CN105506145B - A kind of primer, probe and identification method for identifying the quick Schizoid of the photosynthetic algae of coral symbiosis - Google Patents
A kind of primer, probe and identification method for identifying the quick Schizoid of the photosynthetic algae of coral symbiosis Download PDFInfo
- Publication number
- CN105506145B CN105506145B CN201610048293.XA CN201610048293A CN105506145B CN 105506145 B CN105506145 B CN 105506145B CN 201610048293 A CN201610048293 A CN 201610048293A CN 105506145 B CN105506145 B CN 105506145B
- Authority
- CN
- China
- Prior art keywords
- quick
- schizoid
- probe
- primer
- coral
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of primer, probe and identification methods for identifying the quick Schizoid of the photosynthetic algae of coral symbiosis.The primer is SEQ ID NO:2-3, and probe is SEQ ID NO:4；Or primer and probe is respectively SEQ ID NO:5-7；Or primer and probe is respectively SEQ ID NO:8-10；Or primer and probe is respectively SEQ ID NO:11-13；Or primer and probe is respectively SEQ ID NO:14-16；Or primer and probe is respectively SEQ ID NO:17-19；5 ' ends of the probe, 3 ' ends report fluorescent dye with FAM respectively and TAMRA quenching group marks.It can carry out the qualitative and Quantitative measurement of the quick Schizoid of the photosynthetic algae of coral symbiosis.
Description
Technical field
The present invention relates to field of biotechnology more particularly to a kind of identification coral symbiosis quick Schizoid of photosynthetic algae to draw
Object, probe and identification method.
Background technique
Many oceanic invertebrates, such as coral, sea anemone, discovery can be with a kind of photoautotrophic seaweed
Symbiodinium (also known as zooxanthellae) symbiosis.Exist more recently by the algae that molecular biology research discovery Symbiodinium belongs to
There are bio-diversity in different marine organisms hosts, Symbiodinium category is divided into A-G by the method based on molecular classification
Seven types.Wherein A-F, G are the photosynthetic algae with reef-building coral symbiosis, and the Distribution center of these algae is not only with host's
Type is related, and also with the group of coral reef, geographical location is related.Since the group of Symbiodinium forms (different type
The abundance of cell or individual) it is dynamic change, it is generally recognized that and this is that the physiology that Symbiodinium is response environmental change is anti-
It answers.However, the Symbiodinium physiological growth feature to symbiosis in coral tissue and the symbiosis with coral host at present
It also knows little about it, so being difficult to cultivate with the algae for some symbiosis, this is an important difficulty to Symbiodinium research
Topic.
Coral health and albinism are always the focus of international and domestic research, and many scholars think coral all the time
Health status and the symbiosis of phycobiont have a close relationship, " escaping " or " loss " of phycobiont be considered as coral disease or
The immediate cause of albefaction.Research finds that the Symbiodinium group of the generation and symbiosis of coral " albefaction " phenomenon and diversity are dynamic
State variation is closely bound up.For example, in the case where meeting the raised situation of water temperature, having resistance to since ocean temperature changes with seasonal freezing
The Cell abundance of hot stronger symbiotic algae just will appear.Currently used for investigating the universal user of method of alga cells quantity
Cell count under work microscope, the time-consuming effort of this method, experimental error is big, in addition is difficult to reflect from microscopical morphological observation
Determine type, the type of phycobiont.It is feasible, but if algae cell density is low, just simultaneously in the case where high-cell density
It is difficult to detect.How quickly, simply, accurately, reliable to detect sea-weed type or Cell abundance, there is important practice
Meaning.
Summary of the invention
The purpose of the present invention is to provide a kind of primer and probes for identifying the quick Schizoid of the photosynthetic algae of coral symbiosis.
To achieve the above object, the present invention provide it is a kind of identify the quick Schizoid of the photosynthetic algae of coral symbiosis primer and spy
Needle, which is characterized in that the primer is SEQ ID NO:2-3, and probe is SEQ ID NO:4；
Or primer is SEQ ID NO:5-6, probe is SEQ ID NO:7；
Or primer is SEQ ID NO:8-9, probe is SEQ ID NO:10；
Or primer is SEQ ID NO:11-12, probe is SEQ ID NO:13；
Or primer is SEQ ID NO:14-15, probe is SEQ ID NO:16；
Or primer is SEQ ID NO:17-18, probe is SEQ ID NO:19；
5 ' ends of the probe, 3 ' ends report fluorescent dye with FAM respectively and TAMRA quenching group marks.
On one side, the present invention provides a kind of for identifying the kit of the quick Schizoid of the photosynthetic algae of coral symbiosis,
It is characterized in that, contains the primer and probe.
On one side, the purposes that the kit is used to identify the quick Schizoid of the photosynthetic algae of coral symbiosis is provided.
On one side, a kind of method for identifying the quick Schizoid of the photosynthetic algae of coral symbiosis is provided, which is characterized in that
Using the primer and probe or the kit.
Further, step is,
Extract photosynthetic algae DNA；
PCR amplification, using the primer and probe；
Result judgement.
Further, the program of the PCR amplification are as follows: 90-100 DEG C, 30-60s；90-100 DEG C, 5-30s, 50-70 DEG C, 20-
90s, 20~50 circulations, carries out fluorescence signal detection at the end of the extension of each circulation, and fluorescence mode is set as FAM；It is quenched
Group is set as TAMRA.
Further, the system of the PCR amplification is 10 times of PCR reaction buffers of 1/10 volume, dNTP each 0.1~
0.1~5 international unit of 0.5mmol/L, Taq archaeal dna polymerase, the DNA profiling liquid that 0.1~0.5mmol/L of probe is isolated and purified
0.1~5 μ l, each 0.1~2mmol/L of upstream and downstream primer add aseptic deionized water that total volume is made to reach 10~100 μ l.
Further, the result judgement are as follows:
If Ct value is between 0 and 40, it is preferred that Ct value is between 0-38；It is determined as the positive, indicates that sample detects coral
The quick Schizoid of the photosynthetic algae of symbiosis is Clade A；
If Ct value is 0 or more than or equal to 40, it is determined as feminine gender, indicates that the quick Schizoid of coral symbiosis is not detected in sample
Photosynthetic algae.
It further, further include that the concentration value Y that quick Schizoid is Clade A is calculated according to Ct value according to standard curve；
The standard curve is Y clade A=-0.3098x+5.4468, R2=0.9992.
The photosynthetic algae Clade A of the quick Schizoid of coral symbiosis refers in China Seas, coral symbiosis it is photosynthetic
Algae Clade A has under 25 DEG C of normal illumination cultures of temperature, and the frond speed of growth and cell division rate are significantly faster than
The photosynthetic algae type of Clade C and Clade F, Testing and appraisal characteristic sequence are as follows:
CAATAGTGGAAGGTCCAAAAGGGACCAATGACGATGGGCAATAGCCAGAACATACACTCTGGGTGCAG
CTCCGAGTACGCCCACTCGCCCATAGCTTCCACTTG.It is denoted as SEQ ID NO:1.
The present invention is mainly according to the gene order specificity of species, mirror that can be special using the molecular labeling of this section of sequence
Determine the photosynthetic algae Clade A of symbiosis, while being different from the coral phycobiont of non-A type；In addition by the sequence alignment of early period and experiment
Verifying, by this section of sequence G/C content between 45-60%；Length is between 100-150bp；Amplification efficiency is high.Gained is designed simultaneously
Primer be not easy to form dimer；60 DEG C of the annealing temperature of primer, 68 DEG C of annealing temperature or more of probe, the two differs 8 DEG C, visits
Needle is suitble to carry fluorescent marker.Therefore select this section of sequence as the molecular labeling of Classification Identification.
To achieve the goals above, the photosynthetic algae Clade A Molecular Detection of the quick Schizoid of coral symbiosis of the invention
Method is the characteristic sequence according to Clade type-A first, designed for real-time quantitative Taqman PCR several primers and
Taqman probe combinations FAM-Clade A.
Since 2014, applicant was by investigating sampling and the biology of Symbiodinium to China Seas coral sample
Geography research, the Symbiodinium of Preliminary Identification China Seas coral symbiosis is common Clade A and C two types.It is logical
Crossing its different culture studies, to show that Clade A, F and C divide rate under identical cultivation conditions entirely different, Clade A's
Split speed and the speed of growth are significantly faster than that Clade C and Clade F.Illustrate that Symbiodinium Clade A is quickly to divide
Type, this has found that it is likely that closely related with the dynamic change of the symbiotic algae abundance of coral " albefaction " or coral tissue.
For this purpose, how quickly to be examined to the quick Schizoid Symbiodinium Clade A of the photosynthetic algae of China Seas coral symbiosis
Identification is surveyed, research coral " albefaction " mechanism and its prevention and control prevention and treatment are had a very important significance.
In order to ensure the quick Schizoid Clade A that algae is the photosynthetic algae of coral symbiosis that participates in the experiment, the present invention passes through in vitro
Purifying culture and ITS-PCR method have carried out the identification of algae Clade A to sample collected.
Advantages of the present invention: the present invention is specifically drawn with the easy region of variability design of the ITS sequence of quick Schizoid algae Clade A
Object and TanMan probe combinations (FAM-Clade A), can be realized by Taqman round pcr to quick Schizoid algae Clade
The rapid quantitative detection and cell of A quickly divide the precise Identification of type.And then it converts and obtains the quantity of phycobiont.
For the present invention first by the culture experiment of phycobiont, the split speed of more various phycobionts determines that A type is quick
Fissility, the meaning of selection identification A type mainly consider that quick Schizoid phycobiont future can use its division, growth speed
Fast advantage is spent, the reparation of coral is applied to.By selecting most for the special site DNA of A type as label, design
Primer and probe, while the phycobiont of other non-A types, by lot of experiment validation early period, more multipair spy can be accurately distinguished again
In addition the specificity of needle primer combination considers the annealing temperature of primer itself, G/C content, the composite factors such as primer length, sheet
The primer and probe identification A type of invention is ideal, is finally reached the purpose that A type phycobiont is distinguished in accurately identification.And it fills
Point quantitative PCR sensitivity feature is utilized, the phycobiont dna intake needed is few, few to the sampling amount of coral tissue, not only can be with
The destruction to coral is reduced to greatest extent, and can be changed with the quantity of the A type phycobiont of dynamic monitoring coral tissue, and A is inquired into
The relationship of type phycobiont and coral health status, research and application value are big.In China, about marine environmental monitoring index and
Technology has very big defect, and the evaluation to coral living environment and health status is even more blank out, to the guarantor of China's coral reef
Shield lacks legal basis and relevant criterion.The present invention passes through precise Identification and quantitative determination coral using this purpose as starting point
The cell quantity for organizing endosymbiosis algae identifies from the cell quantity of coral phycobiont and detects being used as a Xiang Zhibiao, as angle
The health status of coral is spent and then judges, future is expected to become a standard in industry.
Detailed description of the invention
Fig. 1 is the optical density absorption relational graph of different algae incubation times and frond cell.
Fig. 2 is 10 days figures compared with the number of frond cell after 21 days of different algae cultures.
Fig. 3 is the probe and design of primers schematic diagram for identifying the photosynthetic algae of coral symbiosis.
Fig. 4 is the fast typing result figure of the photosynthetic algae sample of coral symbiosis.
Fig. 5 is the Taqman PCR reaction amplification curve diagram of the algae DNA of different diluted concentrations.
Fig. 6 is the relational graph of algae DNA concentration Yu Ct value.
Specific embodiment
The embodiment of the present invention is described below in detail, examples of the embodiments are shown in the accompanying drawings, wherein from beginning to end
Same or similar label indicates same or similar element or element with the same or similar functions.Below with reference to attached
The embodiment of figure description is exemplary, it is intended to is used to explain the present invention, and is not considered as limiting the invention.Embodiment
In particular technique or condition person is not specified, described technology or conditions or according to the description of product according to the literature in the art
Book carries out.Reagents or instruments used without specified manufacturer, being can be with conventional products that are commercially available.
WZD 35, ITO 10, WZD 17, SSG, XMH and Symka algae strain are preserved in Chinese Sea Microbiological Culture Collection
Administrative center (MCCC), MCCC belong to national public welfare microbial resources shared platform.
Embodiment 1: for examination algae culture and the comparison of cell division rate, the speed of growth
By isolated coral symbiosis algae ITO 10 (Symbiodiniumsp.Clade A), WZD17
(Symbiodiniumsp.Clade C) and XMH (Symbiodiniumsp.Clade F) MIK (Japan) or f/2 culture medium
(f/2 culture medium prescription (g/L) A:NaNO375mg 75g B:NaH2Po4.H2O 5mg 5g C:Na2SiO3.9H2O 20mg 20g
D Na2EDTA 4.36mg 4.36g E:FeCl3.6H2O 3.16mg 3.16g F:CuSO4.5H2O 0.01mg 0.01g
ZnSO4.7H2O 0.023mg 0.023g CoCl2.6H2O 0.012mg 0.012g MnCl.4H2O 0.18mg 0.18g
Na2MoO42H2O 0.07mg 0.07g G: vitaminB10 .1g 0.1mg vitamin B12 0.5g 0.5mg biotin 0.5g
1 liter of 0.5mg nature seawater (aperture 0.4mm membrane filtration) sterilizes 20 minutes under 121 degree).It is inoculated into triangular flask and cultivates, add
Enter MIK (Japan) or f/2 culture medium is cultivated in the light incubator.Condition of culture: 26 ± 2 DEG C of temperature, intensity of illumination 25-
40μEm-2s-1, periodicity of illumination 14h/10h.The beaker that two fill tap water is placed in incubator and keeps moisture constant.Illumination
It cultivates 1-2 months, this method is used to prepare the cell of photosynthetic algae.
Calculate alga cells number, adjustment cell concentration to 10 under the microscope by blood cell counting plate5A cell/
ml.It takes 50ul to be inoculated into the f/2 culture medium of 50ml, is cultivated by mentioned-above condition.1ml was taken to cultivate cell every three days
Sample, under spectrophotometer (OD 600) measurement, compare the absorbance values of three samples.And existed by blood cell counting plate
Alga cells number is calculated under microscope.Compare the cell division and the speed of growth of three types algae.
It is most fast to be compared 10 speed of growth of ITO, determines that ITO 10 (Symbiodiniumsp.Clade A) is quickly division
Type.The result is shown in Figure 1 and Fig. 2.Wherein Fig. 1 is the optical density absorption relational graph of different algae incubation times and frond cell.It is vertical to sit
Mark represents the absorption value of OD 600, and abscissa is incubation time (day), and the ITO Clade A speed of growth is most fast as can be seen from Figure 1.Figure
2 be 10 days figures compared with the number of frond cell after 21 days of different algae cultures.Ordinate represents number of cells, and abscissa is
Incubation time (day).ITO Clade A number of cells is most as can be seen from Figure 2, i.e., split speed is most fast.
Embodiment 2: the extraction of algae DNA
The alga cells that embodiment 1 is determined as ITO 10 are collected using centrifugal method, i.e., frond cell are placed in 10ml's
In centrifuge tube, 4 DEG C, 13,000rpm, it is centrifuged 15min, after removing supernatant, the thallus of precipitating is placed in aseptic superclean bench and is blown
It is dry.Then, the genomic DNA of frond is extracted using CTAB method: firstly, the frond being collected by centrifugation is transferred to 1.5ml
Eppendorf pipe；The CTAB extracting solution of 600ul is added, is placed in 65 DEG C of water-bath 1 hour, during which repeatedly shakes strongly, so that frond
Cell is sufficiently broken.Secondly, centrifuge tube is removed from water-bath, it is added and the isometric phenol of DNA extracting solution, chloroform, isoamyl alcohol
(volume ratio 25:24:1) mixed liquor, be acutely vortexed 5min, and supernatant is collected by centrifugation.Finally, isometric chloroform/isoamyl is added
Alcohol (volume ratio 24:1), switches and mixes well for several times, and 4 DEG C, 12,000rpm, it is centrifuged 5min, takes supernatant to new centrifuge tube
In.Again (to remove impurity, purification efficiency is improved) after extracting is primary, and Aspirate supernatant is added two into new centrifuge tube
The dehydrated alcohol (- 20 DEG C) of times volume pre-cooling, -20 DEG C of refrigerators place 30min or so.12,000rpm after taking-up, it is centrifuged 12min,
In drying on concentrated frozen centrifugal drying instrument, Rnase aqueous solution is then added, 37 DEG C of water-baths digest 1 hour, (it is miscellaneous to remove RNA
Matter).After agarose gel electrophoresis and PCR amplification judge proposed DNA mass, -20 DEG C are saved backup.Adjust the photosynthetic algae of coral symbiosis
Class quickly divides the final concentration of 200 μ g/ml of the sample DNA of the representative algae ITO 10 of Clade A.
Embodiment 3:Taqman fluorescence quantitative PCR detection
According to the distinguished sequence of the quick Schizoid Clade A of the photosynthetic algae of coral symbiosis design real-time quantitative PCR primer and
Taqman probe combinations (FAM-Clade A).Design schematic diagram is shown in Fig. 3, in Fig. 3, shows relevant existing coral phycobiont
The comparison result of part ITS sequence, from as shown in the figure, sequence performance is greatly inconsistent between different types of phycobiont and becomes
It is different, and sequence performance is very conservative between same type of phycobiont and inhibits.It can choose to the special of phycobiont A type
Segment, premised on meeting design primer probes call under, design specifically for identification A type phycobiont probe and primer.
Wherein FAM-Clade A includes one group in following primer probe groups:
First group of FAM-Clade A:
Primer: FAM-Clade A-F1:5 '-TTTACCCTTTCCTCCGCTTAC-3 ' SEQ ID NO:2；
FAM-Clade A-R1:5 '-TTCTTGAGTGACGCTGCTTAT-3 ' SEQ ID NO:3；
Probe: FAM-Clade A-P1:5 '-AGCGGGTTCACTTGTCTGACTTCA-3 '； SEQ ID NO:4；
Second group of FAM-Clade A:
Primer: FAM-Clade A-F2:5 '-CTAAGCACTGAAGCAGACATACT-3 ' SEQ ID NO:5；
FAM-Clade A-R2:5 '-GCGCGATAGTCTTTGTGAATTG-3 ' SEQ ID NO:6；
Probe: FAM-Clade A-P2:5 '-TCAGGAAATCCCAAGAGTGCAACGT-3 '； SEQ ID NO:7；
FAM-Clade A third group:
Primer: FAM-Clade A-F3:5 '-AGCATCCCTCACAACCAAAG-3 ' SEQ ID NO:8；
FAM-Clade A-R3:5 '-AGAGGAAGGAGAAGTCGTAACA-3 ' SEQ ID NO:9；
Probe: FAM-Clade A-P3:5 '-AATGATCCTTCCGCAGGTTCACCT-3 '； SEQ ID NO:10；
The 4th group of FAM-Clade A:
Primer: FAM-Clade A-F4:5 '-CACGAGTTCAGCAAGCAGATA-3 ' SEQ ID NO:11；
FAM-Clade A-R4:5 '-CGTAACAAGGTTTCCGTAGGT-3 ' SEQ ID NO:12；
Probe: FAM-Clade A-P4:5 '-CGCAAGCATCCCTCACAACCAAAG-3 '； SEQ ID NO:13；
The 5th group of FAM-Clade A:
Primer: FAM-Clade A-F5:5 '-CGGGTTCACTTGTCTGACTT-3 ' SEQ ID NO:14；
FAM-Clade A-R5:5 '-GCTTTGCGCGATGCTATTC-3 ' SEQ ID NO:15；
Probe: FAM-Clade A-P5:5 '-TTGAGTGACGCTGCTTATGCTTGC-3 '； SEQ ID NO:16；
The 6th group of FAM-Clade A:
Primer: FAM-Clade A-F6:5 '-CAATAGTGGAAGGTCCAAAAGG-3 ' SEQ ID NO:17；
FAM-Clade A-R6:5 '-CAAGTGGAAGCTATGGGCGAGTG-3 ' SEQ ID NO:18；
Probe: FAM-Clade A-P6:5 '-CCAGAACATACACTCTGGGTGCAGC-3 '； SEQ ID NO:19；
5 ' ends of above-mentioned Taqman probe, 3 ' ends report fluorescent dye with FAM respectively and TAMRA quenching group marks.
By the lot of experiment validation of early period and compare, probe and primer combine the 6th group it is photosynthetic as Classification Identification symbiosis
Algae Clade A, design principle are shown in Fig. 3, and the main gene order specificity according to species combines probe and primer using this
Identification A type that can be very special, while being different from the coral phycobiont of non-A type.Secondly, comprehensively considering suitable design
The other factors of Taqman probe and primer, probe and primer G/C content are between 45~60%；The length of primer and probe between
20~27bp；Primer is not easy to form dimer；60 DEG C of the annealing temperature of primer, 68 DEG C of annealing temperature or more of probe, the two phase
Poor 8 DEG C or more；Amplification efficiency height etc. reduces the experimental error that primer factor may carry, ensure that experiment repeat type and
Accuracy.
(any one group can be changed into draw using the primer of embodiment 3 and the 6th group of Taqman probe groups FAM-Clade A
Object and probe, obtained result are all the same) carry out the fluorescence quantitative PCR detection of quick Schizoid Clade A:
Amplified reaction total volume is 20 μ L, wherein upstream and downstream primer (FAM-Clade A-F6/FAM-Clade A-R6)
200nM, probe (FAM-Clade A-P6) 100nM, 10 μ lQPCR Probe Master Mix (Vazyme, Nanjing),
ROX Reference Dye I 0.4 μ l, 1 μ L of template (DNA of the DNA of the DNA of WZD 35, ITO 10, WZD 17, SSG's
The DNA of the DNA or Symka of DNA, XMH, concentration are 2 μ g/ml), remainder supplies 20 μ L with distilled water, sets ABI Step One
Plus quantitative fluorescent PCR system operating analysis, carries out fluorescence signal detection at the end of the extension of each circulation, and fluorescence mode is set
For FAM, the mode of being quenched is set as TAMRA.Response procedures are as follows: 95 DEG C of 5min；95 DEG C of 10s, 60 DEG C of 30s, 40 circulations.
As a result see that Fig. 4 and table 1, Fig. 4 are the fast typing result figures of the photosynthetic algae sample of coral symbiosis.It can be with from Fig. 4
Find out, quick Schizoid algae Clade A sample amounts PCR testing result is with fluorescence intensity change in certain range of DO
Exponential growth (S-type curve amplification), PCR is in certain range of DO, and (i.e. 10 be bottom with the Lg value of fluorescence intensity change
Logarithmic function value) it is in a linear relationship.Ct value is between 0-40, and wherein Ct (threshold value) is provided as referring to what quantitative PCR was defaulted.
It but is that the sample of non-Clade A S type amplification curve does not occur, Ct value is 0, illustrates that Taqman probe FAM-Clade A is tied
The method for closing qPCR has preferable specificity.
The fast typing result table of the photosynthetic algae sample of 1 coral symbiosis of table
As it can be seen from table 1 WZD 35 and ITO 10 is Clade A type, quantitative PCR is positive, and ct value is between 0-40
Between；Non-A type phycobiont WZD 17 and SSG (Clade c-type) and XMH and Symka (Clade F type), qualification result is negative,
Ct value is 0.Illustrate that the method for the probe and primer combination quantitative PCR that the present invention designs can accurately identify A type coral symbiosis
The photosynthetic quick Schizoid of algae.
The sensitivity analysis of embodiment 4:Taqman probe PCR
Adjust quick 10 sample of Schizoid algae Symbiodinium sp.ITO (Clade A) of the photosynthetic algae of coral symbiosis
The final concentration of 20 μ g/ml of DNA.It successively carries out 10 times and is serially diluted (10-1, 10-2, 10-3, 10-4, 10-5, 10-6), respectively with spy
Different identification Taqman probe FAM-Clade A carries out Taqman PCR detection, obtains kinetic curve as shown in Figure 1.
Conclusion: probe FAM-Clade A is to the DNA sample of ITO Clade A in 6 dilutions (10-1~10-6) model
The S-type amplification curve of quantification PCR is enclosed, sees Fig. 5；Fig. 5 is the Taqman PCR reaction amplification of the algae DNA of different diluted concentrations
Curve graph, abscissa represent recurring number Ct value, and ordinate represents fluorescent absorption Strength Changes value.From fig. 5, it can be seen that all
The S-type exponential increase of sample amplification curve, and the Ct value difference between different dilution is uniformly, meet the Ct value of quantitative PCR with
As a result stringent linear relationship between starting copy number is shown in that Fig. 6, Fig. 6 are the relational graphs of algae DNA concentration Yu Ct value.Abscissa
(x) recurring number Ct value, ordinate (Y) representation DNA concentration are represented.Y clade A=-0.3098x+5.4468, R2=0.9992.
Therefore, there is good correlation between sample copy number and Ct value.In order to guarantee the reliability and standard of testing result
True property determines the Symbiodinium of Taqman probe FAM-Clade A identification in conjunction with experimental analysis is repeated several times
Sp.Clade A detectable limit Ct value is 38.It is converted into DNA concentration by standard curve, the photosynthetic algae of the symbiosis of detectable limit is quick
Division Aform DNA load capacity is 2pg, estimation about 0.2 cell (by taking phycobiont Genome Size is 1500MB as an example).
Although the embodiments of the present invention has been shown and described above, it is to be understood that above-described embodiment is example
Property, it is not considered as limiting the invention, those skilled in the art are not departing from the principle of the present invention and objective
In the case where can make changes, modifications, alterations, and variations to the above described embodiments within the scope of the invention.
Claims (10)
1. a kind of primer and probe for identifying the quick Schizoid of the photosynthetic algae of coral symbiosis, which is characterized in that the primer is SEQ
ID NO:2-3, probe are SEQ ID NO:4；
5 ' ends of the probe, 3 ' ends report fluorescent dye with FAM respectively and TAMRA quenching group marks.
2. a kind of for identifying the kit of the quick Schizoid of the photosynthetic algae of coral symbiosis, which is characterized in that contain claim 1
The primer and probe.
3. primer and probe described in claim 1 or kit as claimed in claim 2 are for identifying the photosynthetic algae of coral symbiosis
The purposes of quick Schizoid.
4. a kind of method for identifying the quick Schizoid of the photosynthetic algae of coral symbiosis, which is characterized in that use claim 1 institute
State primer and probe or kit as claimed in claim 2.
5. the method described in claim 4 for identifying the quick Schizoid of the photosynthetic algae of coral symbiosis, which is characterized in that step
For,
Extract photosynthetic algae DNA；
PCR amplification, using primer and probe described in claim 1；
Result judgement.
6. the method described in claim 4 for identifying the quick Schizoid of the photosynthetic algae of coral symbiosis, which is characterized in that described
The program of PCR amplification are as follows: 90-100 DEG C, 30-60s；90-100 DEG C, 5-30s, 50-70 DEG C, 20-90s, 20~50 circulation,
Fluorescence signal detection is carried out at the end of the extension of each circulation, fluorescence mode is set as FAM；Quenching group is set as TAMRA.
7. the method described in claim 4 for identifying the quick Schizoid of the photosynthetic algae of coral symbiosis, which is characterized in that described
The system of PCR amplification is 10 times of PCR reaction buffers of 1/10 volume, dNTP each 0.1~0.5mmol/L, Taq
0.1~5 international unit of DNA polymerase, the DNA template liquid 0.1 that 0.1~0.5mmol/ of probe L is isolated and purified
~5 μ l, each 0.1~2mmol/ L of upstream and downstream primer, add aseptic deionized water that total volume is made to reach 10~100 μ l.
8. the method described in claim 4 for identifying the quick Schizoid of the photosynthetic algae of coral symbiosis, which is characterized in that the knot
Fruit determines are as follows:
If Ct value is between 0 and 40, it is determined as the positive, indicates that the quick Schizoid of the sample detection photosynthetic algae of coral symbiosis is
Clade A；
If Ct value is 0 or more than or equal to 40, it is determined as feminine gender, indicates that the quick Schizoid light of coral symbiosis is not detected in sample
Close algae.
9. the method described in claim 8 for identifying the quick Schizoid of the photosynthetic algae of coral symbiosis, which is characterized in that the knot
Fruit determines are as follows:
If Ct value is between 0-38；It is determined as the positive, indicates that the quick Schizoid of the sample detection photosynthetic algae of coral symbiosis is
Clade A。
10. the method described in claim 5 for identifying the quick Schizoid of the photosynthetic algae of coral symbiosis, which is characterized in that also wrap
It includes according to standard curve, calculates the concentration value Y that quick Schizoid is Clade A according to Ct value；The standard curve is Y
Clade A=- 0.3098x+5.4468, R2=0.9992.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610048293.XA CN105506145B (en) | 2016-01-25 | 2016-01-25 | A kind of primer, probe and identification method for identifying the quick Schizoid of the photosynthetic algae of coral symbiosis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610048293.XA CN105506145B (en) | 2016-01-25 | 2016-01-25 | A kind of primer, probe and identification method for identifying the quick Schizoid of the photosynthetic algae of coral symbiosis |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105506145A CN105506145A (en) | 2016-04-20 |
| CN105506145B true CN105506145B (en) | 2019-04-23 |
Family
ID=55714435
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610048293.XA Active CN105506145B (en) | 2016-01-25 | 2016-01-25 | A kind of primer, probe and identification method for identifying the quick Schizoid of the photosynthetic algae of coral symbiosis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105506145B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1536091A (en) * | 2003-04-09 | 2004-10-13 | 中国海洋大学 | Quick quantitative detection of genetic marker of skeletonema costatum japonicum and its method |
| CN101914615A (en) * | 2010-05-28 | 2010-12-15 | 上海交通大学 | Constructing method of standard sample in Alexandrium catenella (A.catenella) fluorescence quantitative polymerase chain reaction |
| CN105002273A (en) * | 2015-07-10 | 2015-10-28 | 中国海洋大学 | Primer group for Alexandrium catenella cell explosive growth monitoring based on real-time fluorescent quantitative PCR method and monitoring method thereof |
-
2016
- 2016-01-25 CN CN201610048293.XA patent/CN105506145B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1536091A (en) * | 2003-04-09 | 2004-10-13 | 中国海洋大学 | Quick quantitative detection of genetic marker of skeletonema costatum japonicum and its method |
| CN101914615A (en) * | 2010-05-28 | 2010-12-15 | 上海交通大学 | Constructing method of standard sample in Alexandrium catenella (A.catenella) fluorescence quantitative polymerase chain reaction |
| CN105002273A (en) * | 2015-07-10 | 2015-10-28 | 中国海洋大学 | Primer group for Alexandrium catenella cell explosive growth monitoring based on real-time fluorescent quantitative PCR method and monitoring method thereof |
Non-Patent Citations (4)
| Title |
|---|
| AB704015.1;Genbank;《NCBI》;20130130 |
| 福建东山岛附近海域造礁石珊瑚共生藻的分子系统分类和遗传多样性研究;董志军 等;《台湾海峡》;20080531;第27卷(第2期);第135-140页 |
| 虫黄藻的分类和遗传多样性研究进展;董志军 等;《海洋通报》;20080630;第23卷(第3期);第95-101页 |
| 运用PCR．RFLP方法研究三亚鹿回头岸礁造礁石珊瑚共生藻的组成;董志军 等;《生物多样性》;20081231;第16卷(第5期);第498-502页 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105506145A (en) | 2016-04-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ruvindy et al. | qPCR assays for the detection and quantification of multiple paralytic shellfish toxin-producing species of Alexandrium | |
| CN105154564B (en) | The unified analysis method estimated based on environment DNA technology fish DNA abundance | |
| CN102102124B (en) | Multiplex fluorescence PCR (Polymerase Chain Reaction) detection kit for typhoid/paratyphoid saimonella | |
| CN101775440A (en) | Plasmid control molecule for detection of transgenic soybean and building method thereof | |
| CN102985565A (en) | Rapid genotyping analysis for human papillomavirus and the device thereof | |
| CN101144775B (en) | Bacteria real-time fluorescence quantitative polymerase chain reaction detection reagent kit | |
| CN100451129C (en) | Pig pestivirus fluorescence quantitative RT-PCR diagnosis agent kit | |
| CN104561281B (en) | Brown tide algae species detection method and kit | |
| CN102747144B (en) | Triplex real-time fluorescence PCR detection primers, probes, detection kit and detection method for three bacterial | |
| CN106987626A (en) | For a variety of fungies of quick detection and identify primer and probe and its application of strain | |
| CN111154900B (en) | Pseudomonas aeruginosa specific new molecular target and rapid detection method thereof | |
| CN103468806B (en) | The method for quick of scallop pathogenic Vibrio splindidus Vibrio splendidus | |
| CN101333557B (en) | Simultaneous quantitative determination process for various enteric pathogenic bacteria in environment water body example | |
| CN106086200B (en) | A method of for establishing the technical indicator of free coral and endoparasitism phycobiont abundance and coral bleaching warning coefficient H | |
| CN102978282B (en) | Typhoid fever salmonella and salmonella paratyphi fluorescent quantitative polymerase chain reaction (PCR) detection kit and application thereof | |
| CN105506145B (en) | A kind of primer, probe and identification method for identifying the quick Schizoid of the photosynthetic algae of coral symbiosis | |
| CN102312015B (en) | Real-time fluorescent quantitative PCR method for detecting parasitic Xanthomonas albilineans in sugarcane | |
| CN104673885A (en) | Detection kit and detection method for I-form legionella pneumophila | |
| CN106916903A (en) | The real-time fluorescence RT PCR detection methods and kit of mycobacterium tuberculosis 85B mRNA | |
| Mota et al. | Extraction of DNA from micro-tissue for bat species identification | |
| CN105441579A (en) | Primer and probe for identifying temperature-sensitive type of coral symbiotic photosynthetic algae and identifying method | |
| Peeridogaheh et al. | Evaluation of three DNA extraction methods for detection of brucella DNA in human serum samples | |
| CN103555844B (en) | Fluorescent quantitative PCR (polymerase chain reaction) kit for detecting sugarcane red stripe germ | |
| CN114196767B (en) | Specific molecular target and method for detecting staphylococcus aureus ST type by using same | |
| CN201156030Y (en) | Gram bacteria retest real-time fluorescent quantitative PCR detection reagent kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |