CN111088403A - Constant-temperature fluorescent amplification primer group, probe, method and kit for detecting African swine fever virus - Google Patents
Constant-temperature fluorescent amplification primer group, probe, method and kit for detecting African swine fever virus Download PDFInfo
- Publication number
- CN111088403A CN111088403A CN202010071357.4A CN202010071357A CN111088403A CN 111088403 A CN111088403 A CN 111088403A CN 202010071357 A CN202010071357 A CN 202010071357A CN 111088403 A CN111088403 A CN 111088403A
- Authority
- CN
- China
- Prior art keywords
- probe
- swine fever
- african swine
- asfv
- buffer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Abstract
The invention discloses a detection method of nucleic acid isothermal fluorescence amplification of African swine fever virus. According to the invention, by designing a specific primer and a probe and utilizing a recombinase mediated chain to replace a nucleic acid amplification technology, a sample to be detected is amplified under a constant temperature condition, and the detection of the African swine fever virus can be completed within 20 min. The kit has high sensitivity, and the lowest detection limit is 10 copies/mu L; the specificity is strong, and an effective technical means can be provided for the on-site rapid detection and screening of the African swine fever virus.
Description
Technical Field
The invention belongs to the field of virus detection, and particularly relates to a constant-temperature fluorescent amplification primer group, a probe, a method and a kit for detecting African swine fever virus.
Background
African swine fever was always present in African countries south of Sahara since 1921 after first reported in Kenya, was first released to Western Europe and Lamet in 1957, and was mostly extinguished in time, but still prevalent in grapevine, southwest Spanish and Italy, the island Sadingmu. Since 2007, African swine fever has occurred, spread, and prevailed in several countries around the world, particularly Russia and its surrounding areas. 3 months in 2017, African swine fever epidemic situation occurs in Oakzke in the far east Russian region, and the epidemic situation is close to China and is only about 1000 kilometers; in addition, China is a big country for pig raising and pork consumption, the marketing amount, the stocking amount and the pork consumption amount of live pigs are all in the top of the world, the total import amount of the pigs and pork products is huge every year, and the trade is frequent in a plurality of countries; moreover, China has frequent trips with passengers in other countries, and the number of commodities carried by the passengers is large and the types of the commodities are various. Therefore, the risk of transferring the African swine fever into China is increased, and once the African swine fever is transferred, the direct and indirect loss caused by the African swine fever is immeasurable. In contrast, in recent years, the Ministry of agriculture in China has issued urgent notices for further strengthening the work of prevention of risk of African swine fever.
African Swine Fever (ASF) is a virulent and hemorrhagic infectious disease of domestic pigs and wild pigs caused by African Swine Fever Virus (ASFV), and is characterized by short onset process, the death rate of the most acute and acute infections reaches 100%, the clinical manifestations are fever (reaching 40-42 ℃), heart beat is accelerated, dyspnea, partial cough, serous or mucoid purulent secretion of eyes and nose, skin cyanosis, obvious bleeding of lymph node, kidney and gastrointestinal mucosa, and the clinical symptoms of African swine fever are similar to those of swine fever, and the diagnosis can be confirmed only by means of laboratory monitoring.
The Recombinase mediated strand displacement nucleic acid Amplification technology (RAA) is a constant temperature nucleic acid rapid Amplification technology. RAA uses recombinase, single-strand binding protein and DNA polymerase to replace the traditional PCR thermal cycle melting process, and nucleic acid can be rapidly amplified at a constant temperature of 37 ℃. Meanwhile, the result analysis of timing and quantification can be realized by utilizing the labeling of the fluorescent probe, the biotin-labeled primer and endonuclease enzyme digestion, and the fluorescence detection result can be obtained within 20-30min generally.
The existing laboratory method for diagnosing African swine fever comprises an erythrocyte adsorption test, a direct/indirect immunofluorescence test, an animal inoculation test, an enzyme-linked immunosorbent test, an immunoelectrophoresis test, an indirect enzyme-linked immunosorbent assay and the like; however, the existing technical method is complex in operation, high in technical requirement on operators, long in time and incapable of detecting samples in batches, so that the establishment of a rapid and accurate detection method is particularly important.
Disclosure of Invention
The invention aims to provide a constant-temperature fluorescence amplification detection method for African swine fever virus nucleic acid, which utilizes an RAA technology to rapidly judge the African swine fever virus in a large scale in a short time.
The technical scheme adopted by the invention is as follows:
in a first aspect of the present invention, a primer set for detecting african swine fever virus nucleic acid is provided, wherein the nucleic acid sequence of the primer set is:
ASFV-F：5’-CAAGGTTCACGTTCTCRTTAAACCAAAAGCGC-3’；
ASFV-R：
5’-CTTAATCCAGAGCGCAAGAGGGGGCTGATAG[FAM-dT][THF][BHQ1-dT]TTAGGGGTTTGAGGY-3’。
according to the embodiment of the invention, the optimal concentration of both ASFV-F and ASFV-R is 300-350 nM; according to a preferred embodiment of the present invention, the optimum concentration of ASFV-F and ASFV-R are 300nM each.
In a second aspect of the invention, a RAA-exo probe ASFV-P labeled with a THF residue for use in the detection of african swine fever virus, said probe having the nucleic acid sequence:
ASFV-P：5’-GGAYGCAACGTATCTGGACATAAGACGTAATG-3’。
according to the embodiment of the invention, the fluorescent group marked at the 5 'end of the probe sequence is FAM, and the quenching group marked at the 3' end of the probe sequence is BHQ 1; the optimal concentration of the probe is 200-250 nM; preferably, the optimal concentration of the probe is 200 nM.
In a third aspect of the invention, a kit for detecting African swine fever virus is provided, wherein the kit comprises the primer set and the probe.
According to the embodiment of the invention, the kit also comprises a fluorescent RAA reaction unit, Buffer A, Buffer B, a negative control and a positive control; buffer A is a hydrolysis Buffer solution; buffer B is magnesium acetate.
According to an embodiment of the present invention, the fluorescent RAA reaction unit contains a recombinase, a single-strand binding protein, a strand-displacement DNA polymerase lyophilized enzyme powder, and dntps.
According to the embodiment of the invention, the optimal concentration of the magnesium acetate is 280-320 mM; preferably, the optimal concentration of magnesium acetate is 280 mM.
In a fourth aspect of the present invention, there is provided a method for detecting african swine fever virus, comprising the steps of:
(1) extracting DNA of a sample to be detected;
(2) using the extracted DNA as a template, performing fluorescent RAA amplification using the primer set and the probe,
obtaining an amplification curve and analyzing a Ct value;
(3) and (4) judging a result: and analyzing the amplification curve, analyzing the Ct value and judging whether the African swine fever virus exists in the sample.
According to an embodiment of the present invention, the amplification system in step (2) is: mixing 1 μ L of ASFV-F primer, 1 μ L of ASFV-R primer, 1 μ L of ASFV-P probe, and 42.5 μ L of hydrolysis Buffer (Buffer A), and dissolving RAA reaction unit (lyophilized powder); magnesium acetate 2.5. mu.L (buffer B), DNA template 5. mu.L.
According to an embodiment of the present invention, the amplification procedure described in step (2) is: and (3) collecting fluorescence signals at the temperature of 39-42 ℃ for 30 seconds for 40 cycles.
According to the embodiment of the present invention, the result determination method in step (3) is: if the Ct value is less than 35, judging the test result to be positive; if the Ct value is more than or equal to 40, judging the result as negative; if the Ct value is less than 35 and less than 40, the detection is judged to be suspicious, and repeated detection is needed for confirmation. And if the detection result is still 35< Ct value <40, the negative control Ct value is referred, and if the negative control peak time Ct value is more than or equal to 40, the positive result is judged.
The invention has the beneficial effects that:
the kit provided by the invention can realize effective amplification of the target gene under the condition of 37-42 ℃ by using isothermal amplification reaction, can realize detection of the African swine fever virus within 20min, and has strong specificity and high sensitivity. Therefore, the kit has the characteristics of simple, rapid and sensitive operation, provides an effective technical means for the on-site rapid detection and screening of the African swine fever virus, and has very important significance for controlling the spread of the African swine fever virus.
Detailed Description
The present invention will be further described with reference to the following examples, but is not limited thereto.
Example 1 design of fluorescent RAA primer set and Probe
According to 24 genotype reference strains of the African swine fever virus and a p72 gene sequence of the African swine fever strain separated from China, a conserved region is screened, and a primer and a probe are designed. The invention screens out a group of primer pairs ASFV-F, ASFV-R and probes ASFV-P with high sensitivity and strong specificity for amplifying African swine fever virus gene sequences through a large amount of screening, and the nucleotide sequences are as follows:
ASFV-F：CAAGGTTCACGTTCTCRTTAAACCAAAAGCGC(SEQ ID NO:1)；
ASFV-R：
CTTAATCCAGAGCGCAAGAGGGGGCTGATAG[FAM-dT][THF][BHQ1-dT]TTAGGGGTTTGAGGY(SEQ ID NO:2)；
ASFV-P：FAM-GGAYGCAACGTATCTGGACATAAGACGTAATG-BHQ1(SEQ ID NO:3)。
example 2
(1) Preparation of Standard samples
Artificially synthesizing the full length of p72 gene of ASFV reference gene II type Chinese separated strain (accession number: AF270706), and connecting the gene into a pUC57 vector to obtain a vector of the African swine fever target sequence, namely a positive control of the African swine fever virus.
(2) Positive control fluorescent RAA assay
And (2) performing fluorescent RAA amplification on the diluted plasmid standard by using the primer group ASFV-F, ASFV-R and the probe ASFV-P in the example 1 under the optimal amplification condition by using the positive standard prepared in the step (1), and taking pUC57 plasmid without African swine fever virus gene fragment as a negative control.
The reaction system is as follows: mixing 1 μ L of ASFV-F primer, 1 μ L of ASFV-R primer, 1 μ L of ASFV-P probe, and 42.5 μ L of hydrolysis Buffer (Buffer A), and dissolving RAA reaction unit (lyophilized powder); magnesium acetate 2.5 μ L (buffer B), DNA template 5 μ L; the fluorescent RAA reaction unit contains recombinase, single-strand binding protein, strand displacement DNA polymerase freeze-dried enzyme powder and dNTP.
The reaction procedure is as follows: and (3) collecting fluorescence signals at 39 ℃ for 30 seconds for 40 cycles to obtain a Ct value.
(3) And (4) judging a result: and analyzing the Ct value to judge whether the African swine fever virus exists in the sample. The implementation shows a typical amplification curve, and the sample is judged to be positive by judging that the sample is positive by the African swine fever virus nucleic acid if the peak-out time is less than or equal to 15min (Ct value is less than or equal to 30).
Example 3
(1) And extracting DNA of tissue samples such as spleen, muscle and the like of the sample to be detected, a whole blood sample, a feed sample, sewage and a feces sample.
(2) Using the extracted DNA as a template, performing fluorescent RAA amplification by using the primer group and the probe in the embodiment 2, using the recombinant plasmid in the embodiment 2 as a positive control, and using a plasmid without an African swine fever virus gene fragment as a negative control;
the reaction system is as follows: mixing 1 μ L of ASFV-F primer, 1 μ L of ASFV-R primer, 1 μ L of ASFV-P probe, and 42.5 μ L of hydrolysis Buffer (Buffer A), and dissolving RAA reaction unit (lyophilized powder); magnesium acetate 2.5 μ L (buffer B), DNA template 5 μ L; the reaction procedure is as follows: fluorescence signals were collected at 42 ℃ for 30 seconds for 40 cycles to obtain Ct values.
(3) And (4) judging a result:
positive control: typical amplification curves appear, the peak-out time is less than or equal to 15min (Ct value is less than or equal to 30);
negative control: no amplification curve appears, or the peak-out time is more than or equal to 0min (the Ct value is more than or equal to 40);
the sample to be detected shows a typical amplification curve and:
a. if the peak-out time is less than or equal to 17.5min (Ct value is less than 35), judging the sample to be positive;
b. if the peak-out time is more than or equal to 20min (Ct value is more than or equal to 40), judging the sample to be negative;
c. if the peak time is less than 20min (35< Ct value <40) at 17.5min, the sample is judged to be suspicious and needs to be checked repeatedly.
And (3) the result of the secondary detection is still 17.5min < the peak-out time <20min (35< the Ct value <40), the negative control peak-out time (Ct value) is referred to, and if the negative control peak-out time is more than or equal to 20min (the Ct value is more than or equal to 40), the African swine fever virus nucleic acid of the sample is judged to be positive.
The following further tests the sensitivity and specificity of the method of the invention.
Sensitivity test
By ddH2Recombinant plasmid in example 2 (concentration 10)6copies/. mu.L) were diluted by a factor of 10 each110 times of210 times of310 times of410 times of510 times of6And taking a pUC57 plasmid without the African swine fever virus gene fragment as a negative control, preparing a reagent according to a reaction system of the kit and setting a reaction program.
The result shows that the lowest detection limit of the kit is 10 copies/mu L, which indicates that the kit has higher sensitivity.
Specificity test
Extracting nucleic acid of classical swine fever virus, nucleic acid of circovirus, nucleic acid of parvovirus, nucleic acid of foot-and-mouth disease virus, nucleic acid of porcine reproductive and respiratory syndrome virus and nucleic acid of pseudorabies virus, taking the recombinant plasmid in the embodiment 2 as a positive control, taking the plasmid without African swine fever virus gene segment as a negative control, respectively taking the plasmids as templates to carry out constant-temperature amplification detection, preparing reagents according to a kit system and setting a reaction program.
The result shows that only the African swine fever virus recombinant plasmid has a Ct value in the detection result; all other samples have no Ct value, so all other samples are judged to be negative.
In conclusion, the kit has higher sensitivity, and the lowest detection limit is less than 10 copies/mu L; the kit has good specificity, so the kit can be used for detecting and preventing the infection of the African swine fever virus.
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.
SEQUENCE LISTING
<110> institute of animal health of academy of agricultural sciences of Guangdong province, university of agriculture of south China, Zhengzhou Zhongdao Biotechnology Co., Ltd
<120> constant-temperature fluorescent amplification primer group, probe, method and kit for detecting African swine fever virus
<130>
<160>3
<170>PatentIn version 3.5
<210>1
<211>32
<212>DNA
<213> Artificial sequence
<400>1
caaggttcac gttctcrtta aaccaaaagc gc 32
<210>2
<211>31
<212>DNA
<213> Artificial sequence
<400>2
cttaatccag agcgcaagag ggggctgata g 31
<210>3
<211>32
<212>DNA
<213> Artificial sequence
<400>3
ggaygcaacg tatctggaca taagacgtaa tg 32
Claims (10)
1. A constant-temperature fluorescent amplification primer group for detecting African swine fever viruses is characterized in that the nucleotide sequence of the primer group is as follows:
ASFV-F：5’-CAAGGTTCACGTTCTCRTTAAACCAAAAGCGC-3’；
ASFV-R：5’-CTTAATCCAGAGCGCAAGAGGGGGCTGATAG[FAM-dT][THF][BHQ1-dT]TTAGGGGTTTGAGGY-3’。
2. a RAA-exo probe ASFV-P marked with THF residue for detecting African swine fever virus, characterized in that the nucleotide sequence of the probe is:
ASFV-P：5’-GGAYGCAACGTATCTGGACATAAGACGTAATG-3’。
3. the probe of claim 2, wherein the fluorescent group labeled at the 5 'end of the probe sequence is FAM and the quencher group labeled at the 3' end of the probe sequence is BHQ 1.
4. A kit for detecting African swine fever virus, comprising the primer set of claim 1 and the probe of claim 2 or 3.
5. The kit according to claim 4, further comprising a fluorescent RAA reaction unit, Buffer A, Buffer B, a negative control and a positive control; buffer A is a hydrolysis Buffer solution; buffer B is magnesium acetate.
6. The kit of claim 5, wherein the fluorescent RAA reaction unit comprises recombinase, single-strand binding protein, strand-displacement DNA polymerase lyophilized enzyme powder, and dNTP.
7. A method for detecting African swine fever virus is characterized by comprising the following steps:
(1) extracting DNA of a sample to be detected;
(2) performing fluorescent RAA amplification by using the extracted DNA as a template and the primer set of claim 1 and the probe of claim 2 or 3 to obtain an amplification curve;
(3) and (4) judging a result: and analyzing the amplification curve to judge whether the sample contains the African swine fever virus.
8. The method of claim 7, wherein the amplification system in step (2) is: mu.L of ASFV-F primer, 1 mu.L of ASFV-R primer, 1 mu.L of ASFV-P probe, and 42.5 mu.L of Buffer A, and dissolving the RAA reaction unit; buffer B2.5. mu.L, DNA template; wherein, Buffer A is a hydrolysis Buffer solution; the Buffer B is magnesium acetate, and the RAA reaction unit is freeze-dried powder.
9. The method of claim 7, wherein the amplification procedure in step (2) is: and (3) collecting fluorescence signals at 39-42 ℃ for 30 seconds in 40 cycles.
10. The method of claim 7, wherein the result determination method of step (3): if the Ct value is less than 35, judging the test result to be positive; if the Ct value is more than or equal to 40, judging the result as negative; if the Ct value is more than 35 and less than 40, the detection is judged to be suspicious and needs to be repeatedly detected; and if the detection result is that the Ct value is less than 35 and less than 40, the negative control Ct value is referred, and if the negative control peak time Ct value is more than or equal to 40, the positive result is judged.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010071357.4A CN111088403A (en) | 2020-01-21 | 2020-01-21 | Constant-temperature fluorescent amplification primer group, probe, method and kit for detecting African swine fever virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010071357.4A CN111088403A (en) | 2020-01-21 | 2020-01-21 | Constant-temperature fluorescent amplification primer group, probe, method and kit for detecting African swine fever virus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111088403A true CN111088403A (en) | 2020-05-01 |
Family
ID=70399710
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010071357.4A Pending CN111088403A (en) | 2020-01-21 | 2020-01-21 | Constant-temperature fluorescent amplification primer group, probe, method and kit for detecting African swine fever virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111088403A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111593139A (en) * | 2020-05-13 | 2020-08-28 | 中国农业大学 | RT-RAA primer, probe and kit for detecting classical swine fever virus and application |
| CN113186344A (en) * | 2021-04-25 | 2021-07-30 | 济南国益生物科技有限公司 | Primer probe set for detecting African swine fever virus ASFV based on LFD-RMA method |
| CN114525190A (en) * | 2022-01-11 | 2022-05-24 | 山东师范大学 | Integrated detection system and detection method for African swine fever virus |
| CN114752710A (en) * | 2022-05-26 | 2022-07-15 | 中国农业科学院都市农业研究所 | CrRNA, kit and method for rapid visual detection of SADS-CoV |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110358867A (en) * | 2019-08-21 | 2019-10-22 | 郑州中道生物技术有限公司 | African hog cholera virus fluorescent type RAA detection kit |
| CN110699490A (en) * | 2019-11-12 | 2020-01-17 | 南宁众册生物科技有限公司 | RAA constant-temperature fluorescence detection primer probe set, kit and method for African swine fever virus CD2V gene |
-
2020
- 2020-01-21 CN CN202010071357.4A patent/CN111088403A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110358867A (en) * | 2019-08-21 | 2019-10-22 | 郑州中道生物技术有限公司 | African hog cholera virus fluorescent type RAA detection kit |
| CN110699490A (en) * | 2019-11-12 | 2020-01-17 | 南宁众册生物科技有限公司 | RAA constant-temperature fluorescence detection primer probe set, kit and method for African swine fever virus CD2V gene |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111593139A (en) * | 2020-05-13 | 2020-08-28 | 中国农业大学 | RT-RAA primer, probe and kit for detecting classical swine fever virus and application |
| CN113186344A (en) * | 2021-04-25 | 2021-07-30 | 济南国益生物科技有限公司 | Primer probe set for detecting African swine fever virus ASFV based on LFD-RMA method |
| CN114525190A (en) * | 2022-01-11 | 2022-05-24 | 山东师范大学 | Integrated detection system and detection method for African swine fever virus |
| CN114752710A (en) * | 2022-05-26 | 2022-07-15 | 中国农业科学院都市农业研究所 | CrRNA, kit and method for rapid visual detection of SADS-CoV |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111088403A (en) | Constant-temperature fluorescent amplification primer group, probe, method and kit for detecting African swine fever virus | |
| CN110760617B (en) | Real-time fluorescent PCR primer probe combination and kit for detecting African swine fever virus wild virus | |
| CN111172321B (en) | Fluorescent PCR detection kit for identifying African swine fever infection and immunity | |
| CN110760620A (en) | Classical swine fever virus and African classical swine fever virus dual-fluorescence PCR detection reagent, kit and detection method | |
| CN110358867A (en) | African hog cholera virus fluorescent type RAA detection kit | |
| CN112176103A (en) | African swine fever virus fluorescence ERA constant temperature rapid detection kit | |
| CN105603123A (en) | Real-time fluorescence RPA reagent kit and test strip RPA reagent kit for rapidly detecting porcine parvovirus and application of reagent kits | |
| CN113462820A (en) | Multiplex RT-PCR primer probe set for real-time fluorescent quantitative detection of four porcine diarrhea viruses, kit and detection method thereof | |
| CN110699485B (en) | RPA primer pair, probe, kit and detection method for rapidly detecting Marek's disease virus | |
| CN114350848B (en) | Dual fluorescent probe primer combination for identifying African swine fever type I strain and type II strain, kit and application thereof | |
| CN104774953A (en) | Fluorescent PCR (polymerase chain reaction) detection reagent for African swine fever virus (ASFV) CP530R gene, and preparation method and application thereof | |
| CN112458208B (en) | Kit and method for detecting bovine sarcoidosis virus | |
| CN111471800B (en) | Kit for detecting novel coronavirus and amplification primer composition thereof | |
| CN111676316B (en) | Primer, probe and detection method for rapidly distinguishing African swine fever virus gene type II from other genotypes | |
| CN108359743A (en) | A kind of HRM primer group for differentiating FPV and CPV, the kit containing the primer sets and its application | |
| CN112646927A (en) | Fluorescent RAA kit for detecting bovine sarcoidosis virus, detection method and application thereof | |
| AU2021104086A4 (en) | Detection reagent for fluorescent duplex pcr for classical swine fever virus and african swine fever virus, kit, and detection method | |
| CN111334613B (en) | RPA primer pair, probe, kit and detection method for detecting canine adenovirus | |
| CN113493850A (en) | PCR primer probe group and kit for real-time fluorescent quantitative detection of toxoplasma gondii and eperythrozoon of pig and detection method thereof | |
| CN111004868A (en) | Fluorescent PCR (polymerase chain reaction) primer, probe and kit for detecting goat intranasal tumor virus | |
| CN111500773A (en) | Fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) primer, probe and kit for identifying serotype of epidemic hemorrhagic disease virus | |
| CN116814848B (en) | Primer, probe and method for detecting mouse parvovirus based on fluorescence RAA | |
| AU2021102364A4 (en) | Fluorescent pcr primer, probe and kit for detecting bovine rhinitis b virus | |
| CN103882150A (en) | Primer, probe and real-time fluorescent PCR (polymerase chain reaction) method for detecting TTSuV II (torque teno sus virus II) | |
| CN103882151A (en) | Primer, probe and real-time fluorescence polymerase chain reaction (PCR) detection method for detecting I-type torque teno sus virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |