CN1266273C - Promoter for regulating and controlling mouse orphan nucleus recepter and its use - Google Patents
Promoter for regulating and controlling mouse orphan nucleus recepter and its use Download PDFInfo
- Publication number
- CN1266273C CN1266273C CN 200310108631 CN200310108631A CN1266273C CN 1266273 C CN1266273 C CN 1266273C CN 200310108631 CN200310108631 CN 200310108631 CN 200310108631 A CN200310108631 A CN 200310108631A CN 1266273 C CN1266273 C CN 1266273C
- Authority
- CN
- China
- Prior art keywords
- promotor
- sequence
- gene
- seq
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The present invention discloses a promotor P2 nucleotide sequence for regulating and controlling the high expression of a mouse gene mLRH-1 (mouse liver receptor homolog 1) in the embryonic development process, and the application thereof. The promotor has high activity in a mouse embryo stem cell serving as an early development in vitro model but has correspondingly low activity in an adult cell strain. The discovery of the P2 promotor lays the basis for alternatively regulating the high expression of a heterologous gene or a purpose gene in early embryonic development period in the transgenic animal research and application field.
Description
Technical field
The present invention relates to the genetically engineered field, be specifically related to a kind of promotor and uses thereof.The promotor P2 and the purposes in Study on Transgenic Animal thereof that The present invention be more particularly directed to high expression level in the mouse gene mLRH-1 embryo development procedure are regulated the application of foreign gene at the early stage high expression level of fetal development with its selectivity.
Background technology
Main expression organ is pancreas, liver, small intestine and ovary to mouse orphan nuclear receptor mLRH-1 (mouse liver receptor homolog 1) in adult.MLRH-1 has important regulation to a plurality of expression of gene in above-mentioned tissue, participated in bile acide circulation and the adjusting of cholesterol equilibrated in the body widely.On the other hand, the mouse that mLRH-1 rejects (knock-out) just causes death at the early stage of fetal development, early than the differentiation of tissues such as pancreas, liver, shows that mLRH-1 has played important effect in early days in fetal development.
The existing mLRH-1 of studies show that gene is made up of 9 exons and 8 introns.The expression of mLRH-1 in adult hepatic is subjected to the regulation and control of the promotor P1 (contriver names this promotor to be different from P2 with P1) of the first exon upstream.P1 has the special activity of stronger liver.Still do not have clear and definite experimental evidence and show whether P1 also regulates and control the expression of mLRH-1 in embryo development procedure and other tissue.
Mouse embryo stem cell (Embryonic Stem Cell, ES Cell) is widely used in the functional study of gene.Can produce the mouse that goal gene is rejected by homologous recombination, observe because this gene physiological function is in vivo inferred in the mouse phenotype variation that the disappearance of goal gene causes.On the other hand, the ES cell has totipotency, can be according to the variation of environmental factor and directed differentiation is the good model of in vitro study early development and differentiation.
Therefore, this area presses for establishes the new mLRH-1 expression promoter of bringing into play, and this promotor has different expression regulation effects in embryonic stage and adult.Utilize this promotor or its expression vector in transgenic animal, both can produce useful matter then, again the further research purpose gene physiological function in fetal development stage particularly in vivo.
Summary of the invention
Purpose of the present invention just provides a kind of sequence of new regulation and control mouse gene mLRH-1 promotor of high expression level in embryo development procedure.
Another object of the present invention just provides the construction that contains described promoter sequence, carrier, and their purposes.
Another object of the present invention just provides a kind of method of utilizing described promotor high expression level foreign gene in embryo development procedure.
A first aspect of the present invention provides a kind of promotor, it is characterized in that, it comprises the nucleotide sequence of regulation and control mouse orphan nuclear receptors (mLRH-1) promotor of high expression level in embryo development procedure.
In a preference, described promotor comprises variant, homologue, segment or the derivative that is selected from following nucleotide sequence or has the following nucleotide sequence of functionally active:
1) 975-1419 position Nucleotide among the SEQ ID NO:1;
2) 1-1419 position Nucleotide among the SEQ ID NO:1;
In another preference, described promotor comprises and is selected from following nucleotide sequence, and described sequence has the promoter activity of regulation and control mouse orphan nuclear receptors (mLRH-1) high expression level in embryo development procedure:
1) shows the sequence of 75% homology with the nucleotides sequence shown in the SEQ ID NO:1;
2) show the sequence of 85% homology with the nucleotides sequence shown in the SEQ ID NO:1;
3) show the sequence of 95% homology with the nucleotides sequence shown in the SEQ ID NO:1;
In another preference, described promotor has variant, homologue, segment or the derivative that is selected from following nucleotide sequence or has the following nucleotide sequence of functionally active:
1) 975-1419 position Nucleotide among the SEQ ID NO:1;
2) 1-1419 position Nucleotide among the SEQ ID NO:1;
In another preference, described promotor has and is selected from following nucleotide sequence, and described sequence has the promoter activity of regulation and control mouse orphan nuclear receptors (mLRH-1) high expression level in embryo development procedure:
1) shows the sequence of 75% homology with the nucleotides sequence shown in the SEQ ID NO:1;
2) show the sequence of 85% homology with the nucleotides sequence shown in the SEQ ID NO:1;
3) show the sequence of 95% homology with the nucleotides sequence shown in the SEQ ID NO:1;
A second aspect of the present invention provides a kind of construction that is used for regulating and control foreign gene at the embryo development procedure high expression level, and described construction contains foreign gene and this foreign gene promotor above-mentioned with the present invention that be operably connected.Preferably, described promotor is to comprise variant, homologue, segment or the derivative that is selected from following nucleotide sequence or has the following nucleotide sequence of functionally active:
1) 975-1419 position Nucleotide among the SEQ ID NO:1;
2) 1-1419 position Nucleotide among the SEQ ID NO:1;
3) nucleotides sequence shown in the SEQ ID NO:1 is shown the sequence of 75% homology;
4) nucleotides sequence shown in the SEQ ID NO:1 is shown the sequence of 85% homology;
5) nucleotides sequence shown in the SEQ ID NO:1 is shown the sequence of 95% homology;
A third aspect of the present invention provides a kind of the present invention of containing the carrier of above-mentioned nucleotide sequence.
A fourth aspect of the present invention provides the host or the host cell that contain the above-mentioned carrier of the present invention.
A fifth aspect of the present invention provides the application of above-mentioned promotor in transgenic animal.
A sixth aspect of the present invention provides above-mentioned promotor selectivity to regulate the application of foreign gene at the early stage high expression level of fetal development.
A seventh aspect of the present invention, provide a kind of in embryo development procedure the method for high expression level foreign gene, it may further comprise the steps:
1) provides a construction, the described promotor of claim 1 that described construction contains foreign gene and is operably connected with this foreign gene;
2) with the construction transfection in the step 1) or conversion host or host cell, make its expression alien gene.
Preferably, described promotor is to comprise variant, homologue, segment or the derivative that is selected from following nucleotide sequence or has the following nucleotide sequence of functionally active:
1) 975-1419 position Nucleotide among the SEQ ID NO:1;
2) 1-1419 position Nucleotide among the SEQ ID NO:1;
3) show the sequence of 75% homology with the nucleotides sequence shown in the SEQ ID NO:1;
4) show the sequence of 85% homology with the nucleotides sequence shown in the SEQ ID NO:1;
5) show the sequence of 95% homology with the nucleotides sequence shown in the SEQ ID NO:1;
The present invention also comprise have with 75%, 85%, 90%, 95% homology of nucleotide sequence shown in the SEQ ID NO:1 and have the active sequence of identical adjusting function, can use the Clustal computer program that European information biology institute (EBI) provides to measure sequence homology.Also comprise SEQ ID NO:1 nucleotide sequence is replaced, disappearance, inserts or add and form through the conservative property of one or more (as 1-10) Nucleotide, and have the sequence of identical regulation activity function.
As used herein, " isolating " is meant that material separates (if natural substance, primal environment promptly is a natural surroundings) from its primal environment.Do not have separation and purification as the polynucleotide under the native state in the active somatic cell, but same polynucleotide as from native state with in other materials that exist separately, then for separation and purification.
" nucleotide sequence of the present invention " mentioned in the following description comprises the implication of " promotor of the present invention ", and vice versa.In addition, term " nucleotide sequence of the present invention " and " polynucleotide sequence of the present invention " " P2 promotor " " promotor of the present invention " are synonyms, the polynucleotide sequence of refer to have the P2 promoter sequence (SEQ NO:1) or its active fragments.
Functionally active of the present invention is meant that variant, homologue, segment or the derivative of nucleotide sequence of the present invention have the promoter activity of regulation and control mouse gene mLRH-1 high expression level in embryo development procedure.
Other aspects of relevant promotor of the present invention and/or nucleotide sequence comprise: the structure that contains sequence of the present invention; The carrier that contains sequence of the present invention; The plasmid that contains sequence of the present invention; The transformant that contains sequence of the present invention; The transforming tissue that contains sequence of the present invention; The organ that contains the conversion of sequence of the present invention; The host of containing the conversion of sequence of the present invention; The animal that contains the conversion of sequence of the present invention. the present invention also comprises the method with described promoter expression product, as expressing in host animal cell; Comprise the method that shifts described promotor.
" can be operatively connected " connection that is meant the promotor of dna sequence dna upstream, make this promotor mediate transcribing of this dna sequence dna.Be appreciated that promoter sequence comprises the transcription sequence between transcription initiation and translation initiation, the translation initiation codon.
" construction " is meant the nucleotide sequence that can influence expression of structural gene among the host compatible with nucleotide sequence.This construction comprises promotor at least, and randomly comprises transcription termination signal.As described herein, also can use other to realize expressing the necessary or helpful factor.
Polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.
The invention still further relates to the varient of above-mentioned polynucleotide, the varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, replacement, disappearance or the insertion of its (preferable less than the 10) Nucleotide that may be one or more, but can be from not changing the function of this promotor in fact.
The invention still further relates to nucleic acid fragment with above-mentioned sequence hybridization.As used herein, the length of " nucleic acid fragment " contains 15 Nucleotide at least, better is at least 30 Nucleotide, is more preferably at least 50 Nucleotide, and preferably at least 100 Nucleotide are above to P2 promotor total length.The amplification technique (as PCR) that nucleic acid fragment can be used for nucleic acid is to determine and/or to separate above-mentioned polynucleotide.
P2 promotor full length sequence or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be according to the present invention the nucleotide sequence of disclosed P2 promotor design primer, and with mouse gene group DNA or the artificial chromosome clone that contains mouse chromosome as template, amplification and must relevant sequence.
In case obtained relevant sequence, just can obtain relevant sequence in large quantity with recombination method.This normally is cloned into carrier with it, changes cell again over to, separates obtaining relevant sequence then from the host cell after the propagation by ordinary method.
In addition, also the method for available synthetic is synthesized relevant sequence, especially fragment length more in short-term.Usually, by first synthetic a plurality of small segments, and then connect and to obtain the very long fragment of sequence.At present, can be fully obtain the dna sequence dna of promotor of the present invention (or its fragment, or derivatives thereof) by chemosynthesis.This promoter sequence can be introduced in various existing dna moleculars as known in the art (or as carrier) and the cell then.The method of application round pcr DNA amplification/RNA (Saiki, etal.Science 1985; 230:1350-1354) be optimized for acquisition promotor of the present invention.
The present invention also relates to comprise the construction or the carrier of promotor of the present invention, and transform or the host cell of transfection with described construction or carrier, and the method that produces foreign protein or functional nucleic acid through recombinant technology.
" external source " gene is meant to be operably connected and is subjected to the polynucleotide of any gene, gene segment or the certain function of tool of promoter regulation of the present invention with promotor of the present invention and its transcript and expression.
" purpose " gene is meant experimenter or conscious gene or the gene segment that is incorporated in certain carrier of the producer, thereby its objective is in order to express this gene in host or host cell and study the biological function of this gene or obtain this gene product with practical value.
Be applicable to that foreign gene of the present invention is not particularly limited, nearly all functional gene, functional gene segment or polynucleotide all can be used for the present invention.Because transgenation causes certain albumen to express deficiency period or do not express the inherited disease that is caused the embryo, can from normal cell, separate and obtain related gene, then it is linked to each other with promoter element of the present invention, formation contains the construction of foreign gene, then described construction is used for gene therapy.
A kind of example of construction is exactly the foreign gene that links to each other with the P2 promotor.Promotor generally should be positioned at the upstream of foreign gene.
Among the present invention, the nucleotide sequence that contains the P2 promotor can preferably be inserted into carrier, for example in the expression vector.Term " carrier " refers to that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carriers.The carrier of Shi Yonging includes but not limited in the present invention: expression vector, cloning vector for example are applicable to the carrier in protokaryon (as bacteriums such as intestinal bacteria), eukaryotic cell (as yeast), insect cell, vegetable cell, the mammalian cell such as low.In a word, as long as can duplicate in host and stablize, any plasmid and carrier can be used.In expression vector, except containing replication orgin, P2 promotor, also can contain marker gene and other translation controlling elementss.
Method well-known to those having ordinary skill in the art can be used to make up and contains P2 promotor and suitable transcribing/the translate expression vector of control signal.These methods comprise (Sambrook, et al.Molecular Cloning, a Laboratory Manual, ColdSpring Harbor Laboratory.New York, 1989) such as extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technologys of body.Described dna sequence dna can be connected with treating expressed exogenous gene effectively, and is synthetic to instruct described foreign gene mRNA.
In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance.
Comprise the carrier of above-mentioned suitable dna sequence dna and suitable promotor or control sequence, can be used for transforming or the transfection appropriate host cell, so that it can express exogenous protein or functional nucleic acid.
Host cell can be a prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, streptomyces; The bacterial cell of Salmonella typhimurium; Fungal cell such as yeast; Vegetable cell; The insect cell of fruit bat S2 or Sf9; The zooblast of CHO, COS, 293 cells or Bowes melanoma cells etc.
Can carry out with routine techniques well known to those skilled in the art with recombinant DNA conversion, transfection host cell.Conversion, the transfection method of some employings include, but are not limited to: coprecipitation of calcium phosphate method, conventional mechanical method such as microinjection, electroporation, liposome packing etc.
Recombinant DNA technology (Science, 1984 by routine; 224:1431), can utilize polynucleotide sequence of the present invention to express or produce foreign protein.In general following steps are arranged:
(1). with polynucleotide of the present invention (or varient), or transform or the transfection proper host cell with the recombinant expression vector that contains these polynucleotide;
(2). in suitable medium, nutrient solution, cultivate host cell;
(3). separation, protein purification from substratum, nutrient solution or cell.
Particularly, promotor of the present invention can be by introducing corresponding coding sequence host cell (directly introducing or contain by introducing the carrier of foreign gene encoding sequence), and under appropriate condition, cultivate to transform, the host cell of transfection to be to express foreign protein, separate then and be purified into foreign protein.
The extracellular can be expressed or be secreted into to foreign protein in the above methods in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.The example of these methods includes, but are not limited to: conventional renaturation handles, handle the combination of (salt analysis method), centrifugal, the broken bacterium of infiltration, super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods with protein precipitant.
The contriver adopts the method for RT-PCR (Reverse Transcription-Polymerase Chain Reaction) and 5 ' RACE (Rapid Amplification of cDNA Ends) to determine expression and the transcripton initiation site of mLRH-1 in the R1 ES cell strain.Utilize PCR to obtain the sequence (, seeing Fig. 6) of this transcription initiation site upstream 1.4kb with the P2 name.Whether have promoter activity by cell transfecting and reporter gene analysis verification P2, the result shows that P2 has very strong activity in R1 ES cell strain, and has only more weak activity in the adult cell strain.The embryo that mice embryonic is grown each period makes RT-PCR and detects and show that P2 is the promotor of regulation and control mLRH-1 at the fetal development early expression.The P2 promotor of this 1.4kb is lacked with cell transfecting experimental analysis determined that regulation and control mLRH-1 gene is in the necessary core promoter sequence of the early stage high expression level of fetal development (see figure 7).
Description of drawings
MLRH-1 agarose electrophoresis result in Fig. 1 .RT-PCR amplification R1 ES cell.
1 is dna molecular amount standard; 2 is Primer-a and the pairing of Primer-5r primer; 3 is Primer-1 and the pairing of Primer-5r primer; 2 and 3 template is the product of R1 ES cell total rna after ThermoScript II is handled; 4 is Primer-a and the pairing of Primer-5r primer; 5 is Primer-1 and the pairing of Primer-5r primer; 4 and 5 template is that R1 ES cell total rna is handled without ThermoScript II.
The method of Fig. 2 .5 ' RACE inverse PCR is determined 5 ' end of V2 isomer.
1 is dna molecular amount standard; 2 is 5 ' RACE inverse PCR result, and through order-checking, the band of macromolecule is the binary of the DNA of small molecular weight band representative.5 ' end of V2 isomer is positioned at the 6408A of mLRH-1 gene intron 1.
The cell transfecting of Fig. 3 .P2 promoter activity and reporter gene analysis.
Data are from the mean value of three different transfection experiments.The value of negative contrast pGL3basic is 1, and the reporter gene in other transfection experiment activates active activation multiple with negative relatively contrast and represents.
Fig. 4 .RT-PCR detects the mLRH-1 expression that mice embryonic is grown each period.
M is a dna molecular amount standard; 1-8 is that Primer-1 and Primer-5r pairing detect the V1 isomer; 9-16 is that Primer-a and Primer-5r pairing detect the V2 isomer; 17-24 is the HPRT contrast; 1,9,17 are respectively the water contrast; 2,10,18 are fetal development 5.5 days; 3,11,19 are fetal development 6.5 days; 4,12,20 are fetal development 7.5 days; 5,13,21 are fetal development 8.5 days; 6,14,22 are fetal development 9.5 days; 7,15,23 are fetal development 10.5 days; 8,16,24 are fetal development 11.5 days.
Fig. 5 regulates and control mLRH-1 gene determining at the necessary P2 core promoter of the early stage high expression level of fetal development.
P2 promotor construction difference transfection R1 ES cell strain and Y1 cell strain with different lengths.Data are from the mean value of at least three different transfection experiments.The value of negative contrast is 1, and the reporter gene activity in other transfection experiment is represented with the activation multiple of negative relatively contrast.
The complete sequence of Fig. 6 P2 (1419bp)
Fig. 7 regulates and control the mLRH-1 gene in the early stage high expression level of fetal development necessary P2 core promoter sequence (445bp)
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:ColdSpring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Embodiment 1: expression and the transcripton initiation site of determining mLRH-1 in the R1 ES cell strain
With known mLRH-1 cDNA (being called for short V1) retrieval EST (expressed sequence tag) database, find that an EST (GI:16486133) and V1 are terminal inequality 5 '.In this EST, first exon among the V1 is replaced by one section unknown nucleotide sequence.Further, find that this sequence is arranged in first intron of mLRH-1 gene with this unknown nucleotide sequence retrieval mouse genome database.Therefore, the product of this EST representative is the isomer (being called for short V2) of mLRH-1.According to the synthetic forward primer Primer-a (table 1) of V25 ' end sequence, with reverse primer Primer-5r (table 1) pairing in the 5th exon, cDNA after reverse transcription is a template with R1 ES cell total rna, can amplify the obvious band of 491bp, and according to the first exon sequence synthetic forward primer Primer-1 (table 1) that comprises in the V1 isomer, with the Primer-5r pairing, but can not obtain amplified production (Fig. 1).Show in the R1 ES cell only to have this new isomer V2, and do not have the V1 form.
5 ' terminal sequence design reverse primer Primer-br and Primer-cr (table 1) according to the V2 isomer, match respectively with forward primer Primer-2 that is positioned at second and third exon and Primer-3 (table 1), utilize 5 ' RACE inverse PCR and order-checking to determine 5 ' terminal (Fig. 2) of V2 isomer.
| Primer | Sequence | Direction |
| Primer-a | TCTAGGACTCTTCCCGGGCTTCAG | Forward |
| Primer-5r | AGTAGGGACATCGTTTTCTCTGCGT | Oppositely |
| Primer-1 | ATGTCTGCTAGTTTGGATACTGGA | Forward |
| Primer-br | GATACTACGTTCTGAAGCCCGGGA | Oppositely |
| Primer-cr | ACCACTCGAGCTGAAGCCCGGGAAGAGTC | Oppositely |
| Primer-2 | GCGTCTGCACCAGGGTCAG | Forward |
| Primer-3 | GCTGGGCTTCCGGACCGAC | Forward |
| Primer-d | TGTTTTGCCTGCTTGTCTGCCTG | Forward |
Table 1
Embodiment 2: the P2 sequence of amplification and clone's transcription initiation site upstream 1.4kb
5 ' end according to determined V2 isomer among the whole genome sequence of mLRH-1 and the embodiment 1, design forward primer Primer-d, with reverse primer Primer-cr pairing (table 1), genomic dna with mouse is a template, and amplification obtains the genome sequence of V2 isomer 5 ' the terminal about 1.6kb in upstream.Behind this sheet cracked ends KpnI and the XhoI enzymolysis, KpnI and XhoI site that the segment of about 1.4kb (being called for short P2) is inserted fluorescein reporter gene carrier pGL3basic (Promega) obtain plasmid pV2Pro1.4k.PV2Pro1.4k obtains the segment of about 325bp after the HindIII enzyme is cut, insert the HindIII site of pGL3basic, obtains plasmid pV2Pro0.3k.
The cell transfecting of embodiment 3:P2 promoter activity and reporter gene analysis
With pV2Pro1.4k, pV2Pro0.3k and negative contrast pGL3basic transfection R1 ES cell strain, the adrenal cells strain of Y1 mouse and the strain of Huh7 human liver cell respectively, hold the promoter activity of upstream sequence with the V2 isomer 5 ' of check different lengths.In Y1 and Huh7 cell, the reporter gene activity of pV2Pro1.4k and pV2Pro0.3k is close, with respect to the negative contrast 6-12 activation doubly of all having an appointment.And in R1 ES cell, the reporter gene activity of pV2Pro0.3k is with similar in Y1 and Huh7 cell, but pV2Pro1.4k has very strong reporter gene activity, with respect to have an appointment 150 times activation (Fig. 3) of negative contrast.The experimental result explanation, the P2 promotor has very strong activity in the mouse embryo stem cell as the early development external model, and in the adult cell strain, only having more weak activity relatively, it may be the promotor of regulation and control mLRH-1 gene at the fetal development early expression.
Embodiment 4:P2 is the promotor of regulation and control mLRH-1 gene at the fetal development early expression
The embryo that mice embryonic is grown each period makes RT-PCR and detects and show that only there is the isomer of V2 form in early days in fetal development, and the V1 isomer appears at fetal development 10.5 days (Fig. 4) the earliest.3 result shows that further the P2 promotor is the promotor of regulation and control mLRH-1 gene at the fetal development early expression in conjunction with the embodiments.
Embodiment 5: regulation and control mLRH-1 gene determining at the necessary P2 core promoter of the early stage high expression level of fetal development
At the necessary P2 core promoter of the early stage high expression level of fetal development, the P2 promotor of 1.4kb has been done 5 ' end deletion analysis in order to determine regulation and control mLRH-1 gene.P2 promotor construction difference transfection R1 ES cell strain and Y1 cell strain with different lengths, in the Y1 cell, the P2 disappearance construction activity of different lengths is very close, and in R1 ES cell, 0.7k and the activity of the P2 promotor of the P2 promotor of 0.4k and 1.4k is approaching, all apparently higher than the P2 promoter activity (Fig. 5) of 0.3k.Can determine to regulate and control the mLRH-1 gene thus is the sequence of 3 ' end 0.4k at the necessary P2 core promoter of the early stage high expression level of fetal development.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table
＜110〉Shanghai Inst. of Life Science, CAS
＜120〉promotor of regulation and control mouse orphan nuclear receptor and uses thereof
<130>031107
<160>9
<170>PatentIn version 3.1
<210>1
<211>1419
<212>DNA
＜213〉mouse
<220>
＜221〉promotor nucleus
<222>(975)..(1319)
<223>
<400>1
ggtacccatg ctcagggctg tcactactat aagccataag cctagggttc cacattgcct 60
ttttacagac agaggattca attaccttta caagagcatc gacattattg cctataagcc 120
aatcactgat ttacctgaag tgtaaggtaa tctcaaagta gagtctcttc tgagaaaggt 180
tctcagatct tagcagcgga atttttaaaa accttataag gacccggcag tggcagcata 240
cacctttaat cccagggctc tggtggcaga ggcaggtgga tctctgtaaa ttctaggcca 300
gcctggtcta cagagcaatc tctaggacag ccaaggctgc acagtgaaag caagaaaaga 360
aaaagaaaaa gacaccccgc ccccacacac agaagaagtc ttagctcaat tacttctcat 420
tgaagtttag ccctaaagga ccatttctag cctagattaa aaccaggtgg gtttatagag 480
gagagagata ttaggtgttg cctagtttgt tttaccacag acctcttggc caactggctc 540
ctggactgtc ttgggcctgt cagtgctttg tggtgtttgg tctggtctac taagcccagg 600
taactttcca actccgaggc tttgtagacc agatctcctt tgaagatccc aggctcccaa 660
ggcagggcga gcttgaactc ggtattgaag aaagttccca atgatgtaat tttaaagata 720
aagagcctta aattccaaaa acagaggtcc aaaactccct cctttctttc agggtgaggg 780
tggaggactc cagcagtata gagagggaag tggggattgc cctggcatat tttccccagg 840
cataaagccc aggatggggt atttattagg acactctttt agggtattga aaatctgcag 900
gtttgcccca attcgggatt ggcagcccgc cctctcacgg aagcggagga tgtccccacc 960
cccaccccct gcagctgcct acagtgctta tttgaaacaa tcaatacaaa gagaattttt 1020
tttaagtttt tttttttttt tttttttttt aaccagggaa gatcactggc tttaagttcg 1080
tgttttgttt tgcaaagctt ggtctacaag gtgcgctgaa gttttgtctt tagaaaccgg 1140
gctgttcttt ttaaaacaaa gcgctccggg tgagggcgtg gagcccagga aggaggtggg 1200
ggggagggcc agaacccacc cagtaggcaa aacgcattat tggctcaact gagttttgca 1260
gcttcacctg atggaatgtt caagtgggag gggtggaaaa attagggaag tcagagcttc 1320
agagttgata aattcgtttc tcttttccct tgggctgtca cttcccttca ggggaagaat 1380
actttaaaac agagatctag gactcttccc gggcttcag 1419
<210>2
<211>24
<212>DNA
＜213〉synthetic
<220>
<221>misc_feature
<222>(1)..(24)
＜223〉primer-a
<400>2
tctaggactc ttcccgggct tcag 24
<210>3
<211>25
<212>DNA
＜213〉synthetic
<220>
<221>misc_feature
<222>(1)..(25)
＜223〉primer-5r
<400>3
agtagggaca tcgttttctc tgcgt 25
<210>4
<211>24
<212>DNA
＜213〉synthetic
<220>
<221>misc_feature
<222>(1)..(24)
＜223〉primer-1
<400>4
atgtctgcta gtttggatac tgga 24
<210>5
<211>24
<212>DNA
＜213〉synthetic
<220>
<221>misc_feature
<222>(1)..(24)
＜223〉primer-br
<400>5
gatactacgt tctgaagccc ggga 24
<210>6
<211>29
<212>DNA
＜213〉synthetic
<220>
<221>misc_feature
<222>(1)..(29)
＜223〉primer-cr
<400>6
accactcgag ctgaagcccg ggaagagtc 29
<210>7
<211>19
<212>DNA
＜213〉synthetic
<220>
<221>misc_feature
<222>(1)..(19)
＜223〉primer-2
<400>7
<210>8
<211>19
<212>DNA
＜213〉synthetic
<220>
<221>misc_feature
<222>(1)..(19)
＜223〉primer-3
<400>8
gctgggcttc cggaccgac 19
<210>9
<211>23
<212>DNA
＜213〉synthetic
<220>
<221>misc_feature
<222>(1)..(23)
＜223〉primer-d
<400>9
tgttttgcct gcttgtctgc ctg 23
Claims (10)
1. a promotor is characterized in that, it comprises and is selected from following nucleotide sequence:
1) 975-1419 position Nucleotide among the SEQ ID NO:1;
2) 1-1419 position Nucleotide among the SEQ ID NO:1.
2. promotor as claimed in claim 1 is characterized in that, has to be selected from following nucleotide sequence:
1) 975-1419 position Nucleotide among the SEQ ID NO:1;
2) 1-1419 position Nucleotide among the SEQ ID NO:1.
3. a construction that is used for regulating and control foreign gene at the embryo development procedure high expression level is characterized in that, described construction contains foreign gene and this foreign gene is operably connected to the described promotor of claim 1.
4. the described construction of claim 3 is characterized in that, described promotor is to comprise being selected from following nucleotide sequence:
1) 975-1419 position Nucleotide among the SEQ ID NO:1;
2) 1-1419 position Nucleotide among the SEQ ID NO:1.
5. carrier that contains claim 1 or 2 described nucleotide sequences.
6. a host or host cell that contains the described carrier of claim 5.
7. claim 1 or 2 application of described promotor in transgenic animal.
8. claim 1 or 2 described promotor selectivity are regulated the application of foreign gene at the early stage high expression level of fetal development.
9. the method for a high expression level foreign gene in embryo development procedure, it may further comprise the steps:
1) provides a construction, the described promotor of claim 1 that described construction contains foreign gene and is operably connected with this foreign gene;
2) with the construction transfection in the step 1) or conversion host or host cell, make its expression alien gene.
10. the described promotor of claim 9 is to comprise being selected from following nucleotide sequence:
1) 975-1419 position Nucleotide among the SEQ ID NO:1;
2) 1-1419 position Nucleotide among the SEQ ID NO:1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200310108631 CN1266273C (en) | 2003-11-14 | 2003-11-14 | Promoter for regulating and controlling mouse orphan nucleus recepter and its use |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200310108631 CN1266273C (en) | 2003-11-14 | 2003-11-14 | Promoter for regulating and controlling mouse orphan nucleus recepter and its use |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1616660A CN1616660A (en) | 2005-05-18 |
| CN1266273C true CN1266273C (en) | 2006-07-26 |
Family
ID=34758652
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200310108631 Expired - Fee Related CN1266273C (en) | 2003-11-14 | 2003-11-14 | Promoter for regulating and controlling mouse orphan nucleus recepter and its use |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1266273C (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114426573B (en) * | 2020-10-29 | 2022-11-01 | 南京鼓楼医院 | Nur77 phosphorylation derivative peptide and application thereof in preparation of drug for promoting embryo implantation |
-
2003
- 2003-11-14 CN CN 200310108631 patent/CN1266273C/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN1616660A (en) | 2005-05-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1458973A (en) | Pre-adipose cell lines | |
| CN1923850A (en) | Control gene of paddy leaf shape and application thereof | |
| CN1248286A (en) | Transgenic animal with recombinant vascular endothelial growth factor B (VEGF-B) DNA and uses thereof | |
| CN1306043C (en) | Reagent and method for detecting leucocythemia susceptibility | |
| CN1769457A (en) | Butterfly orchid pPI15 encoding sequence and its uses | |
| CN1266273C (en) | Promoter for regulating and controlling mouse orphan nucleus recepter and its use | |
| CN100347298C (en) | Clone of fish muscle growth inhibit or MSTN gene, and establishment of said gene targeting carrier | |
| CN101074428A (en) | Method for improving embryonic stem cell to differentiate to cardiac muscle cell | |
| CN1295340C (en) | Method for extablishing polymorphism adenoid tumour mouse model | |
| CN1211486C (en) | A DNA molecule encoding mutant prepro-neuropeptide Y, a mutant signal peptide, and uses thereof | |
| CN1247612C (en) | 0sGLR1 gene of paddy and application | |
| CN1568374A (en) | Method for identifying compounds modulating reverse cholesterol transport | |
| CN1873005A (en) | Conjugated protein Tau of microtubule of earthworm, its coding gene, and application | |
| CN1478149A (en) | Method of screening physiologically active substance | |
| CN1203181C (en) | Mouse entactin gene promoter and its tissue-specific enhancer | |
| CN100335137C (en) | Use of human homology cassette gene LHX4 in preparing medicine for treating phaeochromocytoma | |
| CN1795929A (en) | Method for generating model of chmice in male sterile | |
| CN101054583A (en) | Gene sequence of penaeus monodon cell periodic protein B | |
| CN101063131A (en) | Lateolabrax agglutinin gene order | |
| CN1219062C (en) | Mouse cholesterol ester synthetase-2 gene promotor | |
| CN1604967A (en) | Isolation tool for viable c-kit expressing cells | |
| CN1208462C (en) | Human zinc finger protein family new gene ZNF325 | |
| CN1205225C (en) | Human protein with cancer inhibiting function and its coding sequence | |
| CN1208461C (en) | New gene SNX21 of human SNX family | |
| CN1566344A (en) | cDNA sequence of gene GhRLK1 expressed specifically in cotton fibre and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20060726 Termination date: 20111114 |