A kind of method of setting up the pleomorphic adenoma mouse model
Technical field
The present invention relates to field of transgenic technology.More specifically, relate to a kind of pleomorphic adenoma mouse model, set up the method for this pleomorphic adenoma mouse model, and the purposes of this pleomorphic adenoma mouse model.
Background technology
Pleomorphic adenoma (pleomorphic adenoma) is the modal salivary gland tumor of Oral and Maxillofacial Surgery, good sending out in the parotid gland and palatine gland, the boundary is a typical critical knurl (border-linetumor) between innocent and malignant tumour, accounts for 53.9% of whole salivary gland tumor.Pleomorphic adenoma has another name called mixed tumor (mixed tumor), has diversity aspect the histopathology form, can contain tumour epithelium sample tissue, pseudocartilage tissue and mucoid tissue etc.
A large amount of cytogenetical studies is found, is often occurred abnormal karyotype in the pleomorphic adenoma.According to statistics, the normal pleomorphic adenoma of karyotype only accounts for 30% of sum, and all the other 70% are abnormal karyotype, and the wherein modal 8q12 of being resets in the district.
1997, Kas K etc. were from t (3; 8) (p21; Q12) transcript of having cloned a new about 7.5Kb in the pleomorphic adenoma tissue of chromosome abnormalty, and called after pleomorphic adenoma gene 1 (pleomorphicadenoma gene 1, PLAG1).PLAG1 is positioned at human chromosome 8q12, and cDNA (Gene Bank is numbered U65002) total length is 7313bp, comprises 5 exons, and encoder block is 1503bp altogether, and its expression product is a zinc finger protein, contains seven C2H2 zinc fingerses.
Modal t (3 in the pleomorphic adenoma; 8) (p21; Q12) chromosome translocation is involved PLAG1 and is positioned at the plain (gene of β-catenin) of No. 3 chromosomal β-be connected.Because chromosome translocation causes the regulating and controlling sequence of two genes to exchange (promoter swapping) mutually, makes the PLAG1 gene activation; And t (5; 8) high expression level of PLAG1 gene then is and is positioned at the result that No. 5 chromosomal leukaemia inhibitory factor acceptor (LIFR) gene generation promotor is exchanged in the pleomorphic adenoma of chromosome translocation.In the normal pleomorphic adenoma of some caryogram, PLAG1 and β-be connected are plain, transcriptional elongation factor SII gene takes place by recessive the rearrangement, cause PLAG1 to express and raise.In addition, in not detecting the unusual and recessive pleomorphic adenoma of resetting of karyotype, the also unconventionality expression of ubiquity PLAG1.This prompting PLAG1 expression of gene activates and takes place closely related with pleomorphic adenoma.PLAG1 has also proved the effect of PLAG1 in tumour takes place at the high expression level of Lipoblastoma.
Though research hint PLAG1 is a kind of potential oncogene, yet the relation of the biological function of PLAG1 and high expression level thereof and pleomorphic adenoma morbidity still lacks direct evidence, does not also have the research report of whole animal level.In addition,, also do not have suitable pleomorphic adenoma animal model at present, give research, treatment, the drug screening of pleomorphic adenoma and prevent that research such as postoperative recurrence from bringing inconvenience because the Molecular Study that pleomorphic adenoma takes place relatively lags behind.
Therefore, this area presses for exploitation pleomorphic adenoma animal model.
Summary of the invention
The method that purpose of the present invention just provides a kind of pleomorphic adenoma mouse model and sets up this pleomorphic adenoma mouse model.
Another object of the present invention provides the purposes of this pleomorphic adenoma mouse model.
In a first aspect of the present invention, a kind of method that produces pleomorphic adenoma non-human mammal model is provided, comprise step:
(i) provide a linearizing transgenosis construct, this construction from 5 ' to 3 ' contains (a) promotor successively, (b) the PLAG1 encoding sequence that links to each other with the promotor operability, (c) terminator codon, and also contain the homologous region that carries out homologous recombination in the upstream and the codon downstream of promotor;
(ii) the linearizing construction gene in the step (i) is introduced non-human mammal zygote with microinjection technique;
(iii) with the uterine tube of step zygote transplation (ii) to the non-human mammal of false pregnancy;
(iv) produce genetically modified non-human mammal, be integrated with the FLAG1 expression cassette in the genome of described non-human mammal, described expression cassette contains (a) promotor, (b) the PLAG1 encoding sequence that links to each other with the promotor operability, (c) terminator codon.
In another preference, described method also comprises step: (v) the transgenic animal that step is (iv) obtained are identified.
In another preference, described evaluation is by PCR and Southern hybrid method.
In another preference, described method also comprises step:
(vii) with the transgene mammal and normal Mammals hybridization that obtain, to obtain filial generation.
In another preference, described non-human mammal is mouse, rat, rabbit, monkey.
In another preference, described evaluation is the tissue of transgenic animal to be hybridized with RT-PCR and Northern carry out expression pattern analysis.
In another preference, described PLAG1 is people's PLAG1.
In a second aspect of the present invention, passed through the pleomorphic adenoma non-human mammal model that obtains with aforesaid method.
In a third aspect of the present invention, a kind of purposes of using the pleomorphic adenoma non-human mammal model of aforesaid method acquisition of the present invention is provided, it is used to screen the medicine of treatment pleomorphic adenoma.
Description of drawings
Fig. 1 has shown MMTV-PLAG1 transgenic positive mouse has been identified.
A:PCR identifies 1: transgenic positive 1.1K and 610bp band occur or the 610bp band only occurs, and wild-type or negative mouse can amplify the 1.1K band.
B:PCR identifies 2: the 660bp band appears in transgenic positive, and wild-type or negative mouse do not have special band amplification.
C: transgenic mice southern blot identifies (genomic dna is cut with the BamHI enzyme), and 1.9K expection band appears in positive mouse.With the positive contrast of plasmid DNA.
Swimming lane M is the molecular weight marker thing, and swimming lane 9,41 etc. is the numbering of each transgenic mice, and Wt is a wild-type mice.
Fig. 2 has shown transgenic mice sialisterium PLAG1 gene expression analysis (Northern blot).
Fig. 3 has shown the transgenic mice that pleomorphic adenoma takes place.
Embodiment
Extensive studies in the MMTV expression vector, has obtained transgenic mice through microinjection with people PLAG1 gene clone to the inventor through going deep into, thereby has set up the stable pleomorphic adenoma animal model of phenotype first.Spontaneous salivary gland tumor has taken place in transgenic mice, and pathologic finding shows that tumour meets the main pathological characters of people's pleomorphic adenoma.Finished the present invention on this basis.
Can be used for PLAG1 of the present invention and be not particularly limited, can be people, mouse, rat, pig or other mammiferous PLAG1.Can be wild-type PLAG1, also can be mutant PLAG1.A kind of particularly preferred PLAG1 sequence is the sequence that GenBank is numbered U65002, and its total length is 7313bp (SEQID NO:1), comprises 5 exons, and encoder block is 1503bp altogether, and its expression product is a zinc finger protein, contains seven C2H2 zinc fingerses.
Can be used for promotor of the present invention and be not particularly limited, representational example comprises (but being not limited to): MMTV LTR promotor, CMV promotor, salivin gene promoter etc.
In the method for generation transgenic animal of the present invention, at first make up a construction, this construction from 5 ' to 3 ' contains (a) promotor successively, (b) the PLAG1 encoding sequence that links to each other with the promotor operability, (c) terminator codon.In addition, also contain the homologous region that carries out homologous recombination in the upstream and the codon downstream of promotor.
After having obtained construction, available ordinary method changes linearizing construction in the zygote over to.Treat mouse birth back identifies with methods such as PCR detection, Southern blottings whether PLAG1 is integrated into its genome, thereby obtain transgenic mice.
The main application of pleomorphic adenoma non-human mammal model of the present invention comprises: the Prevention Research of pleomorphic adenoma, the operation of pleomorphic adenoma and study medication, the Prevention Research of pleomorphic adenoma postoperative recurrence, pleomorphic adenoma Study on Pathogenesis etc.A kind of specific purposes is the medicine of screening treatment pleomorphic adenoma, is about to drug candidate and is applied to animal pattern of the present invention, and observe the size variation of pleomorphic adenoma, thereby determine effective medicine.
Major advantage of the present invention is:
(a) be that first meets the sialoma animal model of people's pleomorphic adenoma pathological characters and molecular mechanism thereof in the world.
(b) transgenosis can Mendelian's rule genetic stability.A plurality of different onset rates, the transgenic mice of different onset time system are arranged, can select for use according to research purpose.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, people such as Sambrook for example, molecular cloning: laboratory manual (NewYork:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Embodiment 1
The structure of MMTV-PLAG1 plasmid
Use following primer, primer PLAG381:5 '-TTACGACCACATGAAACTTGAG-3 ' (SEQ ID NO:2), primer PLAG2003:5 '-TGAATCCATGTCCCAGAATCCT-3 ' (SEQ ID NO:3), is template with total RNA in people's sialoma or the placenta sample through the cDNA that reverse transcription obtains, and obtains people's PLAG1 gene by the RT-PCR method of routine.Directly be cloned into pGEM-Teasy carrier (Promega) then, obtain plasmid pGEMT-PLAG1.
MMTV-EGFR-stop (Xie W, Paterson AJ, Chin E, et al.Targetedexpression of a dominant negative epidermal growth factor receptor inthe mammary gland of transgenic mice inhibits pubertal mammary ductdevelopment.Mol Endocrinol.1997; 11 (12): 1766-81) contain MMTV LTR promotor.MMTV-EGFR-stop is cut with the EcoRI enzyme, excise wherein EGFR gene, use CIAP (ox pancreas alkaline phosphatase) dephosphorylation after the recovery carrier segments; Cut pGEMT-PLAG1 with the EcoRI enzyme, reclaim the PLAG1 gene fragment; Connect two fragments with ligase enzyme, form plasmid MMTV-PLAG1, wherein, the PLAG1 gene is positioned at MMTV LTR downstream.
Embodiment 2:
PLAG1 introduces the generation of mouse fertilized egg and transgenic positive mouse through microinjection
After transgenosis plasmid MMTV-PLAG1 uses the XhoI linearizing, reclaim the fragment (4.3kb) that contains MMTV LTR and PLAG1 gene.Linearizing DNA (about 500 copies) is injected in the male pronucleus of mouse fertilized egg, and the zygote transplation after the injection is given the false pregnancy mouse.After about 20 days, the mouse birth.
Mouse was born after 3 weeks, cut tail and extracted DNA, and whether analyze has transgenosis to integrate: after overlapping the PCR reaction detection with two, primer is as shown in table 1.The betaglobulin gene that contains with the MMTV-PLAG1 plasmid is that probe is done the affirmation of Southern blotting.
Table 1
Numbering | Sequence (5 '-3 ') | SEQ ID NO: |
1 | GenBank numbering: U65002 | 1 |
2 | TTACGACCACATGAAACTTGAG | 2 |
3 | TGAATCCATGTCCCAGAATCCT | 3 |
Fig. 1 has shown MMTV-PLAG1 transgenic positive mouse has been identified.A:PCR identifies 1: transgenic positive 1.1K and 610bp band occur or the 610bp band only occurs, and wild-type or negative mouse can amplify the 1.1K band.B:PCR identifies 2: the 660bp band appears in transgenic positive, and wild-type or negative mouse do not have special band amplification.C: transgenic mice southern blot identifies (genomic dna is cut with the BamHI enzyme), and 1.9K expection band appears in positive mouse.With the positive contrast of plasmid DNA.
As a result, obtain 9 of transgenic positive mouse altogether, these mouse breed to build through mating and are, build together and have found 6 transgenic mice systems.
Embodiment 3
The expression of transgenosis in mouse sialisterium
Whether express in the mouse body in order to detect MMTV LTR/PLAG1 fusion gene, extract the total RNA of mouse sialisterium according to a conventional method with Trizol reagent.Being transferred to nitrocellulose filter after getting 20mg RNA electrophoresis, is that probe carries out Northern blot hybridization with the PLAG1 gene fragment.
Found that therein and have PLAG1 transgenosis high level expression (Fig. 2) in 5 transgenic mice systems.
Embodiment 4
The spontaneous pleomorphic adenoma of transgenic mice
In 6 transgenic mice systems 3 transgenic mices are arranged is salivary gland tumor to occur spontaneously, and through pathologic finding, tumor tissues contains glandular epithelium sample tissue, pseudocartilage sample tissue, mucoid tissue and myoepithelical cell etc.; Similar arrangement mode in the normal appearance of various tissues and the people's pleomorphic adenoma.Tumour has the main pathological characters (Fig. 3) of people's pleomorphic adenoma.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table
<110〉Shanghai Nanfangmoshi Biological Sci-Tech Dev Co., Ltd.
Shanghai Second Emdical University of Shanghai life science institute of Chinese Academy of Sciences health science center
Shanghai Second Emdical University
No.9 People's Hospital Attached to Shanghai No.2 Medical Univ
<120〉a kind of method of setting up the pleomorphic adenoma mouse model
<130>033705
<160>3
<170>PatentIn version 3.1
<210>1
<211>7313
<212>DNA
<213〉homo sapiens (Homo sapiens)
<400>1
ggcagcgcat acactacaat ggctgctgga aagaggcgta aggaaacaat ttccaggccc 60
gccgcgtcca gcccgaaata tgagaaaaaa attattagaa attccgcggg cggtgtagag 120
gcggcggacg ggccggaggg aggatgttaa agccccgcgg ttgcctcttg gtgctgcctt 180
ggccgtattt ggcacccaga atgcttcatt ctgtgacggt ctattaataa ggttgccttg 240
ctagagtttg gagcagggcc tcagattggc caaaatggga aggattggat tccactctct 300
tccacgaaga gtcaatggga ctggctaaga tcaaagtctg aggctttttc catcagtaat 360
cagtcccttt ttgctttctt ttacgaccac atgaaacttg agaagccacc taaagctata 420
tcatttagtg gagttgggca gttcccaagt gtccaacaag aaggcctggt ttaggctgcg 480
atggccactg tcattcctgg tgatttgtca gaagtaagag atacccagaa agtcccttca 540
gggaaacgta agcgtggtga aaccaaacca agaaaaaact ttccttgcca actgtgtgac 600
aaggccttta acagtgttga gaaattaaag gttcactcct actctcacac aggagagagg 660
ccctacaagt gcatacaaca agactgcacc aaggcctttg tttctaagta caaattacaa 720
aggcacatgg ctactcattc tcctgagaaa acccacaagt gtaattattg tgagaaaatg 780
tttcaccgga aagatcatct gaagaatcac ctccatacac acgaccctaa caaagagacg 840
tttaagtgcg aagaatgtgg caagaactac aataccaagc ttggatttaa acgtcacttg 900
gccttgcatg ccgcaacaag tggtgacctc acctgtaagg tatgtttgca aacttttgaa 960
agcacgggag tgcttctgga gcaccttaaa tctcatgcag gcaagtcgtc tggtggggtt 1020
aaagaaaaaa agcaccagtg cgaacattgt gatcgccggt tctacacccg aaaggatgtc 1080
cggagacaca tggtggtgca cactggaaga aaggacttcc tctgtcagta ttgtgcacag 1140
agatttgggc gaaaggatca cctgactcga catatgaaga agagtcacaa tcaagagctt 1200
ctgaaggtca aaacagaacc agtggatttc cttgacccat ttacctgcaa tgtgtctgtg 1260
cctataaaag acgagctcct tccggtgatg tccttacctt ccagtgaact gttatcaaag 1320
ccattcacaa acactttgca gttaaacctc tacaacactc catttcagtc catgcagagc 1380
tcgggatctg cccaccaaat gatcacaact ttacctttgg gaatgacatg cccaatagat 1440
atggacactg ttcatccctc tcaccacctt tctttcaaat atccgttcag ttctacctca 1500
tatgcaattt ctattcctga aaaagaacag ccattaaagg gggaaattga gagttacctg 1560
atggagttac aaggtggcgt gccctcttca tcccaagatt ctcaagcatc gtcatcatct 1620
aagctagggt tggatcctca gattgggtcc ctagatgatg gtgcaggaga cctctcccta 1680
tccaaaagct ctatctccat cagtgacccc ctaaacacac cagcattgga tttttctcag 1740
ttgtttaatt tcataccttt aaatggtcct ccctataatc ctctatcagt ggggagcctt 1800
ggaatgagct attcccagga agaagcacat tcttctgttt cccagctccc cacacaaaca 1860
caggatcttc aggatcctgc aaacactata gggcttgggt ctctgcactc actgtcagca 1920
gctttcacca gcagtttaag cacaagtacc accctcccac gtttccatca agcttttcag 1980
taggattctg ggacatggat tcattacaga aatgtatgtg tagctgtgcc ctagatgacc 2040
atttttattt tagtgcctac tttaaaacag tataaaaatt tctgcttttg tataatacaa 2100
attttcatta agccagtata aaatagaaac tagcttttaa actgagcttt ggaaccattt 2160
gtgttcagtt aagtttacct gggtattttg tcctgattca ctgccaattg tcacatttta 2220
agactttttt tttttccata taggaaagcc attattagta gtaaactttt acaaatccca 2280
ttttcaaatt acttttagat cttaaaattt tcatttttgt ctaataacag tggctctacc 2340
ttttgacatc tggctcatta aaaaatttag caatagaatg taaattgtat aaaaagtttg 2400
tgaataactc aagggtttaa attttcttac tagcttctaa atggattaat aatcaagtgc 2460
ttcaaatgaa ttaagagtcc agtttcggaa gataataaat gtttgttaga tacaccataa 2520
tttcagatca gtatattctg aagactctct gttgtctggc taaaatattt gccatcttta 2580
ttatgagcct ttaaggaaaa caaaccctaa acacaaagca tcagtattta tagcaaaaag 2640
agactctgtt aggtgacatg gcatttcgtg tcacttaata gttggcccta aattagtaca 2700
caggatattt tgtcgtgttt catccttctt aacatgctat cttttcattt aataatagta 2760
atagtgtatg gcattggggt cttcagagtc gatatatagg tagatctctt tagtcttttc 2820
cacctttcac atccaagggg tgggtcaagt gcagccagca atttattttc attgttggcc 2880
cacggttagt ccataatcta gagccattgt ggaactgcag ccatgaggtg tgtttatccc 2940
acagtggatt gactcagcct ctgtgggtga cagacttcta agcaggaaga tagacgtgaa 3000
gcacatggtt acatttggga acttgtgtag ggatcatggc ccctgtagcc agggttaaaa 3060
actggacttt ttagaagtaa agtaaaagca tagcgcttat atcatttctt gctgaatttg 3120
atatgttttt ctttccctta agaatcaaaa gcagaaaaca aaaacaacag tcctactccg 3180
atgttatctt tctgattcaa tgtgaatcca tctttccttg caatattttg gatggagaat 3240
ttgaagttaa atgcattaga aaactacctg atgaactacc acaaagtttt aagtgactag 3300
aaatatatac agtaaaatcc cactttcatg catctctggg aaatgatagg agtattgcaa 3360
ataagttgag tttgtagagg gtaacaaagt aaagtaaaac aaacctatct tggttaacat 3420
gaaaataaca attgagaata tattatattc actgaataat tataggcttt tcctcacatt 3480
agacaaccaa cataatcttc ttaaaggtct aattaatata tttttctaag ggtcagttgg 3540
gacattaacc taagaaacat atctattaag cacttgttaa caccttattt taggaccctt 3600
tccgttgggg atgggggcaa gggtgggagg tttttagaag agtatatatc tctttaaaaa 3660
aaaacagaaa gaaaaatatt tctgagcact cattagccct atatggaaac ttctttcctt 3720
tttgtagggc cagttatcac tgcagattgc aatgtttacc aagaatttct aaaaatgagt 3780
gcagattact gaatataata cattatttaa aatatttggg agtagtataa tttgttgaga 3840
aatgtaaatt gtaataatgt aaatgggggg cttcaatata tatatataat acacacacac 3900
acacacatgc acacataccg cacttcatag aatcaaagtt gctctctgaa ggagctttgg 3960
ctcctgatat tttatcatgc tcctatattt ttttaatcct tggagcagta gtttttatac 4020
ttatgtattt aaattttatt atgaaaaatt acatttatta aaaaagtgtg ttccaaaggc 4080
attaaaatta tatatgttaa taaggaagta catttttaaa tttttcaaac tgctcctagc 4140
ttttgattag gagaatattt tttctgaaag taggcttttc gctctgcttc attactgctt 4200
cctttagttt ctatgaaaca gattgcttac ctaaatcttt agttgaatga ttagtgttca 4260
atattgcttt aatcaccata taaaaggaaa aaaattggtg acagagcaca aatagaaaac 4320
ctatttttaa atagaaatca caaatagcaa gtgtggaagc actactttat tctgtttaaa 4380
atgtacttaa gaagtcatca aattagtgaa ctgagacatt ggccttagta ggctgtattc 4440
actgctaatt taaaaaaggg agtaccagga tttattaagt aaagcatttt ggaaatgggg 4500
aatagcgcca tatatgtatg tatgtgtatg tgtgtgtgtg gtgtgtgtat atatacacac 4560
acacatacat acttaaatct tgccctgcat gaaattcaaa tacatggagg cacatcttca 4620
gggcaccagt gttaaaattt tggagtctta attttcatgt gtacacctct ttgcctgttc 4680
ccacccccag acttgaaata acacttcaga gtaagaggga attcagctaa tttgttttta 4740
aaattgactg tagtggtcac taaacccttt ttgagagaat ttctattaaa gatgaggcag 4800
actcgcttat ttgaattgca caatgttcta acaaggatgt aacacagaat tggctttttt 4860
ttccctagaa aaagattgtt tgtttctatg tcaactagat atgattaaaa ataagtattg 4920
ccaatgctgt tttcattctc tagtggccag aatcattatc cttgaaattt ctggtagtgc 4980
cttagcttgg ttaaaaaaaa aaaaaaaaaa aaaaaaaaag ggattaacat taaataaaag 5040
tagtttagaa tttgggcctc agacaagata ttgaacctca ttcagtttca cttccacatg 5100
tatgtacaag ttaggtcacc aaacacggaa gttgagtgtg gaaggatctt ggcactgtaa 5160
gcaatgctat ccattgatgt atacaagtac ctttatagtt atcgatcact gttaaaactt 5220
tcattttaaa atcctattac caagttcagt tttttaaaac ttcaattgtc ctggctgatt 5280
atgcatcact ctgtgtgcaa cttttttatt tcatttagtg tttctttcaa gctgtgtatt 5340
tttgcctatt tgttgcttgt gctttatttt tcttagtcat ttgtggaata tagtgatata 5400
ttgtgttaat ttggacagta gcggttttta aaaaccatat actgactgaa acatgagcca 5460
gagccgattg ctttattaag ctaataatga atgttaaaga gtacatattt tcaggatcgt 5520
tcatctagtg agcaatacac atattatagg ccaatatttt tttaaaaaat agagcttggt 5580
caacctctat actacacata ttacaagata tagcactttc aaaatgaatc taaaccttta 5640
cagaaacttt cttataggtt atgcctttta ttttaagact tattataatt caagtgccat 5700
tagatgatat atatgtaggc ctttgatata taatgctttg tgtacaaaaa tggtagatgg 5760
tattttaaac aggtacattt ttacagtgtt ttcttatcaa tttgctatat tgcacagaat 5820
cagtgtgtgt cttttcataa ggttttacaa tggtttattt ttttacaagg tttacgtgtc 5880
tcaaagcaca ctgtcttccc agtacgtaag ttaaaaaata ccagttcacc caagttgctt 5940
ctagcctact gagatccatg tgacattgga ggagatcttt taaatgttta gtattcgtca 6000
ttagcaatgg ctggctgtta gttctggtaa atgtgtgcct aagttgaatt tgtcttgttt 6060
ttctcacact gtgtcagcag ccatgtctac aacacagata agtctgttgt gatcacatag 6120
atctacataa gttgtgcagt tttgtgctaa aaacccatag ggagctcctt tgggatcata 6180
gaaaagaaga tcatgcaacc agcattggtg aaggcacact cagattgcac ttagggcctt 6240
tctatgatgt tgtcaaccct ctgaggatgg aaggcagtgt cttttgatgt tatctagcct 6300
agaaatgaca cagaactatt gctaatgtat aaaacacttc attatataag cttcagtggt 6360
acagatgaac cagaatgaat gtttatcttc tcagaaacac tccttcaata ttatattgga 6420
tcatgctgct aatgtaactt gggctacaac tcttcatggt gctacaaact tctctgtctc 6480
attcagtcgt atttttttat ccatagaaaa aggactacat taggtgtaaa agtgtacaat 6540
atatttttat actgtgactt aatttgtcat taacaaactt ttacaccacc acaatgtatt 6600
catgtgcact tgcaaaagga gatctcggac atgcaaatgt taccagaaca aacccagctt 6660
ttgtccacaa ggtgactgta actcagaatg gaaagtgggc tttataatag ggtgtggagt 6720
gaagaacatg ctgtatgtta ctaacagccc tttgaattta acaaaaactg ggaatccatt 6780
aggaaacgga ttgcatcata cctgaacata agctggactg ctgaaattgt atttttagct 6840
aatgaaaaag tgtttggact agtactctaa aaatgttcta atgataaagt tttgagtcaa 6900
aatagaaaag aaaaaaatct gcattccagg ccgaattttg tatattttta ttgcatttaa 6960
aattgctatt ctgtaatatt gggaaatcaa gtggcttatc atgtatatcg tgtacttaaa 7020
atgtattcac aaactactgt tgtatttgta taaaatatag acaaagatca tattttttgt 7080
gtgtgtataa gctctgtaaa atagcaatca cattatgaag ctgcagtgat actacatttt 7140
aaacattcac atccaaagaa gcagactatt tattgtccat ataccagatt taaaatatta 7200
atttgctgct aattaaataa tagtactgca gcttcttgtg gcctacagtg ttatgtttgc 7260
tgtaagaata agatatgtga attccacaaa atatatgaat aaaatctcgt gcc 7313
<210>2
<211>22
<212>DNA
<213〉artificial sequence
<220>
<221>misc_feature
<222>(1)..(22)
<223〉primer
<400>2
ttacgaccac atgaaacttg ag 22
<210>3
<211>22
<212>DNA
<213〉artificial sequence
<220>
<221>misc_feature
<222>(1)..(22)
<223〉primer
<400>3
tgaatccatg tcccagaatc ct 22