virus M gene are developed for amplified target sequence, this detection reagent comprises two pairs of primers, two label probes and two positive controls.
In order to solve the problems of the technologies described above, the technical solution used in the present invention is realized by following steps: the bifluorescence RT-PCR detection reagent of a kind of Nipah virus and swine influenza virus, comprise two pairs of Auele Specific Primers for detecting Nipah virus M gene and swine influenza virus M gene respectively, two specific probes and two positive controls, amplification target length is respectively 79bp and 80bp, and primer and probe sequence are:
Nipah virus:
Upstream primer: NIPHA-M-F:5 '-GCTCAACAGATTGACCTGGAAC-3 ' SEQ ID NO.1
Downstream primer: NIPHA-M-R:5 '-AACAGAAGGCTGCAACACAGC-3 ' SEQ ID NO.2
Probe: NIPHA-M-P:5 '-FAM-CTCGGCTGATCTCACA-3 '-MGB SEQ ID NO.3
Positive control: NIPHA-M:GATGGACATCAATCCTTGGCTCAACAGATTGACCTGGAACAACAGTTG TGAGATCAGCCGAGTAGCAGCTGTGTTGCAGCCTTCTGTTCCAAGAGAGTTCATGA TCTATGATGATGTCTTCATTGACAATACAGGGAG SEQ ID NO.4
Swine influenza virus:
Upstream primer: SIV-M-F:5 '-CGGTCTCACAGACAGATGGCTAC-3 ' SEQ ID NO.9
Downstream primer: SIV-M-R:5 '-GTGCTAGCCAACACCATTCTG-3 ' SEQ ID NO.10
Probe: SIV-M-P:5 '-VIC-ACCACCAATCCACTAATCAGGCA-3 '-MGB SEQ ID NO.11
Swine influenza virus M gene masculine control sequence: CTGATTCACAGCATCGGTCTCACAGACAGATGGCTACTACCACCAATCCACTAATC AGGCATGAGAACAGAATGGTGTTGGCTAGCACTACGGCA SEQ ID NO.12.
The preparation method of the bifluorescence RT-PCR detection reagent of above-mentioned Nipah virus and swine influenza virus, comprises the following steps:
(1) select Nipah virus M gene order conservative fragments to be amplification and the target sequence preparing positive control, its nucleotide sequence as shown in SEQ ID NO.4, for:
GATGGACATCAATCCTTGGCTCAACAGATTGACCTGGAACAACAGTTGTGAGATCAGCCGAGTAGCAGCTGTGTTGCAGCCTTCTGTTCCAAGAGAGTTCATGATCTATGATGATGTCTTCATTGACAATACAGGGAG；
(2) select swine influenza virus M gene order conservative fragments to be amplification and the target sequence preparing positive control, its nucleotide sequence as shown in SEQ ID NO.12, for:
CTGATTCACAGCATCGGTCTCACAGACAGATGGCTACTACCACCAATCCACTAATCAGGCATGAGAACAGAATGGTGTTGGCTAGCACTACGGCA；
(3) design 4 primers, with pcr amplification and prepare Nipah virus M gene masculine contrast, primer sequence SEQ IDNO.5-SEQ ID NO.8 is as follows:
NIPHA-F1:5’-CCTGGAACAACAGTTGTGAGATCAGCCGAGTAGCAGCTGTGTTGCAGCCTTCTGTTCC-3’
NIPHA-R1:5’-GGAACAGAAGGCTGCAACACAGCTGCTACTCGGCTGATCTCACAACTGTTGTTCCAGG-3’
NIPHA-F2:5’-GATGGACATCAATCCTTGGCTCAACAGATTGACCTGGAACAACAGTTGTGAGATC-3’
NIPHA-R2:5’-GAAGACATCATCATAGATCATGAACTCTCTTGGAACAGAAGGCTGCAACACAGCTG-3’
(4) design 4 primers, with pcr amplification and prepare swine influenza virus M gene masculine contrast, primer sequence SEQID NO.13-SEQ ID NO.16, as follows:
SIM-M-F1:5’-CTGATTCACAGCATCGGTCTCACAGACAGATGGCTACTA-3’
SIM-M-R1:5’-TGCCGTAGTGCTAGCCAACACCATTCTGTTCTCATGCCTG-3’
SIV-M-F2:5’-CACAGACAGATGGCTACTACCACCAATCCACTAATCAGGCATGAGAACAGAATGGT-3’
SIM-M-R2:5’-ACCATTCTGTTCTCATGCCTGATTAGTGGATTGGTGGTAGTAGCCATCTGTCTGTG-3’
(5) design multipair primer and many probes according to Nipah virus M gene masculine control sequence and swine influenza virus M gene masculine control sequence respectively, through a large amount of contrast shaker tests, determine the suitableeest primer pair and label probe combination:
Nipah virus:
Upstream primer: NIPHA-M-F:5 '-GCTCAACAGATTGACCTGGAAC-3 ' SEQ ID NO.1
Downstream primer: NIPHA-M-R:5 '-AACAGAAGGCTGCAACACAGC-3 ' SEQ ID NO.2
Probe: NIPHA-M-P:5 '-FAM-CTCGGCTGATCTCACA-3 '-MGB SEQ ID NO.3
Swine influenza virus:
Upstream primer: SIV-M-F:5 '-CGGTCTCACAGACAGATGGCTAC-3 ' SEQ ID NO.9
Downstream primer: SIV-M-R:5 '-GTGCTAGCCAACACCATTCTG-3 ' SEQ ID NO.10
Probe: SIV-M-P:5 '-VIC-ACCACCAATCCACTAATCAGGCA-3 '-MGB SEQ ID NO.11
(6) fluorescent reporter group detecting 5 ' end mark of the probe of Nipah virus M gene is FAM, and the non-fluorescence quenching group of 3 ' end mark is MGB; The fluorescent reporter group detecting 5 ' end mark of the probe of swine influenza virus M gene is VIC, and the non-fluorescence quenching group of 3 ' end mark is MGB;
(7) preferred through a large amount of simultaneous tests and reaction conditions, determine specificity and the sensitivity of reaction conditions, primer and probe that bifluorescence RT-PCR is the suitableeest.
The suitableeest reaction conditions in described (5) is that the upstream and downstream primer working concentration detecting Nipah virus M gene and swine influenza virus M gene is 15pmol/ μ L, the working concentration of probe is 5pmol/ μ L, primer and the probe of 0.5 μ L is all added in 25 μ L systems, the specificity of primer and probe makes it be different from other virus of pig source, and the sensitivity detecting Nipah virus M gene and swine influenza virus M gene reaches 46 copies ~ 58 copies respectively.
The application of bifluorescence RT-PCR detection reagent in production standard test kit of described Nipah virus and swine influenza virus.
The bifluorescence RT-PCR detection reagent of described Nipah virus and swine influenza virus is in the purposes of drawing Nipah virus and swine influenza virus fluorescence quantitative PCR detection typical curve.
The invention has the beneficial effects as follows: (1) has special, responsive, feature accurately and rapidly, can be used for detecting the micro-Nipah virus in a pig and correlated samples thereof and swine influenza virus nucleic acid simultaneously.(2) the Nipah virus M gene in the present invention and swine influenza virus M genetic contrast preparation method, neither relate to the use of Nipah virus and swine influenza virus and genomic nucleic acids thereof, also the Nipah virus M gene RNA fragment not needing synthetic longer and swine influenza virus M gene RNA fragment, have easy, safe and economic advantage.
Accompanying drawing explanation
Fig. 1 is the fluorescence RT-PCR amplification curve that the suitableeest primer pair contrasts Nipah virus M gene masculine with label probe.
Fig. 2 is the fluorescent specific amplification curve that the suitableeest primer pair contrasts Nipah virus M gene masculine with label probe.
Fig. 3 is to 4.6 × 10 7~ 4.6 × 10 1the fluorescence quantitative RT-RCR amplification kinetic curve of the Nipah virus M gene masculine contrast in copies/ μ L concentration range.
Fig. 4 is the fluorescence quantitative RT-RCR typical curve of Nipah virus M gene.
Fig. 5 is the fluorescence RT-PCR amplification curve that the suitableeest primer pair contrasts swine influenza virus M gene masculine with label probe.
Fig. 6 is that the suitableeest primer pair and label probe are to the fluorescence RT-PCR specific amplification curve of swine influenza virus M gene.
Fig. 7 is to 5.8 × 10 7~ 5.8 × 10 1the fluorescence quantitative RT-RCR amplification kinetic curve of the swine influenza virus M gene masculine contrast in copies/ μ L concentration range.
Fig. 8 is the fluorescence quantitative RT-RCR typical curve of swine influenza virus M gene.
Embodiment
Below in conjunction with the drawings and specific embodiments, the present invention is described in further detail.
Bifluorescence RT-PCR detection reagent of Nipah virus of the present invention and Pestivirus suis and preparation method thereof and purposes, comprise the following steps.
First step is the positive control substance (RNA) preparing Nipah virus M gene, and process comprises:
(1) in NCBI website, BLAST comparison is carried out to Nipah virus M gene order, select one section of conserved sequence to be used for Nipah virus M gene masculine contrast preparation, as shown in SEQ ID NO.4.
(2) synthesize 4 primers based on SEQ ID NO.4 sequences Design, primer sequence is as follows:
NIPHA-M-F1:5’-CCTGGAACAACAGTTGTGAGATCAGCCGAGTAGCAGCTGTGTTGCAGCCTTCTGTTCC-3
NIPHA-M-R1:5’-GGAACAGAAGGCTGCAACACAGCTGCTACTCGGCTGATCTCACAACTGTTGTTCCAGG-3
NIPHA-M-F2:5’-GATGGACATCAATCCTTGGCTCAACAGATTGACCTGGAACAACAGTTGTGAGATC-3’
NIPHA-M-R2:5’-GAAGACATCATCATAGATCATGAACTCTCTTGGAACAGAAGGCTGCAACACAGCTG-3’
(3) using two complementary primers as amplification template, other two are carried out standard PCR amplification with the partly overlapping primer of primer sequence being used as template as amplimer;
(4) recovery, purifying contain the pcr amplification product of SEQ ID NO.4 sequence, be connected, be converted into DH5 α Recombinant organism with PCR2.1 cloning vector, picking, extraction positive colony plasmid;
(5) positive colony plasmid Bam H I enzyme of above-mentioned purifying is cut, reclaim digestion products, with linearizing positive colony plasmid DNA for template, use DNA in-vitro transcription test kit to carry out in-vitro transcription, use dnase digestion DNA profiling, extract RNA.
(6) carry out quality determination with foranalysis of nucleic acids instrument, become copy number by formula scales, obtain Nipah virus M gene masculine contrast (RNA) of known copy Particle density.
Below by way of concrete embodiment, the present invention is further described in more detail.
Second step prepares the contrast of swine influenza virus M gene masculine, and process comprises:
(1) in NCBI website, BLAST comparison is carried out to swine influenza virus M gene order, select one section of conserved sequence to be used for swine influenza virus M gene masculine contrast (RNA) preparation, as shown in SEQ ID NO.8.
(2) synthesize 4 primers based on SEQ ID NO.12 sequences Design, primer sequence is as follows:
SIV-M-F1:5-GTGCCTGAGTCCATGAGGGAAGAATATCAGCAGGAACAGCAGAGTGCTGTGGATGTTG-3
SIV-M-R1:5-CAACATCCACAGCACTCTGCTGTTCCTGCTGATATTCTTCCCTCATGGACTCAGGCAC-3
SIV-M-F2:5-ATACGGTTTGAAAAGAGGGCCTTCTACGGAAGGAGTGCCTGAGTCCATGAGGGAA-3
SIV-M-R2:5-TTACTCTAGCTCTATGTTGACAAAATGACCATCGTCAACATCCACAGCACTCTGCTG-3
(3) using two complementary primers as amplification template, other two are carried out standard PCR amplification with the partly overlapping primer of primer sequence being used as template as amplimer;
(4) recovery, purifying contain the pcr amplification product of SEQ ID NO.8 sequence, be connected, be converted into DH5 α Recombinant organism with PCR2.1 cloning vector, picking, extraction positive colony plasmid;
(5) positive colony plasmid Bam H I enzyme of above-mentioned purifying is cut, reclaim digestion products, with linearizing positive colony plasmid DNA for template, use DNA in-vitro transcription test kit to carry out in-vitro transcription, use dnase digestion DNA profiling, extract RNA.
(6) carry out quality determination with foranalysis of nucleic acids instrument, become copy number by formula scales, obtain swine influenza virus M gene masculine contrast (RNA) of known copy Particle density.
Third step is primer, the probe of design and synthesis and selective mechanisms Nipah virus M gene, and process comprises:
(1) based on sequence shown in SEQ ID NO.4, the multipair primer of design and synthesis and multiple label probe;
(2) the 1000 times of Nipah virus M gene masculines diluted prepared with first step contrast (RNA) for template, adopt OneStep PrimeScript tMthe reaction amplification condition of RT-PCR Kit (Perfect Real Time) reagent and recommendation, at Light 480 fluorescent PCR instrument carry out shaker test to the multipair primer of designed synthesis and label probe;
(3) under the reaction amplification condition of identical Fluorescence PCR amplifing reagent and recommendation, there is the synthetic determination standard of minimum Ct value, most high fluorescent increased value (Δ Rn) and typical S type amplification curve, see Fig. 1, the suitableeest primer and the label probe sequence of the detection Nipah virus M gene finally determined are respectively:
Upstream primer: NIPHA-M-F:5 '-GCTCAACAGATTGACCTGGAAC-3 ' SEQ ID NO.1
Downstream primer: NIPHA-M-R:5 '-AACAGAAGGCTGCAACACAGC-3 ' SEQ ID NO.2
Probe: NIPHA-M-P:5 '-FAM-CTCGGCTGATCTCACA-3 '-MGB SEQ ID NO.3
4th step is primer, the probe of design and synthesis and selective mechanisms swine influenza virus M gene, and process comprises:
(1) based on sequence shown in SEQ ID NO.4, the multipair primer of design and synthesis and multiple label probe;
(2) positive control (RNA) of the swine influenza virus M genes of the 1000 times of dilutions prepared with first step, for template, adopts One Step PrimeScript tMthe reaction amplification condition of RT-PCR Kit (Perfect Real Time) reagent and recommendation, at Light 480 fluorescent PCR instrument carry out shaker test to the multipair primer of designed synthesis and label probe;
(3) there is the synthetic determination standard of minimum Ct value, the highest fluorescence intensity increased value (Δ Rn) and typical S type amplification curve, see Fig. 5, the suitableeest primer pair and the label probe sequence of the detection swine influenza virus M gene finally determined are respectively:
Upstream primer: SIV-M-F:5 '-CGGTCTCACAGACAGATGGCTAC-3 ' SEQ ID NO.9
Downstream primer: SIV-M-R:5 '-GTGCTAGCCAACACCATTCTG-3 ' SEQ ID NO.10
Probe: SIV-M-P:5 '-VIC-ACCACCAATCCACTAATCAGGCA-3 '-MGB.SEQ ID NO.11
5th step is bifluorescence RT-PCR reaction system and the amplification condition of optimum detection Nipah virus M gene and swine influenza virus M gene, and process comprises:
(1) primer third step and the 4th step determined and label probe, be mixed with the working concentration of 10pmol/ μ L, 8pmol/ μ L, 6pmol/ μ L, 4pmol/ μ L, 2pmol/ μ L with sterilized water respectively, probe sterilized water be mixed with respectively the working concentration of 3.5pmol/ μ L, 3pmol/ μ L, 2.5pmol/ μ L, 2.0pmol/ μ L, 1.5pmol/ μ L;
(2) One Step PrimeScript is adopted tMthe reaction amplification condition of RT-PCR Kit (Perfect Real Time) reagent and recommendation, at Light the primer that 480 fluorescent PCR instrument combine different working concentration and label probe carry out fluorescent PCR square formation shaker test;
(3) be synthetic determination foundation to obtain minimum Ct value, the highest fluorescence intensity increased value (Δ Rn) and typical S type amplification curve, the working concentration of the detection Nipah virus M gene finally determined and the suitableeest upstream and downstream primer of swine influenza virus M gene is 15pmol/ μ L, the working concentration of the suitableeest probe is 5pmol/ μ L, in 25 μ L systems, add 0.5 μ L primer and probe;
(4) under the suitableeest primer and label probe concentration and universal fluorescent RT-PCR reaction amplifing reagent condition, within the scope of 61 DEG C ~ 56 DEG C, carry out shaker test to annealing elongating temperature, the suitableeest fluorescent PCR amplification condition finally determined is: 42 DEG C of reaction 5min; 94 DEG C of denaturation 10s; 94 DEG C of sex change 10s, 60 DEG C extend 20s, totally 40 circulations.
6th step is the bifluorescence RT-PCR method of primer and the label probe determined based on third step, the 4th step and the 5th step, set up the fluorescence RT-PCR amplification typical curve of detection Nipah virus M gene and swine influenza virus M gene respectively and determine lowest detectable limit, process comprises:
(1) carry out 10 times of serial dilutions to the contrast of Nipah virus M gene masculine, the optimal reaction system determined with the 5th step and amplification condition carry out fluorescence RT-PCR amplification, and the kinetic curve of fluorescence RT-PCR amplification sees Fig. 3;
(2) with the Ct value of amplification curve for X-coordinate, with the logarithm of the copy number concentration of Nipah virus M gene masculine contrast for ordinate zou drawing standard curve, the typical curve regression equation obtained is Y=-3.4168X+37.526, relation conefficient (r) is 0.9995, see Fig. 4, show that designed primer and probe amplification efficiency and combination rate are high, the reaction conditions optimized is suitable for, 46 Nipah virus M gene masculine contrast RNA molecule copied can be detected, can be used for the detection by quantitative of micro-Nipah virus M gene, there is very high detection sensitivity.
(3) carry out 10 times of serial dilutions to the contrast of swine influenza virus M gene masculine, the optimal reaction system determined with the 5th step and amplification condition carry out fluorescence RT-PCR amplification, and the kinetic curve of fluorescence RT-PCR amplification sees Fig. 7;
(4) with the Ct value of amplification curve for X-coordinate, with the logarithm of swine influenza virus M gene masculine contrast copy number concentration for ordinate zou drawing standard curve, the typical curve regression equation obtained is Y=-3.2618X+37.649, relation conefficient (r) is 0.9983, see Fig. 8, show that designed primer and probe amplification efficiency and combination rate are high, the reaction conditions optimized is suitable for, 58 swine influenza virus M gene masculine contrast RNA molecule copied can be detected, can be used for the detection by quantitative of swine influenza virus M gene, there is very high detection sensitivity.
7th step carries out specific test to the bifluorescence RT-PCR method of the primer determined based on third step, the 4th step and the 5th step and label probe, and process comprises:
(1) for cell culture and the foot and mouth disease vaccine of porcine reproductive and respiratory syndrome virus, Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus, Pestivirus suis, adopt TRIZOL reagent to press process specifications and extract geneome RNA;
(2) for the cell culture of Pseudorabies virus, pig parvoviral and pig circular ring virus, the Tissure/Blood DNA kit of TIANGEN is adopted press process specifications extraction genomic dna.
(3) with based on third step, the bifluorescence RT-PCR method of the primer that the 4th step and the 5th step are determined and label probe, to porcine reproductive and respiratory syndrome virus, Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus, the cell culture of Pestivirus suis and the geneome RNA of foot and mouth disease vaccine and Pseudorabies virus, pig parvoviral, the genomic dna of pig circular ring virus carries out fluorescence RT-PCR amplification, detected result display is based on third step, the bifluorescence RT-PCR method of the primer that the 4th step and the 5th step are determined and label probe has good specificity, non-specific amplification curve is there is not with above-mentioned pig correlated virus nucleic acid, see Fig. 2 and Fig. 6.
8th step determines to detect the working method of Nipah virus M gene and swine influenza virus M gene in family pig and correlated samples thereof, and process comprises:
(1) process man pig and correlated samples method thereof is set up;
(2) extract the method for sample geneome RNA simultaneously;
(3) utilize the bifluorescence RT-PCR method of primer and the label probe determined based on third step, the 4th step and the 5th step, Nipah virus M gene and swine influenza virus M gene test and result are carried out to these samples and judges.
The preparation of embodiment 1 Nipah virus M gene masculine contrast
1. the selection of reference genetic sequence
BLAST is carried out to Nipah virus M gene order (the GenBank number of including: AJ564621.1), choose one section of conservative and sequence of suitable design fluorescence RT-PCR primer and probe as the reference sequences preparing Nipah virus M gene masculine contrast (RNA), as shown in SEQ ID NO.1.
2. amplimer Design and synthesis
Based on above-mentioned sequence, design and synthesis 4 pcr amplification primers, wherein NIPHA-M-F1 and NIPHA-M-R1 sequence complete complementary is used as template, NIPHA-M-F2 and NIPHA-M-R2 is overlapping with NIPHA-M-F1 and NIPHA-M-R1 Sequence respectively, and the sequence of synthesis is as follows:
NIPHA-M-F1:5’-CCTGGAACAACAGTTGTGAGATCAGCCGAGTAGCAGCTGTGTTGCAGCCTTCTGTTCC-3
NIPHA-M-R1:5’-GGAACAGAAGGCTGCAACACAGCTGCTACTCGGCTGATCTCACAACTGTTGTTCCAGG-3
NIPHA-M-F2:5’-GATGGACATCAATCCTTGGCTCAACAGATTGACCTGGAACAACAGTTGTGAGATC-3’
NIPHA-M-R2:5’-GAAGACATCATCATAGATCATGAACTCTCTTGGAACAGAAGGCTGCAACACAGCTG-3’；
3.PCR increases
In 50 μ L PCR amplification system, add 10 × Buffer successively (containing MgCl 2) 5 μ L, dNTPs (2.5mmol/L) 4 μ L, TaKaRa Taq polysaccharase (5.0U/ μ L) 0.2 μ L, NIPHA-M-F1 (1pmmol/ μ L) and NIPHA-M-R1 (1pmmol/ μ L) each 1 μ L, NIPHA-M-F2 (25pmmol/ μ L) and NIPHA-M-R2 (25pmmol/ μ L) each 1 μ L, supplies ddH 2o to 50 μ L.
Pcr amplification reaction Parameter Conditions is: 94 DEG C of denaturation 5min; 94 DEG C of sex change 30s, 60 DEG C of annealing 30s, 72 DEG C extend 20s, totally 35 circulations; 72 DEG C extend 6min; 4 DEG C of insulation 1min.
The recovery of 4.PCR product, purifying
Get the agarose gel electrophoresis that PCR primer carries out 1.5%, cutting size is the object amplified band of 121bp, and the process specifications purifying reclaiming test kit according to a small amount of sepharose DNA reclaims target DNA fragment.
The connection of 5.PCR product and cloning vector, conversion
According to PCR2.1 cloning vector process specifications, the target DNA fragment of purifying is spent the night with PCR2.1 cloning vector under 16 DEG C of conditions and is connected, this connection product is mixed with DH5 α Recombinant organism, 42 DEG C of heat shock 90s, after ice bath 2min, add the 37 DEG C of joltings of 1mL LB substratum and cultivate 1h, then in AMP +lB flat board is coated with rear 37 DEG C of incubated overnight.
6. insert the selecting of Nipah virus Nipah virus M gene masculine plasmid, identify
Picking 10 single bacterium colonies, 37 DEG C of jolting incubated overnight in 3mL LB substratum, then extract test kit with mini-scale plasmid and press process specifications Isolation and purification cloned plasmids, insert the positive colony plasmid of Nipah virus M gene conserved sequence with PCR method screening;
7. Nipah virus M gene masculine contrasts preparation and the copy number mensuration of (RNA)
Positive colony plasmid Bam H I enzyme of above-mentioned purifying is cut, reclaim digestion products, with linearizing positive colony plasmid DNA for template, use DNA in-vitro transcription test kit RiboMAXTM Large Scale RNA Production SystemT7, in-vitro transcription is carried out according to process specifications, use dnase digestion DNA profiling, extract RNA, packing.Carry out quality determination with the positive colony plasmid of nucleic acid content analyser to purifying, and according to following formula, plasmid mass conversion become copy number:
Namely be prepared into Nipah virus M gene masculine by aforesaid method and contrast (RNA).
The preparation of embodiment 2 swine influenza virus M gene masculine contrast (RNA)
1. the selection of reference genetic sequence
BLAST is carried out to swine influenza virus M gene order (the GenBank number of including: KF986907), chooses one section of conservative and sequence of suitable design fluorescence RT-PCR primer and probe as the ginseng A preparing swine influenza virus M gene masculine contrast (RNA)) ginseng as shown in SEQ ID NO.1.
2. amplimer Design and synthesis
Based on above-mentioned sequence, design and synthesis 4 pcr amplification primers, wherein SIV-M-F1 and SIV-M-R1 sequence complete complementary is used as template, SIV-M-F2 and SIV-M-R2 is overlapping with SIV-M-F1 and SIV-M-R1 Sequence respectively, and the sequence of synthesis is as follows:
SIV-M-F1:5-GTGCCTGAGTCCATGAGGGAAGAATATCAGCAGGAACAGCAGAGTGCTGTGGATGTTG-3
SIV-M-R1:5-CAACATCCACAGCACTCTGCTGTTCCTGCTGATATTCTTCCCTCATGGACTCAGGCAC-3
SIV-M-F2:5-ATACGGTTTGAAAAGAGGGCCTTCTACGGAAGGAGTGCCTGAGTCCATGAGGGAA-3
SIV-M-R2:5-TTACTCTAGCTCTATGTTGACAAAATGACCATCGTCAACATCCACAGCACTCTGCTG-3
3.PCR increases
In 50 μ L PCR amplification system, add 10 × Buffer successively (containing MgCl 2) 5 μ L, dNTPs (2.5mmol/L) 4 μ L, TaKaRa Taq polysaccharase (5.0U/ μ L) 0.2 μ L, CSFV-F1 (1pmmol/ μ L) and CSFV-R1 (1pmmol/ μ L) each 1 μ L, CSFV-F2 (25pmmol/ μ L) and PRRSV-NSP2-R2 (25pmmol/ μ L) each 1 μ L, supplies ddH 2o to 50 μ L.
Pcr amplification reaction Parameter Conditions is: 94 DEG C of denaturation 5min; 94 DEG C of sex change 30s, 60 DEG C of annealing 30s, 72 DEG C extend 20s, totally 35 circulations; 72 DEG C extend 6min; 4 DEG C of insulation 1min.
The recovery of 4.PCR product, purifying
Get the agarose gel electrophoresis that PCR primer carries out 1.5%, cutting size is the object amplified band of 128bp, and the process specifications purifying reclaiming test kit according to a small amount of sepharose DNA reclaims target DNA fragment.
The connection of 5.PCR product and cloning vector, conversion
According to PCR2.1 cloning vector process specifications, the target DNA fragment of purifying is spent the night with PCR2.1 cloning vector under 16 DEG C of conditions and is connected, this connection product is mixed with DH5 α Recombinant organism, 42 DEG C of heat shock 90s, after ice bath 2min, add the 37 DEG C of joltings of 1mL LB substratum and cultivate 1h, then in AMP +lB flat board is coated with rear 37 DEG C of incubated overnight.
6. insert the selecting of swine influenza virus M gene masculine plasmid, identify
Picking 10 single bacterium colonies, 37 DEG C of jolting incubated overnight in 3mL LB substratum, then extract test kit with mini-scale plasmid and press process specifications Isolation and purification cloned plasmids, insert swine influenza virus M gene conserved sequence sex clone plasmid with PCR method screening;
7. swine influenza virus M gene masculine contrasts preparation and the copy number mensuration of (RNA)
Positive colony plasmid Bam H I enzyme of above-mentioned purifying is cut, reclaim digestion products, with linearizing positive colony plasmid DNA for template, use DNA in-vitro transcription test kit RiboMAXTM Large Scale RNA Production SystemT7, in-vitro transcription is carried out according to process specifications, use dnase digestion DNA profiling, extract RNA, packing.Carry out quality determination with the positive colony plasmid of nucleic acid content analyser to purifying, and according to following formula, plasmid mass conversion become copy number:
Namely be prepared into swine influenza virus M gene masculine by aforesaid method and contrast (RNA).
The drafting of embodiment 3 Nipah virus M gene by fluorescence quantitative PCR examination criteria curve
1. the dilution of Nipah virus M gene masculine contrast (plasmid)
Be 4.6 × 10 to concentration 9nipah virus M gene masculine contrast (RNA) carry out 10 times of serial dilutions, select 4.6 × 10 7~ 4.6 × 10 1doubly the M gene masculine contrast of dilution is as standard substance template.
2. the preparation of fluorescence RT-PCR system and amplification
Adopt the One Step PrimeScript of the employing TaKaRa company of TaKaRa company tMrT-PCR Kit (Perfect Real Time) fluorescence RT-PCR reaction reagent, by the reaction system composition preparation reaction system of table 1, fully mix packing 24.0 μ L in backward each fluorescent PCR pipe, then Nipah virus M gene masculine contrast (RNA) of 1.0 μ L, 10 times of serial dilutions is added successively, each extent of dilution does 3 Parallel testing systems, after centrifugal after sealing, be positioned over Light in pattern detection groove on 480 fluorescent PCR instrument.Reaction parameter is 42 DEG C of 5min, 95 DEG C of 10sec, then 95 DEG C of 10sec, 56 DEG C of 10sec, 60 DEG C of 30sec, 40 circulations, before the 60 DEG C of annealing that circulate each time terminate, gather FAM channel fluorescence signal.
Table 1 fluorescence RT-PCR reaction system forms
3. the drafting of typical curve
After reaction terminates, the Nipah virus M gene masculine of acquisition contrast fluorescence RT-PCR amplification kinetic curve is shown in Fig. 3, the copy number concentration of Nipah virus M gene masculine contrast with corresponding Ct value in table 2.
The corresponding Ct value of each copy number of fluorescent quantitation RT-of table 2 Nipah virus M gene masculine contrast
With the Ct value of amplification curve for X-coordinate, with the copy number concentration of Nipah virus M gene masculine contrast for ordinate zou drawing standard curve, the typical curve regression equation obtained is Y=-3.4168X+37.526, relation conefficient (r) is 0.9995, see Fig. 4, show that designed primer and probe amplification efficiency and combination rate are high, the reaction conditions optimized is suitable for, at least 46 Nipah virus M gene RNA molecules copied can be detected, can be used for the detection by quantitative of micro-Nipah virus M gene, there is very high detection sensitivity.
The drafting of embodiment 4 swine influenza virus M gene fluorescence quantitative RT-PCR examination criteria curve
1. the dilution of swine influenza virus M gene (RNA)
Be 5.8 × 10 to concentration 9swine influenza virus M gene masculine contrast (RNA) carry out 10 times of serial dilutions, select 5.8 × 10 7~ 5.7 × 10 1doubly swine influenza virus M gene masculine contrast (RNA) of dilution is as standard substance template.
2. the system of Fluorescence PCR is prepared and amplification
Adopt the One Step PrimeScript of TaKaRa company tMrT-PCR Kit (Perfect Real Time) fluorescence RT-PCR reaction reagent, by the reaction system composition preparation reaction system of table 3, fully mix packing 24.0 μ L in backward each fluorescent PCR pipe, then swine influenza virus M gene masculine contrast (RNA) of 1.0 μ L10 times serial dilutions is added successively, each extent of dilution does 3 Parallel testing systems, after centrifugal after sealing, be positioned over Light in pattern detection groove on 480 fluorescent PCR instrument.Reaction parameter is 42 DEG C of 5min, 95 DEG C of 10sec, then 95 DEG C of 10sec, 56 DEG C of 10sec, 60 DEG C of 30sec, 40 circulations, before the 60 DEG C of annealing that circulate each time terminate, gather fluorescent signal.
Table 3 fluorescence RT-PCR reaction system forms
3. the drafting of typical curve
After reaction terminates, the swine influenza virus M gene by fluorescence RT-PCR of the acquisition kinetic curve that increases is shown in Fig. 7, the copy number concentration of swine influenza virus M gene masculine contrast with corresponding Ct value in table 4.
The corresponding Ct value of each copy number of fluorescence quantitative RT-RCR of table 4 swine influenza virus M gene masculine contrast
With the Ct value of amplification curve for X-coordinate, with the copy number concentration of swine influenza virus M gene masculine contrast for ordinate zou drawing standard curve, the typical curve regression equation obtained is Y=-3.2618X+37.649, relation conefficient (r) is 0.9983, see Fig. 8, show that designed primer and probe amplification efficiency and combination rate are high, the reaction conditions optimized is suitable for, at least 58 swine influenza virus M gene masculine contrast RNA molecule copied can be detected, can be used for the detection by quantitative of micro-swine influenza virus M gene, there is very high detection sensitivity.
The detection of Nipah virus M gene and swine influenza virus M gene in embodiment 5 actual sample
1. the process of sample and geneome RNA thereof extract
(1) process of sample
For pig blood blood sample, directly draw 200 μ L, extract for geneome RNA; For pig muscle and organs and tissues (liver, spleen, lymphoglandula, lung, kidney) meat sample, with aseptic scissors and tweezers clip measuring samples 2.0g in mortar, abundant grinding, then add 10mL PBS and mix, or be placed in tissue homogenizer, add 10mL PBS homogenate, then tissue suspension is proceeded in aseptic Eppendorf pipe, the centrifugal 10min of 3000r/min, get supernatant liquor and proceed in another aseptic 1.5mL centrifuge tube, draw 200 μ L suspensions, extract for geneome RNA.
(2) geneome RNA extracts
Use Trizol reagent, extract sample rna, finally add 11 μ L DEPC water, mix gently according to process specifications, dissolve the RNA on tube wall, the centrifugal 5s of 2000r/min, saves backup on ice.Extract Nipah virus M gene masculine contrast RNA and swine influenza virus positive control RNA and negative tissue simultaneously and contrast RNA.
2. the preparation of fluorescence RT-PCR reaction system and amplification condition
(1) reaction system preparation
Adopt the One Step PrimeScript of TaKaRa company tMrT-PCR Kit (Perfect RealTime) fluorescence RT-PCR reaction reagent, by the reaction system composition preparation reaction system of table 3, fully mix packing 16.5 μ L in backward each fluorescent PCR pipe, then 8.5 μ L detection of nucleic acids samples are added, after centrifugal after sealing, be positioned over Light in pattern detection groove on 480 fluorescent PCR instrument.
Table 3 bifluorescence RT-PCR reaction system forms
(2) amplification condition
Reaction parameter is 42 DEG C of 5min, 95 DEG C of 10sec, then 95 DEG C of 10sec, 56 DEG C of 10sec, 60 DEG C of 30sec, 40 circulations, before the 60 DEG C of annealing that circulate each time terminate, gather fluorescent signal.
3. result judges
After off-test, observe amplification curve and the Ct value of the positive control of FAM passage and VIC passage, negative control and sample, judge to test and whether set up and the result of pattern detection.When negative control is without Ct value and without amplification curve, the Ct value of positive control should≤30.0, and occur specific amplification curve, then test establishment, otherwise this time experiment be considered as invalid.Ct value≤30.0, and there is specific amplification curve, represent in sample to there is virus, be judged to positive findings, without Ct value and without amplification curve, show in sample virus-free, be judged to negative findings.
The present invention establishes a kind of fast and convenient, high specificity, highly sensitive bifluorescence quantitative RT-PCR detection system, Nipah virus M gene and swine influenza virus M gene can be detected quick from tested sample, accurate, special, safe in 3 ~ 4 hours, easily simultaneously, can be used for detecting from while Nipah virus M gene micro-in pig blood, muscle and organs and tissues sample and swine influenza virus M gene.
In sum, content of the present invention is not limited in the above-described embodiment, and the knowledgeable people in same area can propose other embodiment easily within technical director's thought of the present invention, but this embodiment all comprises within the scope of the present invention.

Claims (5)

1. the bifluorescence RT-PCR detection reagent of a Nipah virus and swine influenza virus, it is characterized in that, comprise two pairs of Auele Specific Primers for detecting Nipah virus M gene and swine influenza virus M gene respectively, two specific probes and two positive controls, amplification target length is respectively 79bp and 80bp, and primer and probe sequence are:
Nipah virus:
Upstream primer: NIPHA-M-F:5 '-GCTCAACAGATTGACCTGGAAC-3 ' SEQ ID NO.1
Downstream primer: NIPHA-M-R:5 '-AACAGAAGGCTGCAACACAGC-3 ' SEQ ID NO.2
Probe: NIPHA-M-P:5 '-FAM-CTCGGCTGATCTCACA-3 '-MGB SEQ ID NO.3
Positive control: NIPHA-M:GATGGACATCAATCCTTGGCTCAACAGATTGACCTGGAACAACAGTTG TGAGATCAGCCGAGTAGCAGCTGTGTTGCAGCCTTCTGTTCCAAGAGAGTTCATGA TCTATGATGATGTCTTCATTGACAATACAGGGAG SEQ ID NO.4
Swine influenza virus:
Upstream primer: SIV-M-F:5 '-CGGTCTCACAGACAGATGGCTAC-3 ' SEQ ID NO.9
Downstream primer: SIV-M-R:5 '-GTGCTAGCCAACACCATTCTG-3 ' SEQ ID NO.10
Probe: SIV-M-P:5 '-VIC-ACCACCAATCCACTAATCAGGCA-3 '-MGB SEQ ID NO.11
Swine influenza virus M gene masculine control sequence: CTGATTCACAGCATCGGTCTCACAGACAGATGGCTACTACCACCAATCCACTAATC AGGCATGAGAACAGAATGGTGTTGGCTAGCACTACGGCA SEQ ID NO.12.
2. require the preparation method of the bifluorescence RT-PCR detection reagent of Nipah virus as described in 1 and swine influenza virus as profit, it is characterized in that, comprise the following steps:
(1) select Nipah virus M gene order conservative fragments to be amplification and the target sequence preparing positive control, its nucleotide sequence as shown in SEQ ID NO.4, for:
GATGGACATCAATCCTTGGCTCAACAGATTGACCTGGAACAACAGTTGTGAGATCAGCCGAGTAGCAGCTGTGTTGCAGCCTTCTGTTCCAAGAGAGTTCATGATCTATGATGATGTCTTCATTGACAATACAGGGAG；
(2) select swine influenza virus M gene order conservative fragments to be amplification and the target sequence preparing positive control, its nucleotide sequence as shown in SEQ ID NO.12, for:
CTGATTCACAGCATCGGTCTCACAGACAGATGGCTACTACCACCAATCCACTAATCAGGCATGAGAACAGAATGGTGTTGGCTAGCACTACGGCA；
(3) design 4 primers, with pcr amplification and prepare Nipah virus M gene masculine contrast, primer sequence SEQ IDNO.5-SEQ ID NO.8 is as follows:
NIPHA-F1:5’-CCTGGAACAACAGTTGTGAGATCAGCCGAGTAGCAGCTGTGTTGCAGCCTTCTGTTCC-3’
NIPHA-R1:5’-GGAACAGAAGGCTGCAACACAGCTGCTACTCGGCTGATCTCACAACTGTTGTTCCAGG-3’
NIPHA-F2:5’-GATGGACATCAATCCTTGGCTCAACAGATTGACCTGGAACAACAGTTGTGAGATC-3’
NIPHA-R2:5’-GAAGACATCATCATAGATCATGAACTCTCTTGGAACAGAAGGCTGCAACACAGCTG-3’
(4) design 4 primers, with pcr amplification and prepare swine influenza virus M gene masculine contrast, primer sequence SEQID NO.13-SEQ ID NO.16, as follows:
SIM-M-F1:5’-CTGATTCACAGCATCGGTCTCACAGACAGATGGCTACTA-3’
SIM-M-R1:5’-TGCCGTAGTGCTAGCCAACACCATTCTGTTCTCATGCCTG-3’
SIV-M-F2:5’-CACAGACAGATGGCTACTACCACCAATCCACTAATCAGGCATGAGAACAGAATGGT-3’
SIM-M-R2:5’-ACCATTCTGTTCTCATGCCTGATTAGTGGATTGGTGGTAGTAGCCATCTGTCTGTG-3’
(5) design multipair primer and many probes according to Nipah virus M gene masculine control sequence and swine influenza virus M gene masculine control sequence respectively, through a large amount of contrast shaker tests, determine the suitableeest primer pair and label probe combination:
Nipah virus:
Upstream primer: NIPHA-M-F:5 '-GCTCAACAGATTGACCTGGAAC-3 ' SEQ ID NO.1
Downstream primer: NIPHA-M-R:5 '-AACAGAAGGCTGCAACACAGC-3 ' SEQ ID NO.2
Probe: NIPHA-M-P:5 '-FAM-CTCGGCTGATCTCACA-3 '-MGB SEQ ID NO.3
Swine influenza virus:
Upstream primer: SIV-M-F:5 '-CGGTCTCACAGACAGATGGCTAC-3 ' SEQ ID NO.9
Downstream primer: SIV-M-R:5 '-GTGCTAGCCAACACCATTCTG-3 ' SEQ ID NO.10
Probe: SIV-M-P:5 '-VIC-ACCACCAATCCACTAATCAGGCA-3 '-MGB SEQ ID NO.11
(6) fluorescent reporter group detecting 5 ' end mark of the probe of Nipah virus M gene is FAM, and the non-fluorescence quenching group of 3 ' end mark is MGB; The fluorescent reporter group detecting 5 ' end mark of the probe of swine influenza virus M gene is VIC, and the non-fluorescence quenching group of 3 ' end mark is MGB;
(7) preferred through a large amount of simultaneous tests and reaction conditions, determine specificity and the sensitivity of reaction conditions, primer and probe that bifluorescence RT-PCR is the suitableeest.
3. the bifluorescence RT-PCR detection reagent of Nipah virus according to claim 2 and swine influenza virus, it is characterized in that, the suitableeest reaction conditions in described (5) is detect Nipah virus M gene and swine influenza virus M gene upper, downstream primer working concentration is 15pmol/ μ L, the working concentration of probe is 5pmol/ μ L, primer and the probe of 0.5 μ L is all added in 25 μ L systems, the specificity of primer and probe makes it be different from other virus of pig source, the sensitivity detecting Nipah virus M gene and swine influenza virus M gene reaches 46 copies ~ 58 copies respectively.
4. the application of bifluorescence RT-PCR detection reagent in production standard test kit of Nipah virus as claimed in claim 1 and swine influenza virus.
5. the bifluorescence RT-PCR detection reagent of Nipah virus as claimed in claim 1 and swine influenza virus is in the purposes of drawing Nipah virus and swine influenza virus fluorescence quantitative PCR detection typical curve.
CN201510191679.1A 2015-04-21 2015-04-21 Duplex fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection reagent for nipah virus and swine influenza virus (SIV) as well as preparation method and application of duplex fluorescent RT-PCR detection reagent Pending CN104745713A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201510191679.1A CN104745713A (en) 2015-04-21 2015-04-21 Duplex fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection reagent for nipah virus and swine influenza virus (SIV) as well as preparation method and application of duplex fluorescent RT-PCR detection reagent

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201510191679.1A CN104745713A (en) 2015-04-21 2015-04-21 Duplex fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection reagent for nipah virus and swine influenza virus (SIV) as well as preparation method and application of duplex fluorescent RT-PCR detection reagent

Publications (1)

Publication Number Publication Date
CN104745713A true CN104745713A (en) 2015-07-01

Family

ID=53585960

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201510191679.1A Pending CN104745713A (en) 2015-04-21 2015-04-21 Duplex fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection reagent for nipah virus and swine influenza virus (SIV) as well as preparation method and application of duplex fluorescent RT-PCR detection reagent

Country Status (1)

Country Link
CN (1) CN104745713A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106435040A (en) * 2016-12-27 2017-02-22 湖南新南方养殖服务有限公司 Real-time fluorescent RT-PCR (reverse transcription-polymerase chain reaction) kit for swine influenza virus in umbilical cord blood of piglets and purpose of kit

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102071256A (en) * 2009-11-25 2011-05-25 河南农业大学 Dual SYBR Green I real-time fluorescence PCR detection primer and method for porcine pseudorabies virus and porcine circovirus type 2
CN102559935A (en) * 2012-02-23 2012-07-11 天津出入境检验检疫局动植物与食品检测中心 M-gene based fluorescent RT-PCR (Reverse Transcription Polymerase Chain Reaction) detection method of Nipah virus
CN103255236A (en) * 2013-06-03 2013-08-21 广西壮族自治区兽医研究所 Double fluorescence quantitative reverse transcription-polymerase chain reaction (RT-PCR) detection kit for H7N9 avian influenza virus
CN104450955A (en) * 2014-11-12 2015-03-25 中国农业科学院哈尔滨兽医研究所 Fluorescence quantification RT-PCR (reverse transcription-polymerase chain reaction) detection kit of Eurasian avian-like type H1N1 swine influenza virus and application thereof

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102071256A (en) * 2009-11-25 2011-05-25 河南农业大学 Dual SYBR Green I real-time fluorescence PCR detection primer and method for porcine pseudorabies virus and porcine circovirus type 2
CN102559935A (en) * 2012-02-23 2012-07-11 天津出入境检验检疫局动植物与食品检测中心 M-gene based fluorescent RT-PCR (Reverse Transcription Polymerase Chain Reaction) detection method of Nipah virus
CN103255236A (en) * 2013-06-03 2013-08-21 广西壮族自治区兽医研究所 Double fluorescence quantitative reverse transcription-polymerase chain reaction (RT-PCR) detection kit for H7N9 avian influenza virus
CN104450955A (en) * 2014-11-12 2015-03-25 中国农业科学院哈尔滨兽医研究所 Fluorescence quantification RT-PCR (reverse transcription-polymerase chain reaction) detection kit of Eurasian avian-like type H1N1 swine influenza virus and application thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
董志珍等: "非洲猪瘟病毒实时荧光定量PCR检测方法的建立", 《中国兽医杂志》 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106435040A (en) * 2016-12-27 2017-02-22 湖南新南方养殖服务有限公司 Real-time fluorescent RT-PCR (reverse transcription-polymerase chain reaction) kit for swine influenza virus in umbilical cord blood of piglets and purpose of kit

Similar Documents

Publication Publication Date Title
CN104745731A (en) Triple fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection reagent for African swine fever viruses, swine fever viruses and respiratory syndrome viruses and preparation method and application thereof
CN106947838B (en) African swine fever virus non-structural gene real-time fluorescence LAMP (loop-mediated isothermal amplification) detection primer group, kit and detection method
CN107299155A (en) Primer and probe for real-time fluorescence quantitative PCR detection of goose astrovirus
CN113215164B (en) Method for detecting novel coronavirus variant and subtype
CN106957927A (en) African swine fever fluorescence PCR detection reagent, African swine fever fluorescence PCR detection reagent kit and its application
CN104745730A (en) Fluorescent PCR (Polymerase Chain Reaction) detection reagent for African swine fever virus CP204L genes and preparation method and application thereof
CN111304371B (en) Locked nucleic acid probe fluorescent quantitative PCR detection composition, detection method and detection kit for African swine fever virus wild strain
CN105420373A (en) Multiple PCR primer set and probes and detecting method for simultaneously detecting three kinds of aeromonas
CN104745729A (en) Double fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection reagent for African swine fever viruses and porcine reproductive and respiratory syndrome viruses and preparation method and application thereof
CN108624720A (en) The primed probe group and kit of RAA Fluorometric assay Rift Valley fever virus
CN104774953A (en) Fluorescent PCR (polymerase chain reaction) detection reagent for African swine fever virus (ASFV) CP530R gene, and preparation method and application thereof
CN108950086A (en) Primed probe group and detection kit based on RAA Fluorometric assay west nile virus
WO2024146625A1 (en) Duplex fluorescent pcr detection primer probe group for duck salmonella enteritidis and salmonella typhimurium, kit, and use thereof
CN111088403A (en) Constant-temperature fluorescent amplification primer group, probe, method and kit for detecting African swine fever virus
CN112458208B (en) Kit and method for detecting bovine sarcoidosis virus
CN110804677B (en) Nested double PCR detection primer and kit for distinguishing wild strain and gene deletion strain of African swine fever virus
CN104745578A (en) Duplex fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection reagent for Nipah virus and porcine reproductive and respiratory syndrome virus (PRRSV) as well as preparation method and application of duplex fluorescent RT-PCR detection reagent
CN117004777A (en) RPA composition for detecting mandarin fish rhabdovirus, application thereof and detection method
CN110964848A (en) RAA amplification primer and probe for rapidly detecting carp herpesvirus II, detection kit and use method
CN104774972A (en) Fluorescent RT-PCR detection reagent of nipah virus M gene as well as preparation method and application of fluorescent RT-PCR detection reagent
CN104745713A (en) Duplex fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection reagent for nipah virus and swine influenza virus (SIV) as well as preparation method and application of duplex fluorescent RT-PCR detection reagent
CN113755620B (en) Nucleic acid detection kit for rapidly detecting two leishmanias and application thereof
CN104762404A (en) Duplex fluorescent RT-PCR detection reagent for Nipah virus and hog cholera virus as well as preparation method and application thereof
CN113493850A (en) PCR primer probe group and kit for real-time fluorescent quantitative detection of toxoplasma gondii and eperythrozoon of pig and detection method thereof
CN111334613B (en) RPA primer pair, probe, kit and detection method for detecting canine adenovirus

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20150701