CN103320528A - Primer pair and probe for detecting avian influenza virus in sample by fluorescence RT-PCR and kit containing primer pair and probe - Google Patents
Primer pair and probe for detecting avian influenza virus in sample by fluorescence RT-PCR and kit containing primer pair and probe Download PDFInfo
- Publication number
- CN103320528A CN103320528A CN2013102165396A CN201310216539A CN103320528A CN 103320528 A CN103320528 A CN 103320528A CN 2013102165396 A CN2013102165396 A CN 2013102165396A CN 201310216539 A CN201310216539 A CN 201310216539A CN 103320528 A CN103320528 A CN 103320528A
- Authority
- CN
- China
- Prior art keywords
- probe
- influenza virus
- primer
- avian influenza
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a primer and a probe sequence for detecting avian influenza virus, especially the nucleotide fragment of type H7 (including H7N9) and a kit containing the primer and the probe sequence. The primer and the probe sequence provided by the invention can be used to realize high-sensitivity and high-specificity detection of avian influenza virus, especially type H7 (including H7N9).
Description
Technical field
The present invention relates to a kind of primer and probe sequence for detection of avian influenza virus, particularly H7 type nucleotide fragments, and the test kit that comprises described primer and probe sequence.
Background technology
Bird flu mainly refers to the popular infectious diseases that is caused by influenza virus in the fowl.From in March, 2013 since the outburst of Shanghai, two places, Anhui, on April 21st, 2013, China reported that altogether 102 examples are diagnosed as the case of bird flu H7N9, dead 20 people wherein, 12 people's rehabilitations, all the other 70 people just accept treatment in each fixed medical unit, relate to Shanghai, Jiangsu, the provinces and cities such as Anhui, Zhejiang.For constantly spreading of epidemic situation, national health and Family Planning Committee have put into effect rapidly the people and have infected H7N9 bird flu diagnosis and treatment scheme, health competent authorities of relevant provinces and cities also start the epidemic prevention and control emergency preplan one after another, strive epidemic situation is controlled to minimum extent, alleviate to greatest extent epidemic situation harm.
Up-to-date comparative study discovery, the avian influenza virus that is all the H7 hypotype that the gene diversity of current H7N9 virus occurs previously in Europe is suitable, and this is indicating that the viral ability that morphs is stronger, the variation situation worthy of vigilance that it is following possible." Europe monitoring " magazine is published online a research report a few days ago and is said, the researchists of mechanism such as the national public health of Holland and Environmental Research Institute go together with China, analyzed the gene data of H7N9 virus stain, and with the H7N7 virus that causes Dutch bird flu in 2003, caused 1999 and the H7N1 virus of Italian bird flu in 2000 contrasts.Found that, the gene diversity of these three kinds of H7 C-type virus Cs is suitable, so new virus may also have stronger variation ability.
Stronger variability for bird flu H7 C-type virus C, conservative when having designed a pair of Auele Specific Primer, the district adds again a specific fluorescent probe at it, guarantee accurately to measure bird flu H7 C-type virus C, can prevent simultaneously the further variation of H7N9, cause in time to detect positive-virus, and postponed treatment time, come life danger for human health care belt.
And bird particularly aquatic bird be the natural reservoir (of bird flu viruses) of all these influenza viruses, the H7 avian influenza virus is wherein a kind of.This viral Biological characteristics, virulence, transmissibility also have no basis up till now and analyze judgement.
At present common virus is separated and serological diagnostic method, and complex operation, consuming time, susceptibility is low, poor specificity, is not suitable for the early diagnosis as virus.Along with the development of Protocols in Molecular Biology, the regular-PCR method has been widely used in clinical diagnosis, but this Technology Need carries out aftertreatment to the PCR product, very easily causes the PCR product pollution, and certain non-specific amplification is arranged simultaneously.Fluorescence PCR assay then is on the basis of regular-PCR technology, adds a specific fluorescent probe in a pair of Auele Specific Primer of adding in amplification reaction system again, detects the technology of target nucleotide sequences with the fluorescent PCR detector of Real-Time Monitoring.Except the advantage with regular-PCR, it also has the following advantages: (1) specificity is stronger, and sensitivity is higher.Since used more one can with the fluorescent probe of template complementary pairing, improved specificity, and collected fluorescent signal by self-reacting device, avoided the subjectivity of artificial judgment, can further improve again sensitivity; (2) totally-enclosed reaction, online Real-Time Monitoring fluorescence, aftertreatment that need not the PCR product is avoided polluting, and has guaranteed result's reliability; (3) data analysis is selected in the logarithmic phase of nucleic acid amplification, abandons the end point analysis method that is subjected to multifactor interference of regular-PCR method, so that quantitatively more accurately and reliably; (4) can realize the two inspections of single tube or many inspections, also can design mark in the specific aim, monitoring extraction efficiency and get rid of inhibitor and disturb; (5) do not contact toxic reagent, operational safety; (6) be conducive to mass-producing, automatization and network management; (7) scope of application is wider, can detect in theory the nucleic acid of any virus.
For avian influenza virus, also need to develop new highly sensitive fluorescent PCR detecting primer, probe and the corresponding universal testing product of testing product, particularly H7 at present.
Summary of the invention
The purpose of this invention is to provide a kind of primer for detection of the avian influenza virus nucleotide fragments and probe sequence.
Another object of the present invention provides a kind of for the test kit with fluorescence RT-PCR test sample avian influenza virus.
Based on above-mentioned purpose, the present invention by the following technical solutions:
On the one hand, the invention provides a pair of nucleotide sequence, it can be used as the primer pair that detects avian influenza virus, described primer pair is comprised of upstream primer and downstream primer, upstream primer (being called again " H7N9-4.0-F " herein) comprises the nucleotide sequence shown in the SEQ ID NO.1, and downstream primer (being called again " H7N9-4.0-R " herein) comprises the nucleotide sequence shown in the SEQ ID NO.2:
SEQ?ID?NO.1GGTTTAGCTTCGGGGCATC；
SEQ?ID?NO.2TATATACAAATAGTGCACCGCATGT。
Preferably, the nucleotide sequence of described upstream primer is shown in SEQ ID NO.1, and the nucleotide sequence of described downstream primer is shown in SEQ ID NO.2.
On the other hand, the invention provides a nucleotide sequence, it can be used as the probe that detects avian influenza virus, and described probe (being called again " H7N9-4.0-B " herein) comprises the nucleotide sequence shown in the SEQ ID NO.3:
SEQ?ID?NO.3TTATGCAAATGAAAACCAATCCCATTG。
Preferably, the nucleotide sequence of described probe is shown in SEQ ID NO.3.
And 3 ' end of described probe is marked with the fluorescent quenching group, and described fluorescent quenching group is BHQ1 or TAMRA, preferred BHQ1; 5 ' end of described probe is marked with the fluorescence report group, and described fluorescence report group is FAM or ROX, preferred FAM.
In addition, above-mentioned primer pair and probe are for detection of avian influenza virus, and described avian influenza virus is preferably the H7 type, further preferred H7N9 hypotype.
The detection principle that adopts above-mentioned primer pair and probe in detecting avian influenza virus is to utilize above-mentioned a pair of Auele Specific Primer and a specificity fluorescent probe, adopt the compositions such as hot resistant DNA polymerase (Taq enzyme), ThermoScript II, four kinds of nucleotide monomers (dNTP), and use the nucleic acid fragment amplification that the RT-PCR technology realizes avian influenza virus target nucleotide sequences to be determined.Wherein, employed probe is the oligonucleotide of two ends difference mark fluorescent reporter group (R) and fluorescent quenching group (Q).When probe is complete, the fluorescent signal of reporter group emission is absorbed by quenching group, and in the pcr amplification process, 5 ' end 5 prime excision enzyme activity of Taq enzyme is cut degraded with the fluorescent probe enzyme of specific binding on the target nucleotide fragment, and the fluorescence report group is free in the reaction system.Because broken away from the shielding effect of fluorescent quenching group, the fluorescent signal of this fluorescence report group just can be detected by instrument, and the variation of fluorescent signal amount is directly proportional with the amplified production amount, thus the existence of target nucleotide sequences in the judgement sample to be tested.
On the other hand, the present invention also is provided for the test kit with avian influenza virus in the fluorescence RT-PCR test sample.This test kit can be used for the fluorescence RT-PCR reaction fast, whether test sample exists avian influenza virus delicately, and namely whether test sample has infected avian influenza virus.
Particularly, test kit of the present invention comprises:
(1) primer pair mentioned above provided by the invention;
(2) probe mentioned above provided by the invention;
Preferably, described test kit also comprises:
(3) dNTPs(contains dUTP);
(4) PCR reaction buffer;
（5）Mg
2+；
(6) Taq enzyme;
(7) ThermoScript II.
Further preferably, described test kit also comprises:
(8) avian influenza virus RNA extracting solution is Trizol Reagent total RNA extraction reagent; According to the specific embodiment of the present invention, employing be Trizol Reagent total RNA extraction reagent available from Invitrogen;
(9) negative quality control product is water, is preferably DEPC water; With
(10) positive quality control product is the deactivation strain, is preferably H7N9 deactivation strain.
When adopting test kit provided by the invention to carry out avian flu virus detection, the reaction system of RT-PCR amplification comprises in 25 μ l:
(1) each 0.2 μ mol/L of the upstream primer of described primer pair and downstream primer;
(2) described probe 0.1 μ mol/L;
(3) dNTPs(contains dUTP) 0.2mmol/L;
(4) PCR reaction buffer, final concentration 1 *;
（5）Mg
2+2.5mmol/L；
(6) Taq enzyme 2U;
(7) ThermoScript II 4U;
(8) water is preferably DEPC water, mends to 25 μ l after adding the RNA template.
Mentioned reagent box provided herein is for detection of avian influenza virus, and described avian influenza virus is preferably the H7 type, further preferred H7N9 hypotype.
When detecting, the reaction conditions of described RT-PCR is:
50 ℃ 20 minutes; Then be: 95 ℃ 3 minutes, 1 circulation; 95 ℃ 5 seconds, 60 ℃ 40 seconds, 40 circulations.
The sample that test kit provided herein can detect is from bird or mammiferous brush,throat, cloaca swab, tissue samples, serum or blood plasma.For example people's brush,throat, cloaca swab, fowl brush,throat, cloaca swab, freezing poultry tissues transudate, chick embryo allantoic liquid equal samples.
The detection principle of test kit provided herein is, utilize above-mentioned a pair of Auele Specific Primer and a specificity fluorescent probe, in comprising the RT-PCR reaction buffers such as ThermoScript II, hot resistant DNA polymerase, deoxyribonucleoside triphosphate and magnesium ion, avian influenza virus in the amplification detected sample, realize the cyclic amplification of target nucleotide by multiple commercially available fluorescent PCR amplification instrument, thereby fast, the avian influenza virus in the test sample delicately.
Compared with prior art, technical scheme of the present invention has the following advantages:
(1) the present invention compares analysis to all known avian influenza virus H7N9 subtype gene group sequences respectively, selects to carry out the design of primer and probe without the section of secondary structure and high conservative, has avoided the generation of false negative result.
(2) detection sensitivity of primer provided by the invention and probe can reach 1000 copy/ml, illustrates that it has good sensitivity.
(3) primer provided by the invention and probe without amplified signal, illustrate that it has good specificity for the detection sample standard deviation that does not contain avian influenza virus H7 type.
(4) because the present invention adopts fluorescent RT-PCR technology as detection method, whole reaction is all carried out in the reaction tubes of sealing, has avoided other nucleic acid detection methods such as PCR-electrophoresis etc. to be easy to form Aerosol Pollution and causes false positive results.And, because the RT-PCR product is carried out Real-Time Monitoring, greatly saved monitoring time, saved manpower and materials.
(5) test kit that comprises above-mentioned primer and probe provided by the invention can be used for fast, the high throughput testing avian influenza virus, greatly shorten sense cycle, for the treatment of disease and the control of epidemic situation are given security.
Description of drawings
Below, describe by reference to the accompanying drawings embodiment of the present invention in detail, wherein:
Fig. 1 has shown the fluorescence RT-PCR amplification figure of the sensitivity that detects avian influenza virus H7N9 hypotype positive among the embodiment 2.
Fig. 2 has shown the fluorescence RT-PCR amplification figure of the positive sample of utilizing test kit detection of the present invention among the embodiment 3.
Embodiment
Referring to specific embodiment the present invention is described.It will be appreciated by those skilled in the art that these embodiment only are used for explanation the present invention, the scope that it does not limit the present invention in any way.
Experimental technique among the following embodiment if no special instructions, is ordinary method.Used medicinal raw material, reagent material etc. if no special instructions, are commercially available purchase product among the following embodiment.
Embodiment 1The foundation of primer and probe design and reaction system and optimization
1. primer and probe design:
By respectively all known avian influenza virus H7 type (comprising H7N9) genome sequences being compared analysis, selection is without the section of secondary structure and high conservative, design manyly to primer and probe, primer length is generally about 20 bases, between primer and in the primer without complementary sequence.Optimum primer, probe sequence make up as follows:
Upstream primer H7N9-4.0-F:GGTTTAGCTTCGGGGCATC
Downstream primer H7N9-4.0-R:TATATACAAATAGTGCACCGCATGT
Probe H7N9-4.0-B:TTATGCAAATGAAAACCAATCCCATTG
2. the foundation of reaction system and optimization:
The target region template obtains with following method: utilize the avian influenza virus H7 type of deactivation (to comprise H7N9, Products in China calibrating institute provides) strain is as sample to be checked, extract virus gene genome nucleic acid with the extracting method of phenol chloroform, be stored in after the packing-20 ℃ for subsequent use.
2.1 the optimization of primer concentration is in reaction system, the primer concentration of avian influenza virus H7 type (comprising H7N9) is done to detect after the multiple proportions serial dilution from 0.1 μ mol/L to 0.8 μ mol/L respectively, analysis by test-results is compared, and determines that best primer final concentration is 0.2 μ mol/L.
2.2 under the constant prerequisite of the optimization of magnesium ion concentration other condition in reaction system, with MgCl
2Concentration increase progressively with 0.5mmol/L from 1mmol/L to 2.5mmol/L, be magnesium ion concentration in the test kit reaction system through the selected 2.5mmol/L of repeated experiments repeatedly.
2.3Taq the optimization of archaeal dna polymerase (Taq enzyme) consumption is by comparing the optimization experiment result of Taq enzyme dosage (in the Unit of unit), selected 2U is as the consumption of Taq enzyme in the test kit reaction system.
2.4 the optimization of ThermoScript II consumption is by comparing the optimization experiment result of ThermoScript II consumption (in the Unit of unit), selected 4U is as the consumption of ThermoScript II in the test kit reaction system.
2.5dNTPs the optimization of concentration detects by the dNTPs that uses different concns, selects 0.2mmol/L as the usage quantity of dNTPs in the test kit reaction system after the comprehensive assessment.
2.6 the optimization of concentration and probe concentration is in reaction system, the concentration and probe concentration of avian influenza virus H7 type (comprising H7N9) is done to detect after the multiple proportions serial dilution from 0.05 μ mol/L to 0.2 μ mol/L respectively, analysis by test-results is compared, and determines that best probe final concentration is 0.1 μ mol/L.
Utilize above-mentioned primer and probe to carry out the foundation of reaction system, determine that at last the fluorescence RT-PCR reaction system that adopts is 25 μ l systems, required each component and respective concentration see Table 1.
RT-PCR reaction system after table 1 is optimized
| Component | |
| 10 * |
1× |
| Mg 2＋ | 2.5mmol/L |
| DNTPs(contains dUTP) | 0.2mmol/L |
| The Taq enzyme | 2U |
| ThermoScript II | 4U |
| Primer (upstream) | 0.2μmol/L |
| Primer (downstream) | 0.2μmol/L |
| Probe | 0.1μmol/L |
| After adding template, moisturizing extremely | 25μl |
Annotate: a. at the fluorescence RT-PCR reaction volume not simultaneously, each reagent should be adjusted in proportion.
B. the instrument that uses is different, reaction parameter should be appropriately adjusted.
3. the selection of instrument sense channel: when carrying out the fluorescence RT-PCR reaction, the collection of reaction tubes fluorescent signal arranges in the reply instrument, and the fluorescence detection channel of selection is consistent with the fluorescence report group of probe institute mark.Concrete method to set up is different because of instrument, should be with reference to the instrument working instructions.
4.RT-PCR it is as follows that condition is selected:
50 ℃ of reverse transcriptions 20 minutes; Then be: 95 ℃ 3 minutes, 1 circulation; 95 ℃ 5 seconds, 60 ℃ 40 seconds, 40 circulations.
Embodiment 2Detect the sensitivity experiment of the copy number of H7N9 subtype influenza virus
Be 10 with concentration
6The H7N9 deactivation strain that the Products in China calibrating of individual copy/ml provides is by 10 times of gradient dilutions to 10
5Individual copy/ml, 10
4Individual copy/ml, 10
3Individual copy/ml, 10
2Individual copy/ml, the reaction system of primer, probe and the foundation of the design of 1-4 step and instrument, amplification condition among the employing embodiment 1 carry out fluorescence RT-PCR and detect.
The result shows, 10
3During individual copy/ml, the CT value is 25, and all other indexs also meet testing requirement.Therefore, the present invention has improved the sensitivity that detects by optimizing primer and probe, and its sensitivity can reach 10
3Individual copy/ml.The results are shown in Figure 1.
Embodiment 3Detect the specificity experiment of H7N9 subtype influenza virus
This experimental example proves, adopts reagent provided by the invention or test kit, can detect the virus in the various positive sample under the condition of setting up, and negative sample is without detected result.
1. sample:
Detect sample 120 person-portions, comprising sample 31 examples that are defined as the avian influenza virus H7N9 positive through the CDC recommend method, positive sample; 89 routine negative samples in addition.This 120 routine sample is brush,throat.Sample process: in the centrifuge tube of swab is housed, add 500 μ l PBS or physiological saline, thermal agitation 30sec.Extrude liquid as far as possible and move on to the centrifugal 20sec of 6000rpm in the centrifuge tube, get supernatant for subsequent use.
Negative control: DEPC water;
Positive control: H7N9 deactivation strain is provided by the Products in China calibrating.
2. condition for surveys
Reagent: test kit provided by the invention, for avian influenza virus H7N9 type kit for detecting nucleic acid (fluorescence RT-PCR method), provided by Shenzhen Taitai Genetic Engineering Co., Ltd., comprising:
(1) upstream primer H7N9-4.0-F and downstream primer H7N9-4.0-R;
(2) probe H7N9-4.0-B;
(3) dNTPs(contains dUTP);
(4) 10 * PCR reaction buffers;
（5）Mg
2+；
(6) Taq enzyme;
(7) ThermoScript II; With
(8) avian influenza virus H7N9RNA extracting solution is Trizol Reagent total RNA extraction reagent (available from Invitrogen).
Instrument: AB7500 fluorescent quantitation instrument is provided by Zhejiang Center For Disease Control and Prevention.
3. the extraction of template ribonucleic acid
(1) gets 1.5ml through the centrifuge tube without the pollution of RNA enzyme of sterilization, perform mark.At first respectively add 600 μ l H7N9RNA extracting solutions, then add respectively detection sample and each 200 μ l of positive and negative contrast through pre-treatment of corresponding numbering, inhale and beat mixing; Add again 200 μ l chloroforms, the vibration mixing; Leave standstill 5min, the centrifugal 10min of 12,000rpm;
(2) upper phase of drawing respectively in each pipe is transferred in the centrifuge tube of new 1.5ml without the pollution of RNA enzyme, adds the Virahol of 400 μ l-20 ℃ precoolings, performs mark, puts upside down mixing; Leave standstill 5min, the centrifugal 10min of 12,000rpm;
(3) remove gently supernatant, be inverted on the thieving paper, be stained with dry liquids; Add 700 μ l75% ethanol, put upside down washing; The centrifugal 5min of 12,000rpm; Remove gently supernatant, be inverted on the thieving paper, be stained with dry liquids as far as possible;
The centrifugal 10sec of (4) 4,000rpm blots residual liquid drying at room temperature 1-5min with micro sample adding appliance as far as possible;
(5) add 15 μ l DEPC water, flick mixing, RNA on the dissolving tube wall is stored in below-18 ℃ for subsequent use.
4. trace routine
The fluorescence RT-PCR reaction system is 25 μ l systems, and required each component and respective concentration see Table 2.
Table 2RT-PCR reaction system
| Component | |
| 10 * |
1× |
| Mg 2＋ | 2.5mmol/L |
| DNTPs(contains dUTP) | 0.2mmol/L |
| The Taq enzyme | 2U |
| ThermoScript II | 4U |
| Primer H7N9-4.0-F | 0.2μmol/L |
| Primer H7N9-4.0-R | 0.2μmol/L |
| Probe H7N9-4.0-B | 0.1μmol/L |
| Template ( |
2μl |
| Mend DEPC water extremely | 25μl |
Detect at AB7500 fluorescent quantitation instrument.The RT-PCR condition is: 50 ℃ of reverse transcriptions 20 minutes; Then be: 95 ℃ 3 minutes, 1 circulation; 95 ℃ 5 seconds, 60 ℃ 40 seconds (collect fluorescence FAM), 40 circulations.
5. detected result
The detected result of 120 parts of avian influenza virus H7N9 real-time fluorescent RT-PCR detection reagent boxes sees the following form 3.Wherein the fluorescence RT-PCR amplification figure of positive sample sees Fig. 2.
Table 3
The recall rate of detection kit provided by the invention (fluorescence RT-PCR method) in the avian influenza virus H7N9 positive of center: 31/31=100%;
The recall rate of detection kit provided by the invention (fluorescence RT-PCR method) in the avian influenza virus H7N9 feminine gender of center: 89/89=100%;
Detection kit provided by the invention (fluorescence RT-PCR method) detects coincidence rate at center avian influenza virus H7N9: 31+89/120=100%.
The result who center avian influenza virus H7N9 is detected sample shows: in 31 parts of avian influenza virus H7N9 positive samples, detection kit provided by the invention (fluorescence RT-PCR method) detects 31 examples, in 89 minutes negative samples, detects 89 examples, coincidence rate 100%.Avian influenza virus H7N9 type kit for detecting nucleic acid (fluorescence RT-PCR method) detected result that the production of Mrs's gene biological Engineering Co., Ltd is described is consistent with the result who determines through the CDC recommend method, the result is accurately credible, meets the requirement of clinical detection.
Above specific description of embodiments of the present invention does not limit the present invention, and those skilled in the art can make according to the present invention various changes or distortion, only otherwise break away from spirit of the present invention, all should belong to the scope of claims of the present invention.
Claims (11)
1. primer pair for detection of avian influenza virus, described primer pair is comprised of upstream primer and downstream primer, it is characterized in that, described upstream primer comprises the nucleotide sequence shown in the SEQ ID NO.1, and described downstream primer comprises the nucleotide sequence shown in the SEQ ID NO.2:
SEQ?ID?NO.1GGTTTAGCTTCGGGGCATC；
SEQ?ID?NO.2TATATACAAATAGTGCACCGCATGT。
2. primer pair according to claim 1 is characterized in that, the nucleotide sequence of described upstream primer is shown in SEQ ID NO.1, and the nucleotide sequence of described downstream primer is shown in SEQ ID NO.2.
3. the probe for detection of avian influenza virus is characterized in that, described probe comprises the nucleotide sequence shown in the SEQ ID NO.3:
SEQ?ID?NO.3TTATGCAAATGAAAACCAATCCCATTG。
4. probe according to claim 3 is characterized in that, the nucleotide sequence of described probe is shown in SEQ ID NO.3.
5. according to claim 3 or 4 described probes, it is characterized in that, 3 ' end of described probe is marked with the fluorescent quenching group, and described fluorescent quenching group is BHQ1 or TAMRA, preferred BHQ1; 5 ' end of described probe is marked with the fluorescence report group, and described fluorescence report group is FAM or ROX, preferred FAM.
6. primer pair according to claim 1 and 2 or according to claim 3 each described probe in 5 is characterized in that described avian influenza virus is the H7 type, preferred H7N9 hypotype.
7. a test kit that is used for fluorescence RT-PCR test sample avian influenza virus is characterized in that, described test kit comprises:
(1) primer pair according to claim 1 and 2;
(2) each described probe in 5 according to claim 3;
Preferably, described test kit also comprises:
（3）dNTPs；
(4) PCR reaction buffer;
（5）Mg
2+；
(6) Taq enzyme;
(7) ThermoScript II;
Further preferably, described test kit also comprises:
(8) avian influenza virus RNA extracting solution is Trizol Reagent total RNA extraction reagent;
(9) negative quality control product is water, is preferably DEPC water; With
(10) positive quality control product is the deactivation strain, is preferably H7N9 deactivation strain.
8. test kit according to claim 7 is characterized in that, when adopting described test kit to carry out avian flu virus detection, the reaction system of RT-PCR amplification comprises in 25 μ l:
(1) each 0.2 μ mol/L of the upstream primer of primer pair according to claim 1 and 2 and downstream primer;
(2) each described probe 0.1 μ mol/L in 5 according to claim 3;
（3）dNTPs0.2mmol/L；
(4) PCR reaction buffer, final concentration 1 *;
（5）Mg
2+2.5mmol/L；
(6) Taq enzyme 2U;
(7) ThermoScript II 4U; With
(8) water is preferably DEPC water, mends to 25 μ l after adding the RNA template.
9. according to claim 7 or 8 described test kits, it is characterized in that, described avian influenza virus is the H7 type, preferred H7N9 hypotype.
10. each described test kit in 9 according to claim 7 is characterized in that, the reaction conditions of described RT-PCR is:
50 ℃ 20 minutes; Then be: 95 ℃ 3 minutes, 1 circulation; 95 ℃ 5 seconds, 60 ℃ 40 seconds, 40 circulations.
11. each described test kit in 10 is characterized in that according to claim 7, described sample is from bird or mammiferous brush,throat, cloaca swab, tissue samples, serum or blood plasma.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310216539.6A CN103320528B (en) | 2013-06-03 | 2013-06-03 | Primer pair and probe for detecting avian influenza virus in sample by fluorescence RT-PCR and kit containing primer pair and probe |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310216539.6A CN103320528B (en) | 2013-06-03 | 2013-06-03 | Primer pair and probe for detecting avian influenza virus in sample by fluorescence RT-PCR and kit containing primer pair and probe |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103320528A true CN103320528A (en) | 2013-09-25 |
| CN103320528B CN103320528B (en) | 2014-12-10 |
Family
ID=49189568
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310216539.6A Active CN103320528B (en) | 2013-06-03 | 2013-06-03 | Primer pair and probe for detecting avian influenza virus in sample by fluorescence RT-PCR and kit containing primer pair and probe |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103320528B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107164559A (en) * | 2017-05-23 | 2017-09-15 | 金瑞鸿捷（厦门）生物科技有限公司 | Avian influenza virus H7 hypotypes detection reagent and application based on POCKIT Micro fluorescent PCR platforms |
| CN107523649A (en) * | 2017-08-30 | 2017-12-29 | 上海伯杰医疗科技有限公司 | H7N9 subtype influenza virus genome sequencing methods |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1670221A (en) * | 2004-06-25 | 2005-09-21 | 深圳太太基因工程有限公司 | Primer, probe series and method for multiple real time fluorescent RT-PCR detection of H5, H7 and H9 subtype bird flu |
| CN1670220A (en) * | 2004-06-25 | 2005-09-21 | 深圳太太基因工程有限公司 | Primer and probe series for real time fluorescent RT-PCR detection of bird flu of H7 subtype |
| CN101736091A (en) * | 2008-11-07 | 2010-06-16 | 中山大学达安基因股份有限公司 | Kit for real-time fluorescence RT-PCR detection of H7 subtype avian influenza virus |
-
2013
- 2013-06-03 CN CN201310216539.6A patent/CN103320528B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1670221A (en) * | 2004-06-25 | 2005-09-21 | 深圳太太基因工程有限公司 | Primer, probe series and method for multiple real time fluorescent RT-PCR detection of H5, H7 and H9 subtype bird flu |
| CN1670220A (en) * | 2004-06-25 | 2005-09-21 | 深圳太太基因工程有限公司 | Primer and probe series for real time fluorescent RT-PCR detection of bird flu of H7 subtype |
| CN101736091A (en) * | 2008-11-07 | 2010-06-16 | 中山大学达安基因股份有限公司 | Kit for real-time fluorescence RT-PCR detection of H7 subtype avian influenza virus |
Non-Patent Citations (1)
| Title |
|---|
| WORLD HEALTH ORGANIZATION: ""Real-time RT-PCR protocol for the detection of Avian Influenza A (H7N9) virus"", 《WORLD HEALTH ORGANIZATION》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107164559A (en) * | 2017-05-23 | 2017-09-15 | 金瑞鸿捷（厦门）生物科技有限公司 | Avian influenza virus H7 hypotypes detection reagent and application based on POCKIT Micro fluorescent PCR platforms |
| CN107523649A (en) * | 2017-08-30 | 2017-12-29 | 上海伯杰医疗科技有限公司 | H7N9 subtype influenza virus genome sequencing methods |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103320528B (en) | 2014-12-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Tao et al. | Application of CRISPR-Cas12a enhanced fluorescence assay coupled with nucleic acid amplification for the sensitive detection of African swine fever virus | |
| Borm et al. | A universal avian endogenous real-time reverse transcriptase–polymerase chain reaction control and its application to avian influenza diagnosis and quantification | |
| Zhong et al. | Development of a sensitive and reliable droplet digital PCR assay for the detection of ‘Candidatus Liberibacter asiaticus’ | |
| James et al. | Rapid and sensitive detection of high pathogenicity Eurasian clade 2.3. 4.4 b avian influenza viruses in wild birds and poultry | |
| CN105950759A (en) | Kit for simultaneously detecting four pathogenic bacteria and non-diagnostic detection method thereof | |
| CN103255232B (en) | Dual fluorescence RT (Reverse Transcription)-PCR (Polymerase Chain Reaction) detection kit and method for avian influenza H7N9 virus | |
| CN102534051B (en) | Kit for detecting enterovirus | |
| CN101962689B (en) | Identification and detection method for hepatitis E virus by utilizing quadruple fluorescence quantitative PCR (Polymerase Chain Reaction) | |
| CN102206713B (en) | Triple fluorescence quantitative reverse transcription-polymerase chain reaction (RT-PCR) detection kit and use thereof | |
| CN105463132A (en) | Genetic marker of canine parvovirus and specific primers as well as probe thereof | |
| CN108411041B (en) | Fluorescent quantitative RT-PCR kit for detecting novel chicken reovirus and application thereof | |
| Steyer et al. | A diagnostic method based on MGB probes for rapid detection and simultaneous differentiation between virulent and vaccine strains of avian paramyxovirus type 1 | |
| CN110343784A (en) | The composition and kit of quadruple influenza nucleic acids detection based on melting curve | |
| CN105950785A (en) | Ternary fluorescence RT-PCR detection kit of avian influenza virus, new castle disease virus and infectious bronchitis virus, primers and probes | |
| CN101392299B (en) | Equine influenza detection kit and detection method | |
| Zhang et al. | Diagnostics and detection of African swine fever virus | |
| CN206751855U (en) | A kind of kit for highly pathogenic H7 avian flu virus detections | |
| CN103320528B (en) | Primer pair and probe for detecting avian influenza virus in sample by fluorescence RT-PCR and kit containing primer pair and probe | |
| CN104593357A (en) | Nucleic acid for enterovirus detection, and applications thereof | |
| CN109722492B (en) | Method for detecting H5 and H7N9 subtype highly pathogenic avian influenza virus and H9 subtype avian influenza virus | |
| CN104099430A (en) | Ring mediate isothermal amplification kit for diagnosing H7N9 hypotype avian influenza virus and application method thereof | |
| CN101985664B (en) | Nucleotide sequence and kit for detecting type-A influenza virus | |
| CN103320527B (en) | Primer pair and probe for detecting avian influenza virus in sample by fluorescence RT-PCR and kit containing primer pair and probe | |
| CN102676697A (en) | Primers and probe for detecting peste des petits ruminants virus and kit | |
| CN104745722A (en) | Primers, probe and kit used for detecting varicella zoster viruses (VZVs) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20220318 Address after: 518057 Jian Kang Yuan Pharmaceutical Group, No. 17, Langshan Road, North Nanshan District high tech Zone, Shenzhen, Guangdong Patentee after: JOINCARE PHARMACEUTICAL GROUP INDUSTRY Co.,Ltd. Address before: 518057, Guangdong, Nanshan District science and Technology Park, Shenzhen Fifth Industrial Zone, the pharmaceutical industry, Arts crafts emporium, third floor Patentee before: Shenzhen Taitai Gene Engineering Co.,Ltd. |