CN1580266A - Method for extablishing polymorphism adenoid tumour mouse model - Google Patents
Method for extablishing polymorphism adenoid tumour mouse model Download PDFInfo
- Publication number
- CN1580266A CN1580266A CNA031422209A CN03142220A CN1580266A CN 1580266 A CN1580266 A CN 1580266A CN A031422209 A CNA031422209 A CN A031422209A CN 03142220 A CN03142220 A CN 03142220A CN 1580266 A CN1580266 A CN 1580266A
- Authority
- CN
- China
- Prior art keywords
- plag1
- human mammal
- pleomorphic adenoma
- promotor
- mouse
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a kind of polymorthy adenoma animal model. Roll FLAG1 expression box from out source in the animal's gene group. The box contains promoter, FLAG1 code list relating to the operation of promoter. The rotuled gene mice get spontaneous salivary gland tumor, which accord with main pathology character of men's multiformity tumor. The invention also provides the preparation of the model and the model's use.
Description
Technical field
The present invention relates to field of transgenic technology.More specifically, relate to a kind of pleomorphic adenoma mouse model, set up the method for this pleomorphic adenoma mouse model, and the purposes of this pleomorphic adenoma mouse model.
Background technology
Pleomorphic adenoma (pleomorphic adenoma) is the modal salivary gland tumor of Oral and Maxillofacial Surgery, good sending out in the parotid gland and palatine gland, the boundary is a typical critical knurl (border-linetumor) between innocent and malignant tumour, accounts for 53.9% of whole salivary gland tumor.Pleomorphic adenoma has another name called mixed tumor (mixed tumor), has diversity aspect the histopathology form, can contain tumour epithelium sample tissue, pseudocartilage tissue and mucoid tissue etc.
A large amount of cytogenetical studies is found, is often occurred abnormal karyotype in the pleomorphic adenoma.According to statistics, the normal pleomorphic adenoma of karyotype only accounts for 30% of sum, and all the other 70% are abnormal karyotype, and the wherein modal 8q12 of being resets in the district.
1997, Kas K etc. were from t (3; 8) (p21; Q12) transcript of having cloned a new about 7.5Kb in the pleomorphic adenoma tissue of chromosome abnormalty, and called after pleomorphic adenoma gene 1 (pleomorphicadenoma gene 1, PLAG1).PLAG1 is positioned at human chromosome 8q12, and cDNA (Gene Bank is numbered U65002) total length is 7313bp, comprises 5 exons, and encoder block is 1503bp altogether, and its expression product is a zinc finger protein, contains seven C2H2 zinc fingerses.
Modal t (3 in the pleomorphic adenoma; 8) (p21; Q12) chromosome translocation is involved PLAG1 and is positioned at the plain (gene of β-catenin) of No. 3 chromosomal β-be connected.Because chromosome translocation causes the regulating and controlling sequence of two genes to exchange (promoter swapping) mutually, makes the PLAG1 gene activation; And t (5; 8) high expression level of PLAG1 gene then is and is positioned at the result that No. 5 chromosomal leukaemia inhibitory factor acceptor (LIFR) gene generation promotor is exchanged in the pleomorphic adenoma of chromosome translocation.In the normal pleomorphic adenoma of some caryogram, PLAG1 and β-be connected are plain, transcriptional elongation factor SII gene takes place by recessive the rearrangement, cause PLAG1 to express and raise.In addition, in not detecting the unusual and recessive pleomorphic adenoma of resetting of karyotype, the also unconventionality expression of ubiquity PLAG1.This prompting PLAG1 expression of gene activates and takes place closely related with pleomorphic adenoma.PLAG1 has also proved the effect of PLAG1 in tumour takes place at the high expression level of Lipoblastoma.
Though research hint PLAG1 is a kind of potential oncogene, yet the relation of the biological function of PLAG1 and high expression level thereof and pleomorphic adenoma morbidity still lacks direct evidence, does not also have the research report of whole animal level.In addition,, also do not have suitable pleomorphic adenoma animal model at present, give research, treatment, the drug screening of pleomorphic adenoma and prevent that research such as postoperative recurrence from bringing inconvenience because the Molecular Study that pleomorphic adenoma takes place relatively lags behind.
Therefore, this area presses for exploitation pleomorphic adenoma animal model.
Summary of the invention
The method that purpose of the present invention just provides a kind of pleomorphic adenoma mouse model and sets up this pleomorphic adenoma mouse model.
Another object of the present invention provides the purposes of this pleomorphic adenoma mouse model.
In a first aspect of the present invention, a kind of method that produces pleomorphic adenoma non-human mammal model is provided, comprise step:
(i) provide a linearizing transgenosis construct, this construction from 5 ' to 3 ' contains (a) promotor successively, (b) the PLAG1 encoding sequence that links to each other with the promotor operability, (c) terminator codon, and also contain the homologous region that carries out homologous recombination in the upstream and the codon downstream of promotor;
(ii) the linearizing construction gene in the step (i) is introduced non-human mammal zygote with microinjection technique;
(iii) with the uterine tube of step zygote transplation (ii) to the non-human mammal of false pregnancy;
(iv) produce genetically modified non-human mammal, be integrated with the FLAG1 expression cassette in the genome of described non-human mammal, described expression cassette contains (a) promotor, (b) the PLAG1 encoding sequence that links to each other with the promotor operability, (c) terminator codon.
In another preference, described method also comprises step: (v) the transgenic animal that step is (iv) obtained are identified.
In another preference, described evaluation is by PCR and Southern hybrid method.
In another preference, described method also comprises step:
(vii) with the transgene mammal and normal Mammals hybridization that obtain, to obtain filial generation.
In another preference, described non-human mammal is mouse, rat, rabbit, monkey.
In another preference, described evaluation is the tissue of transgenic animal to be hybridized with RT-PCR and Northern carry out expression pattern analysis.
In another preference, described PLAG1 is people's PLAG1.
In a second aspect of the present invention, passed through the pleomorphic adenoma non-human mammal model that obtains with aforesaid method.
In a third aspect of the present invention, a kind of purposes of using the pleomorphic adenoma non-human mammal model of aforesaid method acquisition of the present invention is provided, it is used to screen the medicine of treatment pleomorphic adenoma.
Description of drawings
Fig. 1 has shown MMTV-PLAG1 transgenic positive mouse has been identified.
A:PCR identifies 1: transgenic positive 1.1K and 610bp band occur or the 610bp band only occurs, and wild-type or negative mouse can amplify the 1.1K band.
B:PCR identifies 2: the 660bp band appears in transgenic positive, and wild-type or negative mouse do not have special band amplification.
C: transgenic mice southern blot identifies (genomic dna is cut with the BamHI enzyme), and 1.9K expection band appears in positive mouse.With the positive contrast of plasmid DNA.
Swimming lane M is the molecular weight marker thing, and swimming lane 9,41 etc. is the numbering of each transgenic mice, and Wt is a wild-type mice.
Fig. 2 has shown transgenic mice sialisterium PLAG1 gene expression analysis (Northern blot).
Fig. 3 has shown the transgenic mice that pleomorphic adenoma takes place.
Embodiment
Extensive studies in the MMTV expression vector, has obtained transgenic mice through microinjection with people PLAG1 gene clone to the inventor through going deep into, thereby has set up the stable pleomorphic adenoma animal model of phenotype first.Spontaneous salivary gland tumor has taken place in transgenic mice, and pathologic finding shows that tumour meets the main pathological characters of people's pleomorphic adenoma.Finished the present invention on this basis.
Can be used for PLAG1 of the present invention and be not particularly limited, can be people, mouse, rat, pig or other mammiferous PLAG1.Can be wild-type PLAG1, also can be mutant PLAG1.A kind of particularly preferred PLAG1 sequence is the sequence that GenBank is numbered U65002, and its total length is 7313bp (SEQID NO:1), comprises 5 exons, and encoder block is 1503bp altogether, and its expression product is a zinc finger protein, contains seven C2H2 zinc fingerses.
Can be used for promotor of the present invention and be not particularly limited, representational example comprises (but being not limited to): MMTV LTR promotor, CMV promotor, salivin gene promoter etc.
In the method for generation transgenic animal of the present invention, at first make up a construction, this construction from 5 ' to 3 ' contains (a) promotor successively, (b) the PLAG1 encoding sequence that links to each other with the promotor operability, (c) terminator codon.In addition, also contain the homologous region that carries out homologous recombination in the upstream and the codon downstream of promotor.
After having obtained construction, available ordinary method changes linearizing construction in the zygote over to.Treat mouse birth back identifies with methods such as PCR detection, Southern blottings whether PLAG1 is integrated into its genome, thereby obtain transgenic mice.
The main application of pleomorphic adenoma non-human mammal model of the present invention comprises: the Prevention Research of pleomorphic adenoma, the operation of pleomorphic adenoma and study medication, the Prevention Research of pleomorphic adenoma postoperative recurrence, pleomorphic adenoma Study on Pathogenesis etc.A kind of specific purposes is the medicine of screening treatment pleomorphic adenoma, is about to drug candidate and is applied to animal pattern of the present invention, and observe the size variation of pleomorphic adenoma, thereby determine effective medicine.
Major advantage of the present invention is:
(a) be that first meets the sialoma animal model of people's pleomorphic adenoma pathological characters and molecular mechanism thereof in the world.
(b) transgenosis can Mendelian's rule genetic stability.A plurality of different onset rates, the transgenic mice of different onset time system are arranged, can select for use according to research purpose.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, people such as Sambrook for example, molecular cloning: laboratory manual (NewYork:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Embodiment 1
The structure of MMTV-PLAG1 plasmid
Use following primer, primer PLAG381:5 '-TTACGACCACATGAAACTTGAG-3 ' (SEQ ID NO:2), primer PLAG2003:5 '-TGAATCCATGTCCCAGAATCCT-3 ' (SEQ ID NO:3), is template with total RNA in people's sialoma or the placenta sample through the cDNA that reverse transcription obtains, and obtains people's PLAG1 gene by the RT-PCR method of routine.Directly be cloned into pGEM-Teasy carrier (Promega) then, obtain plasmid pGEMT-PLAG1.
MMTV-EGFR-stop (Xie W, Paterson AJ, Chin E, et al.Targetedexpression of a dominant negative epidermal growth factor receptor inthe mammary gland of transgenic mice inhibits pubertal mammary ductdevelopment.Mol Endocrinol.1997; 11 (12): 1766-81) contain MMTV LTR promotor.MMTV-EGFR-stop is cut with the EcoRI enzyme, excise wherein EGFR gene, use CIAP (ox pancreas alkaline phosphatase) dephosphorylation after the recovery carrier segments; Cut pGEMT-PLAG1 with the EcoRI enzyme, reclaim the PLAG1 gene fragment; Connect two fragments with ligase enzyme, form plasmid MMTV-PLAG1, wherein, the PLAG1 gene is positioned at MMTV LTR downstream.
Embodiment 2:
PLAG1 introduces the generation of mouse fertilized egg and transgenic positive mouse through microinjection
After transgenosis plasmid MMTV-PLAG1 uses the XhoI linearizing, reclaim the fragment (4.3kb) that contains MMTV LTR and PLAG1 gene.Linearizing DNA (about 500 copies) is injected in the male pronucleus of mouse fertilized egg, and the zygote transplation after the injection is given the false pregnancy mouse.After about 20 days, the mouse birth.
Mouse was born after 3 weeks, cut tail and extracted DNA, and whether analyze has transgenosis to integrate: after overlapping the PCR reaction detection with two, primer is as shown in table 1.The betaglobulin gene that contains with the MTV-PLAG1 plasmid is that probe is done the affirmation of Southern blotting.
Table 1
| Numbering | Sequence (5 '-3 ') | ????SEQ?ID?NO： |
| ??1 | GenBank numbering: U65002 | ????1 |
| ??2 | ??TTACGACCACATGAAACTTGAG | ????2 |
| ??3 | ??TGAATCCATGTCCCAGAATCCT | ????3 |
Fig. 1 has shown MMTV-PLAG1 transgenic positive mouse has been identified.A:PCR identifies 1: transgenic positive 1.1K and 610bp band occur or the 610bp band only occurs, and wild-type or negative mouse can amplify the 1.1K band.B:PCR identifies 2: the 660bp band appears in transgenic positive, and wild-type or negative mouse do not have special band amplification.C: transgenic mice southern blot identifies (genomic dna is cut with the BamHI enzyme), and 1.9K expection band appears in positive mouse.With the positive contrast of plasmid DNA.
As a result, obtain 9 of transgenic positive mouse altogether, these mouse breed to build through mating and are, build together and have found 6 transgenic mice systems.
Embodiment 3
The expression of transgenosis in mouse sialisterium
Whether express in the mouse body in order to detect MMTV LTR/PLAG1 fusion gene, extract the total RNA of mouse sialisterium according to a conventional method with Trizol reagent.Being transferred to nitrocellulose filter after getting 20mg RNA electrophoresis, is that probe carries out Northern blot hybridization with the PLAG1 gene fragment.
Found that therein and have PLAG1 transgenosis high level expression (Fig. 2) in 5 transgenic mice systems.
Embodiment 4
The spontaneous pleomorphic adenoma of transgenic mice
In 6 transgenic mice systems 3 transgenic mices are arranged is salivary gland tumor to occur spontaneously, and through pathologic finding, tumor tissues contains glandular epithelium sample tissue, pseudocartilage sample tissue, mucoid tissue and myoepithelical cell etc.; Similar arrangement mode in the normal appearance of various tissues and the people's pleomorphic adenoma.Tumour has the main pathological characters (Fig. 3) of people's pleomorphic adenoma.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table
＜110〉Shanghai Nanfangmoshi Biological Sci-Tech Dev Co., Ltd.
Shanghai Second Emdical University of Shanghai life science institute of Chinese Academy of Sciences health science center
Shanghai Second Emdical University
No.9 People's Hospital Attached to Shanghai No.2 Medical Univ
＜120〉a kind of method of setting up the pleomorphic adenoma mouse model
<130>033705
<160>3
<170>PatentIn?version?3.1
<210>1
<211>7313
<212>DNA
＜213〉homo sapiens (Homo sapiens)
<400>1
ggcagcgcat?acactacaat?ggctgctgga?aagaggcgta?aggaaacaat?ttccaggccc??60
gccgcgtcca?gcccgaaata?tgagaaaaaa?attattagaa?attccgcggg?cggtgtagag??120
gcggcggacg?ggccggaggg?aggatgttaa?agccccgcgg?ttgcctcttg?gtgctgcctt??180
ggccgtattt?ggcacccaga?atgcttcatt?ctgtgacggt?ctattaataa?ggttgccttg??240
ctagagtttg?gagcagggcc?tcagattggc?caaaatggga?aggattggat?tccactctct??300
tccacgaaga?gtcaatggga?ctggctaaga?tcaaagtctg?aggctttttc?catcagtaat??360
cagtcccttt?ttgctttctt?ttacgaccac?atgaaacttg?agaagccacc?taaagctata??420
tcatttagtg?gagttgggca?gttcccaagt?gtccaacaag?aaggcctggt?ttaggctgcg??480
atggccactg?tcattcctgg?tgatttgtca?gaagtaagag?atacccagaa?agtcccttca??540
gggaaacgta?agcgtggtga?aaccaaacca?agaaaaaact?ttccttgcca?actgtgtgac??600
aaggccttta?acagtgttga?gaaattaaag?gttcactcct?actctcacac?aggagagagg??660
ccctacaagt?gcatacaaca?agactgcacc?aaggcctttg?tttctaagta?caaattacaa??720
aggcacatgg?ctactcattc?tcctgagaaa?acccacaagt?gtaattattg?tgagaaaatg??780
tttcaccgga?aagatcatct?gaagaatcac?ctccatacac?acgaccctaa?caaagagacg??840
tttaagtgcg?aagaatgtgg?caagaactac?aataccaagc?ttggatttaa?acgtcacttg??900
gccttgcatg?ccgcaacaag?tggtgacctc?acctgtaagg?tatgtttgca?aacttttgaa????960
agcacgggag?tgcttctgga?gcaccttaaa?tctcatgcag?gcaagtcgtc?tggtggggtt????1020
aaagaaaaaa?agcaccagtg?cgaacattgt?gatcgccggt?tctacacccg?aaaggatgtc????1080
cggagacaca?tggtggtgca?cactggaaga?aaggacttcc?tctgtcagta?ttgtgcacag????1140
agatttgggc?gaaaggatca?cctgactcga?catatgaaga?agagtcacaa?tcaagagctt????1200
ctgaaggtca?aaacagaacc?agtggatttc?cttgacccat?ttacctgcaa?tgtgtctgtg????1260
cctataaaag?acgagctcct?tccggtgatg?tccttacctt?ccagtgaact?gttatcaaag????1320
ccattcacaa?acactttgca?gttaaacctc?tacaacactc?catttcagtc?catgcagagc????1380
tcgggatctg?cccaccaaat?gatcacaact?ttacctttgg?gaatgacatg?cccaatagat????1440
atggacactg?ttcatccctc?tcaccacctt?tctttcaaat?atccgttcag?ttctacctca????1500
tatgcaattt?ctattcctga?aaaagaacag?ccattaaagg?gggaaattga?gagttacctg????1560
atggagttac?aaggtggcgt?gccctcttca?tcccaagatt?ctcaagcatc?gtcatcatct????1620
aagctagggt?tggatcctca?gattgggtcc?ctagatgatg?gtgcaggaga?cctctcccta????1680
tccaaaagct?ctatctccat?cagtgacccc?ctaaacacac?cagcattgga?tttttctcag????1740
ttgtttaatt?tcataccttt?aaatggtcct?ccctataatc?ctctatcagt?ggggagcctt????1800
ggaatgagct?attcccagga?agaagcacat?tcttctgttt?cccagctccc?cacacaaaca????1860
caggatcttc?aggatcctgc?aaacactata?gggcttgggt?ctctgcactc?actgtcagca????1920
gctttcacca?gcagtttaag?cacaagtacc?accctcccac?gtttccatca?agcttttcag????1980
taggattctg?ggacatggat?tcattacaga?aatgtatgtg?tagctgtgcc?ctagatgacc????2040
atttttattt?tagtgcctac?tttaaaacag?tataaaaatt?tctgcttttg?tataatacaa????2100
attttcatta?agccagtata?aaatagaaac?tagcttttaa?actgagcttt?ggaaccattt????2160
gtgttcagtt?aagtttacct?gggtattttg?tcctgattca?ctgccaattg?tcacatttta????2220
agactttttt?tttttccata?taggaaagcc?attattagta?gtaaactttt?acaaatccca????2280
ttttcaaatt?acttttagat?cttaaaattt?tcatttttgt?ctaataacag?tggctctacc????2340
ttttgacatc?tggctcatta?aaaaatttag?caatagaatg?taaattgtat?aaaaagtttg????2400
tgaataactc?aagggtttaa?attttcttac?tagcttctaa?atggattaat?aatcaagtgc????2460
ttcaaatgaa?ttaagagtcc?agtttcggaa?gataataaat?gtttgttaga?tacaccataa????2520
tttcagatca?gtatattctg?aagactctct?gttgtctggc?taaaatattt?gccatcttta????2580
ttatgagcct?ttaaggaaaa?caaaccctaa?acacaaagca?tcagtattta?tagcaaaaag????2640
agactctgtt?aggtgacatg?gcatttcgtg?tcacttaata?gttggcccta?aattagtaca????2700
caggatattt?tgtcgtgttt?catccttctt?aacatgctat?cttttcattt?aataatagta????2760
atagtgtatg?gcattggggt?cttcagagtc?gatatatagg?tagatctctt?tagtcttttc????2820
cacctttcac?atccaagggg?tgggtcaagt?gcagccagca?atttattttc?attgttggcc????2880
cacggttagt?ccataatcta?gagccattgt?ggaactgcag?ccatgaggtg?tgtttatccc????2940
acagtggatt?gactcagcct?ctgtgggtga?cagacttcta?agcaggaaga?tagacgtgaa????3000
gcacatggtt?acatttggga?acttgtgtag?ggatcatggc?ccctgtagcc?agggttaaaa????3060
actggacttt?ttagaagtaa?agtaaaagca?tagcgcttat?atcatttctt?gctgaatttg????3120
atatgttttt?ctttccctta?agaatcaaaa?gcagaaaaca?aaaacaacag?tcctactccg????3180
atgttatctt?tctgattcaa?tgtgaatcca?tctttccttg?caatattttg?gatggagaat????3240
ttgaagttaa?atgcattaga?aaactacctg?atgaactacc?acaaagtttt?aagtgactag????3300
aaatatatac?agtaaaatcc?cactttcatg?catctctggg?aaatgatagg?agtattgcaa????3360
ataagttgag?tttgtagagg?gtaacaaagt?aaagtaaaac?aaacctatct?tggttaacat????3420
gaaaataaca?attgagaata?tattatattc?actgaataat?tataggcttt?tcctcacatt????3480
agacaaccaa?cataatcttc?ttaaaggtct?aattaatata?tttttctaag?ggtcagttgg????3540
gacattaacc?taagaaacat?atctattaag?cacttgttaa?caccttattt?taggaccctt????3600
tccgttgggg?atgggggcaa?gggtgggagg?tttttagaag?agtatatatc?tctttaaaaa????3660
aaaacagaaa?gaaaaatatt?tctgagcact?cattagccct?atatggaaac?ttctttcctt????3720
tttgtagggc?cagttatcac?tgcagattgc?aatgtttacc?aagaatttct?aaaaatgagt????3780
gcagattact?gaatataata?cattatttaa?aatatttggg?agtagtataa?tttgttgaga????3840
aatgtaaatt?gtaataatgt?aaatgggggg?cttcaatata?tatatataat?acacacacac????3900
acacacatgc?acacataccg?cacttcatag?aatcaaagtt?gctctctgaa?ggagctttgg????3960
ctcctgatat?tttatcatgc?tcctatattt?ttttaatcct?tggagcagta?gtttttatac????4020
ttatgtattt?aaattttatt?atgaaaaatt?acatttatta?aaaaagtgtg?ttccaaaggc????4080
attaaaatta?tatatgttaa?taaggaagta?catttttaaa?tttttcaaac?tgctcctagc????4140
ttttgattag?gagaatattt?tttctgaaag?taggcttttc?gctctgcttc?attactgctt????4200
cctttagttt?ctatgaaaca?gattgcttac?ctaaatcttt?agttgaatga?ttagtgttca????4260
atattgcttt?aatcaccata?taaaaggaaa?aaaattggtg?acagagcaca?aatagaaaac????4320
ctatttttaa?atagaaatca?caaatagcaa?gtgtggaagc?actactttat?tctgtttaaa????4380
atgtacttaa?gaagtcatca?aattagtgaa?ctgagacatt?ggccttagta?ggctgtattc????4440
actgctaatt?taaaaaaggg?agtaccagga?tttattaagt?aaagcatttt?ggaaatgggg????4500
aatagcgcca?tatatgtatg?tatgtgtatg?tgtgtgtgtg?gtgtgtgtat?atatacacac????4560
acacatacat?acttaaatct?tgccctgcat?gaaattcaaa?tacatggagg?cacatcttca????4620
gggcaccagt?gttaaaattt?tggagtctta?attttcatgt?gtacacctct?ttgcctgttc????4680
ccacccccag?acttgaaata?acacttcaga?gtaagaggga?attcagctaa?tttgttttta????4740
aaattgactg?tagtggtcac?taaacccttt?ttgagagaat?ttctattaaa?gatgaggcag????4800
actcgcttat?ttgaattgca?caatgttcta?acaaggatgt?aacacagaat?tggctttttt????4860
ttccctagaa?aaagattgtt?tgtttctatg?tcaactagat?atgattaaaa?ataagtattg????4920
ccaatgctgt?tttcattctc?tagtggccag?aatcattatc?cttgaaattt?ctggtagtgc????4980
cttagcttgg?ttaaaaaaaa?aaaaaaaaaa?aaaaaaaaag?ggattaacat?taaataaaag????5040
tagtttagaa?tttgggcctc?agacaagata?ttgaacctca?ttcagtttca?cttccacatg????5100
tatgtacaag?ttaggtcacc?aaacacggaa?gttgagtgtg?gaaggatctt?ggcactgtaa????5160
gcaatgctat?ccattgatgt?atacaagtac?ctttatagtt?atcgatcact?gttaaaactt????5220
tcattttaaa?atcctattac?caagttcagt?tttttaaaac?ttcaattgtc?ctggctgatt????5280
atgcatcact?ctgtgtgcaa?cttttttatt?tcatttagtg?tttctttcaa?gctgtgtatt????5340
tttgcctatt?tgttgcttgt?gctttatttt?tcttagtcat?ttgtggaata?tagtgatata????5400
ttgtgttaat?ttggacagta?gcggttttta?aaaaccatat?actgactgaa?acatgagcca????5460
gagccgattg?ctttattaag?ctaataatga?atgttaaaga?gtacatattt?tcaggatcgt????5520
tcatctagtg?agcaatacac?atattatagg?ccaatatttt?tttaaaaaat?agagcttggt????5580
caacctctat?actacacata?ttacaagata?tagcactttc?aaaatgaatc?taaaccttta????5640
cagaaacttt?cttataggtt?atgcctttta?ttttaagact?tattataatt?caagtgccat????5700
tagatgatat?atatgtaggc?ctttgatata?taatgctttg?tgtacaaaaa?tggtagatgg????5760
tattttaaac?aggtacattt?ttacagtgtt?ttcttatcaa?tttgctatat?tgcacagaat????5820
cagtgtgtgt?cttttcataa?ggttttacaa?tggtttattt?ttttacaagg?tttacgtgtc????5880
tcaaagcaca?ctgtcttccc?agtacgtaag?ttaaaaaata?ccagttcacc?caagttgctt????5940
ctagcctact?gagatccatg?tgacattgga?ggagatcttt?taaatgttta?gtattcgtca????6000
ttagcaatgg?ctggctgtta?gttctggtaa?atgtgtgcct?aagttgaatt?tgtcttgttt????6060
ttctcacact?gtgtcagcag?ccatgtctac?aacacagata?agtctgttgt?gatcacatag????6120
atctacataa?gttgtgcagt?tttgtgctaa?aaacccatag?ggagctcctt?tgggatcata????6180
gaaaagaaga?tcatgcaacc?agcattggtg?aaggcacact?cagattgcac?ttagggcctt????6240
tctatgatgt?tgtcaaccct?ctgaggatgg?aaggcagtgt?cttttgatgt?tatctagcct????6300
agaaatgaca?cagaactatt?gctaatgtat?aaaacacttc?attatataag?cttcagtggt????6360
acagatgaac?cagaatgaat?gtttatcttc?tcagaaacac?tccttcaata?ttatattgga????6420
tcatgctgct?aatgtaactt?gggctacaac?tcttcatggt?gctacaaact?tctctgtctc????6480
attcagtcgt?atttttttat?ccatagaaaa?aggactacat?taggtgtaaa?agtgtacaat????6540
atatttttat?actgtgactt?aatttgtcat?taacaaactt?ttacaccacc?acaatgtatt????6600
catgtgcact?tgcaaaagga?gatctcggac?atgcaaatgt?taccagaaca?aacccagctt????6660
ttgtccacaa?ggtgactgta?actcagaatg?gaaagtgggc?tttataatag?ggtgtggagt????6720
gaagaacatg?ctgtatgtta?ctaacagccc?tttgaattta?acaaaactg?ggaatccatt?????6780
aggaaacgga?ttgcatcata?cctgaacata?agctggactg?ctgaaattgt?atttttagct????6840
aatgaaaaag?tgtttggact?agtactctaa?aaatgttcta?atgataaagt?tttgagtcaa????6900
aatagaaaag?aaaaaaatct?gcattccagg?ccgaattttg?tatattttta?ttgcatttaa??6960
aattgctatt?ctgtaatatt?gggaaatcaa?gtggcttatc?atgtatatcg?tgtacttaaa??7020
atgtattcac?aaactactgt?tgtatttgta?taaaatatag?acaaagatca?tattttttgt??7080
gtgtgtataa?gctctgtaaa?atagcaatca?cattatgaag?ctgcagtgat?actacatttt??7140
aaacattcac?atccaaagaa?gcagactatt?tattgtccat?ataccagatt?taaaatatta??7200
atttgctgct?aattaaataa?tagtactgca?gcttcttgtg?gcctacagtg?ttatgtttgc??7260
tgtaagaata?agatatgtga?attccacaaa?atatatgaat?aaaatctcgt?gcc?????????7313
<210>2
<211>22
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
<222>(1)..(22)
＜223〉primer
<400>2
ttacgaccac?atgaaacttg?ag???????????????????????????????????????????22
<210>3
<211>22
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
<222>(1)..(22)
＜223〉primer
<400>3
tgaatccatg?tcccagaatc?ct??????????????????????????????????????????22
Claims (8)
1. a method that produces pleomorphic adenoma non-human mammal model is characterized in that, comprises step:
(i) provide a linearizing transgenosis construct, this construction from 5 ' to 3 ' contains (a) promotor successively, (b) the PLAG1 encoding sequence that links to each other with the promotor operability, (c) terminator codon, and also contain the homologous region that carries out homologous recombination in the upstream and the codon downstream of promotor;
(ii) the linearizing construction gene in the step (i) is introduced non-human mammal zygote with microinjection technique;
(iii) with the uterine tube of step zygote transplation (ii) to the non-human mammal of false pregnancy;
(iv) produce genetically modified non-human mammal, be integrated with the FLAG1 expression cassette in the genome of described non-human mammal, described expression cassette contains (a) promotor, (b) the PLAG1 encoding sequence that links to each other with the promotor operability, (c) terminator codon.
2. the method for claim 1 is characterized in that, also comprises step:
(v) the transgenic animal that step is (iv) obtained are identified.
3. method as claimed in claim 2 is characterized in that, described evaluation is by PCR and Southern hybrid method.
4. method as claimed in claim 2 is characterized in that, also comprises step:
(vii) with the transgene mammal and normal Mammals hybridization that obtain, to obtain filial generation.
5. the method for claim 1 is characterized in that, described non-human mammal is mouse, rat, rabbit, monkey.
6. method as claimed in claim 2 is characterized in that, described evaluation is the tissue of transgenic animal to be hybridized with RT-PCR and Northern carry out expression pattern analysis.
7. the method for claim 1 is characterized in that, described PLAG1 is people's PLAG1.
8. the purposes of a pleomorphic adenoma non-human mammal model that obtains with the described method of claim 1, its feature can be used for screening the medicine of treatment pleomorphic adenoma.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB031422209A CN1295340C (en) | 2003-08-13 | 2003-08-13 | Method for extablishing polymorphism adenoid tumour mouse model |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB031422209A CN1295340C (en) | 2003-08-13 | 2003-08-13 | Method for extablishing polymorphism adenoid tumour mouse model |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1580266A true CN1580266A (en) | 2005-02-16 |
| CN1295340C CN1295340C (en) | 2007-01-17 |
Family
ID=34579418
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB031422209A Expired - Lifetime CN1295340C (en) | 2003-08-13 | 2003-08-13 | Method for extablishing polymorphism adenoid tumour mouse model |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1295340C (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101342372B (en) * | 2007-07-09 | 2011-06-29 | 上海南方模式生物科技发展有限公司 | Use of pancreatic lipase associated protein 1 |
| CN110495419A (en) * | 2018-05-16 | 2019-11-26 | 首都医科大学附属北京朝阳医院 | A kind of mouse model of Huppert's disease extramedullary plasmacytoma |
| CN113881772A (en) * | 2021-09-14 | 2022-01-04 | 青岛大学附属医院 | Product for detecting CircCDR1as gene or protein and application thereof |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101942463B (en) * | 2009-12-28 | 2013-01-09 | 哈尔滨医科大学 | Method for building acute polytypism porpheyria transgenic mice model |
| CN101921795B (en) * | 2010-08-16 | 2014-07-02 | 哈尔滨医科大学 | Method for establishing porphyria cutanea tarda (PCT) transgenic mouse model |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1998049336A1 (en) * | 1997-04-28 | 1998-11-05 | Anticancer, Inc. | Metastasis models using green fluorescent protein (gfp) as a marker |
-
2003
- 2003-08-13 CN CNB031422209A patent/CN1295340C/en not_active Expired - Lifetime
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101342372B (en) * | 2007-07-09 | 2011-06-29 | 上海南方模式生物科技发展有限公司 | Use of pancreatic lipase associated protein 1 |
| CN110495419A (en) * | 2018-05-16 | 2019-11-26 | 首都医科大学附属北京朝阳医院 | A kind of mouse model of Huppert's disease extramedullary plasmacytoma |
| CN113881772A (en) * | 2021-09-14 | 2022-01-04 | 青岛大学附属医院 | Product for detecting CircCDR1as gene or protein and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1295340C (en) | 2007-01-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1295340C (en) | Method for extablishing polymorphism adenoid tumour mouse model | |
| CN1923850A (en) | Control gene of paddy leaf shape and application thereof | |
| CN1306043C (en) | Reagent and method for detecting leucocythemia susceptibility | |
| CN1769457A (en) | Butterfly orchid pPI15 encoding sequence and its uses | |
| CN100347298C (en) | Clone of fish muscle growth inhibit or MSTN gene, and establishment of said gene targeting carrier | |
| CN1891822A (en) | PH gene with specific mononucleotide pleimorphism, and its detecting method and use | |
| CN1211486C (en) | A DNA molecule encoding mutant prepro-neuropeptide Y, a mutant signal peptide, and uses thereof | |
| CN1239704C (en) | Gene associated with plant salt resistance and drought resistance, encoded protein and application thereof | |
| CN1795929A (en) | Method for generating model of chmice in male sterile | |
| CN1266273C (en) | Promoter for regulating and controlling mouse orphan nucleus recepter and its use | |
| CN1563084A (en) | 0sGLR1 gene of paddy and application | |
| CN1239706C (en) | Plant low-phosphorus resistant genes, encoded protein and application thereof | |
| CN101054583A (en) | Gene sequence of penaeus monodon cell periodic protein B | |
| CN1604967A (en) | Isolation tool for viable c-kit expressing cells | |
| CN1923276A (en) | Important regulation protein PAK7 of NF[kappa]B signal path | |
| CN1204252C (en) | Recombinant gene of soluble part in tumor necrosis factor acceptor and its fusion gene and product | |
| CN1281621C (en) | Method of diagnosing and treating heritage spasm paraplegia using NIPAl gene mutation hot point | |
| CN1605589A (en) | PC-1 gene promoter and its application | |
| CN100335137C (en) | Use of human homology cassette gene LHX4 in preparing medicine for treating phaeochromocytoma | |
| CN1208462C (en) | Human zinc finger protein family new gene ZNF325 | |
| CN1279167C (en) | Gene oder of directivity and differentiation factor 1 fat cell of pigs | |
| CN1724687A (en) | Relativity of proangiotension transferase 2 gene and prinary hypertension | |
| CN1182245C (en) | Brachydactyly and body height associated gene | |
| CN1305901C (en) | Tumor transfer related protein and coding gene thereof | |
| CN1648252A (en) | Wheat TaGI1 gene and its cloning and use |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CP03 | Change of name, title or address | ||
| CP03 | Change of name, title or address |
Address after: 201318 2-4, building 2, No. 178, Banxia Road, Pudong New Area, Shanghai Co-patentee after: Health Science Center of Shanghai Second Medical University Shanghai Academy of Life Sciences Chinese Academy of Sciences Patentee after: SHANGHAI MODEL ORGANISMS CENTER, Inc. Co-patentee after: SHANGHAI SECOND MEDICAL University Co-patentee after: University SHANGHAI 2ND MEDICAL Address before: 201203 Shanghai science and Technology Industrial Zone Zhangjiang Cailun Road No. 88 2 4 floor Co-patentee before: Health Science Center of Shanghai Second Medical University Shanghai Academy of Life Sciences Chinese Academy of Sciences Patentee before: SHANGHAI BIOMODEL ORGANISM SCIENCE & TECHNOLOGY DEVELOPMENT Co.,Ltd. Co-patentee before: SHANGHAI SECOND MEDICAL University Co-patentee before: University SHANGHAI 2ND MEDICAL |
|
| CX01 | Expiry of patent term | ||
| CX01 | Expiry of patent term |
Granted publication date: 20070117 |