CN1306043C - Reagent and method for detecting leucocythemia susceptibility - Google Patents
Reagent and method for detecting leucocythemia susceptibility Download PDFInfo
- Publication number
- CN1306043C CN1306043C CN 200510084348 CN200510084348A CN1306043C CN 1306043 C CN1306043 C CN 1306043C CN 200510084348 CN200510084348 CN 200510084348 CN 200510084348 A CN200510084348 A CN 200510084348A CN 1306043 C CN1306043 C CN 1306043C
- Authority
- CN
- China
- Prior art keywords
- pdcd5
- gene
- susceptibility
- primer
- snps
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The present invention discloses a reagent box for detecting the susceptibility of leukemia, which comprises a specific primer and a restriction enzyme, wherein the specific primer is used for detecting the 154th SNPs and the 170th SNPs in a control region SEQ ID NO: 1 of a PDCD5 upstream gene 5', and the restriction enzyme is used for detecting the 154th SNPs site and the 171th SNPs site. By detecting the sites of two complete linkage disequilibrium functional single nucleotide polymorphism (SNP) in a PACD5 gene promoter region of a human body, the present invention predicts the susceptibility of the human body for leukemia.
Description
Technical field
The present invention relates to the test kit that a kind of disease detection is used, especially a kind of test kit that detects leucocythemia susceptibility, predict individuality to leukemic susceptibility by the unbalanced functional single nucleotide polymorphism of two complete linkages (SNP) site of detecting the human PDCD 5 gene promoter area, and further relate to the method that detects leucocythemia susceptibility.
Background technology
Apoptosis (programmed cell death) is a suicidal process of physiological cell, is all playing important effect aspect the injury in external the reaching of stable and multicellular organism defence of fetal development, biological internal milieu.The disorder of apoptotic process, may with the direct or indirect relation of having of numerous disease, as tumour, autoimmune disorder, neurodegeneration such as Alzheimer disease and local damage etc.The research of apoptosis associated molecule has important theoretical research meaning and practical value, at the medicine of apoptosis molecular designing in the clinical treatment of diseases such as tumour that are used for.
TFAR19 (TF-1 cell apoptosis-related gene 19) is a kind of new apoptosis regulation gene of recent findings, international man's genoid NK is with its called after PDCD5 (programmed celldeath 5), its encoded protein mainly is positioned in the cell, extensively distributes in the kind tissue surplus human 50.Found effect (the Chinese patent No:98101869.6 that PDCD5 albumen has promotion kinds of tumor cells (TF-1, MGC2803, HeLa etc.) apoptosis and suppresses to breed; Biochem Biophy Res Comm, 1999,254:203-210).
At present, existing both at home and abroad Duo Jia laboratory utilizes different technologies to find PDCD5 under the disease situation, and particularly the expression in tumour obviously descends.For example, Nanfang Research Centre, State Human Gene Group utilizes the difference expression gene of DNA chip technology research liver cancer, finds some gene participating in apoptosis such as PDCD5, and PDCD8, Bak, TRAF6 and TRAIL etc. express in liver cancer obviously and descend.Hedenfalk etc. utilize the DNA chip technology to analyze the gene expression profile of hereditary breast cancer tissue, find that PDCD5 expresses increase in the BRCA1-sudden change tumour, and PDCD5 expression decreased in the BRCA2-sudden change tumour.Feng wait quietly using FIGO that the immunohistochemical methods method detects the proteic expression of PDCD5 and epithelial ovarian cancer by stages, histological grade, histological type be relevant.Raise the proteic down-regulated expression of PDCD5 with histological grade with FIGO by stages.Song Qinghua etc. do the time spent at research PDCD5 in systemic lupus erythematous (SLE) morbidity, the expression amount of finding PDCD5 antibody in the serum of active SLE all is higher than stationary phase and normal population, and this may illustrate that the morbidity of PDCD5 and SLE and the state of an illness have confidential relation.Ruan Guorui etc. utilize 15 kinds of fluorescently-labeled monoclonal antibodies of difference, medullary cell is divided into different colonies, do not control adult's chronic myelogenous leukemia (CML) chronic phase patient by Flow cytometry, CML quickens the expression of PDCD5 in ^ acute transformation phase patient and the normal people's marrow distinct group cell.The PDCD5 developed by molecule was starkly lower than the normal people during the result showed in the total karyocyte of patient's CML marrow, the granulocyte.The unconventionality expression of PDCD5 may be played a role in the CML progression of disease.The new research PDCD5 that waits of journey love is when the expression rule that normally reaches in the osteoarthritic joint cartilage, discovery is the PDCD5 up-regulated in the osteoarthritis chondrocyte, and the nucleus inner accumulated appears, infer that it may participate in osteoarthritis apoptosis of chondrocyte process, plays a role in the morbidity of osteoarthritis.When Du Ying etc. concern between discussion PDCD5 and thyroid tumor, discovery PDCD5 does not almost see Table in the normal thyroid tissue cell and reaches, being strong positive in thyroid adenoma patient's adenoma cell expresses, the expression that then is negative in the patients with papillary thyroid carcinoma thyroid carcinoma cell, the dysequilibrium between prompting cell proliferation and the apoptosis has vital role in the thyroid carcinoma pathogenesis.Discovery PDCD5 such as Liu Chaohui are strong positive more in normal cervix and CIN I level tissue expresses, and reaches cervical cancer tissues and express lower more than CIN II level.On the whole, the expression of PDCD5 is downward trend with the progress of cervical lesions, but CIN I expresses more normally rising.Difference all has significance between the pathologies at different levels.This experimental result explanation, PDCD5 may be in the cervical cell regulation of apoptosis in having participated in cervical cancer and precancerous lesion generating process in varying degrees.Discovery psoriatic skins such as He Yanling decrease the interior proteic expression of PDCD5 of outgrowth face tissue cell obviously to be reduced, the average fluorescent strength and the positive rate of the short apoptosis molecule of epidermis monocell expressing PDCD5 significantly reduce than the normal people, and skin decreases histocyte expression PDCD5 and significantly is lower than the normal people.It is relevant with the downward modulation that short apoptosis molecule PDCD5 expresses to infer that the local skin of psoriatic decreases the hyper-proliferative of epidermic cell, closely related with the dysregulation of the apoptosis of epidermic cell and whole last atomization.
SNP (single nucleotide polymorphism), promptly the single nucleotide polymorphism mark is the dna polymorphism that a class causes based on single nucleotide variation, is called third generation genetic marker by hereditary educational circles.Mainly be meant the dna sequence polymorphism that causes by the variation on the genome nucleotide level, comprise conversion, the transversion of single base, and the insertion/disappearance of single base etc.It is a class polymorphism mark that the most extensively exists in the genome, accounts for about 90%.The variation of these genome sequences can cause the difference of phenotype between individuality and Different Individual to disease, particularly the susceptibility of complex disease and to the difference of environmental factors, drug reaction.SNP can be divided into two kinds of forms: a class is the functional variation of gene coding region (coding region), the another kind of single nucleotide alteration that is dispersed throughout the non-coding region (control region, intron and montage joining region etc.) of whole genome.The SNPs that wherein is positioned at upstream region of gene 5 ' control region may influence the gene transcription expression level because of it, and receives increasing concern.Aforementioned numerous result of study prompting, the unconventionality expression of PDCD5 and disease (as tumour, cardiovascular disorder, autoimmune disease, nervous system disorders etc.) are closely related.Therefore, the discovery of the functional SNPs of PDCD5 upstream region of gene 5 ' control region and analysis are had the tumour of helping and relate to the diagnosis of the unusual disease of apoptosis.
Summary of the invention
The present inventor has found that the mononucleotide polymorphism site SNP of PDCD5 upstream region of gene 5 ' control region is relevant to leukemic susceptibility with human body, thereby a kind of test kit that detects leucocythemia susceptibility is provided.
The inventor is by extensive and deep research, had been found that shown in the SEQ ID NO:1 of PDCD5 upstream region of gene 5 ' control region that 154 A → G and 170 G → A are the uneven SNPs of two complete linkages in the sequence, that is, the 154th bit base is converted to G by A and always is converted to A with the 170th bit base by G and takes place simultaneously.R among Fig. 1 represents the mononucleotide polymorphism site (SNP) of PDCD5 portion gene group SEQ ID NO:1, the SNP site (R) of being disclosed is between 120 to 180 of this gene, it represents base A/G polymorphism, and promptly this site both can be A, also can be G.
Based on these two SNP sites, can design the primer of suitable length, be used for predicting the chronic myelogenous leukemia susceptibility through pcr amplification.
Found that the inventor two SNPs of above-mentioned PDCD5 upstream region of gene 5 ' control region can be used to assess on the individual basis to leukemic susceptibility, provide a kind of test kit that detects leucocythemia susceptibility.
This test kit comprises: the Auele Specific Primer that detects among PDCD5 upstream region of gene 5 ' the control region SEQ ID NO:1 two SNPs of the 154th and the 170th; And the restriction enzyme that detects this SNPs site.
Primer in the test kit is to design at the SNPs site shown in the SEQ ID NO:1, amplifies the fragment that comprises SNP site (R) among the SEQ ID NO:1 specifically.The primer length of design is generally 18-20 Nucleotide.Preferably, described primer is selected from the table 1 one group.
Following table 1 has been enumerated some combinations of primer of the present invention, the product size that the melting temperature(Tm) of primer (Tm) and these combinations obtain.Those skilled in the art will appreciate that primer of the present invention is not limited to these primer of listing and combinations thereof.
Table 1
| SEQ ID NO： | Primer sequence and Tm | The product size | |
| Group 1 | 2 3 | Justice is arranged: CGGGGAATCGGGCCTCTGC (59 ℃) antisense: CAAGCTCCTCGTCCGCCATG (61 ℃) | 184bp |
| Group 2 | 4 8 | Justice is arranged: CTCCGGGCTGGATTGGTG (58 ℃) antisense: AAGCTCCTCGTCCGCCAT (57 ℃) | 135bp |
| Group 3 | 4 9 | Justice is arranged: CTCCGGGCTGGATTGGTG (58 ℃) antisense: CTCAAGCTCCTCGTCCGC (55 ℃) | 138bp |
| Group 4 | 5 10 | Justice is arranged: CTGGATTGGTGGCGCCTG (59 ℃) antisense: CAAGCTCCTCGTCCGCCAT (59 ℃) | 129bp |
| Group 5 | 5 11 | Justice is arranged: CTGGATTGGTGGCGCCTG (59 ℃) antisense: CCTCAAGCTCCTCGTCCG (55 ℃) | 132bp |
| Group 6 | 6 3 | Justice is arranged: GCTGGATTGGTGGCGCCTG (61 ℃) antisense: CAAGCTCCTCGTCCGCCATG (61 ℃) | 137bp |
| Group 7 | 6 12 | Justice is arranged: GCTGGATTGGTGGCGCCTG (61 ℃) antisense: CATGGCTCGGCGTCAGCG (61 ℃) | 121bp |
| Group 8 | 6 13 | Justice is arranged: GCTGGATTGGTGGCGCCTG (61 ℃) antisense: TCAAGCTCCTCGTCCGCC (59 ℃) | 131bp |
| Group 9 | 7 8 | Justice is arranged: GCTCCGGGCTGGATTGGT (59 ℃) antisense: AAGCTCCTCGTCCGCCAT (57 ℃) | 136bp |
| Group 10 | 7 12 | Justice is arranged: GCTCCGGGCTGGATTGGT (59 ℃) antisense: CATGGCTCGGCGTCAGCG (61 ℃) | 121bp |
The restriction enzyme that detects this SNPs site in the test kit of the present invention is Nar I or Kas I or Sfo I or Ehe I preferably, this is that the 154th A destroys a Nar I or Kas I or Sfo I or EheI restriction enzyme site because the 170th G multiformity produces a Nar I or Kas I or Sfo I or Ehe I endonuclease site, cuts the SNP that can detect 154 A → G and 170 G → A easily with the enzyme that Nar I or Kas I or Sfo I or Ehe I enzyme carry out.
The invention still further relates to a kind of method that detects leucocythemia susceptibility, this method comprises the steps:
1) extraction experimenter's genomic dna;
2) genomic dna with the experimenter is that template is carried out pcr amplification, and used primer is the Auele Specific Primer of two SNPs detecting among PDCD5 upstream region of gene 5 ' the control region SEQ ID NO:1 the 154th and the 170th;
3) with the restriction enzyme that detects among the SEQ ID NO:1 the 154th and the 170th site to step 2) the PCR product of acquisition carries out enzyme and cuts;
4) enzyme of step 3) is cut product analysis, when enzyme was cut the product electrophoretogram and shown that sample has in the SEQ ID NO:1 sequence the uneven SNPs of 154 A → G and two complete linkages of 170 G → A, then the experimenter was a leucocythemia susceptibility.
Primer in this method is preferably any one group of sequence in the table 1; 7 sequences of the group in the table 1 more preferably.
Preferred Nar I of restriction enzyme in this method or Kas I or Sfo I or Ehe I.
Being used for specimen of the present invention and being not particularly limited, for detecting SNP, can be samples such as blood, tissue.
After adopting test kit of the present invention from specimen, to amplify the partial sequence of PDCD5 upstream region of gene 5 ' control region, sequence is carried out genetic analysis.Those skilled in the art will appreciate that a large amount of analytical technologies can be used for detecting whether the site exists single nucleotide polymorphism described in the PDCD5 upstream region of gene 5 ' control region.These technology comprise (but being not limited to): dna sequencing, sequencing by hybridization; Enzymatic mispairing cutting, heteroduple analysis, dot blot, Mini-sequencing, Taqman technology, molecular beacon; RFLP; SSCP; Sex change high performance liquid chromatography (DHPLC).Analyze aforementioned detection amplified production and compare with the PDCD5 upstream region of gene 5 ' control region of wild-type, whether 154 170 base exists variation; If 154 bit bases are converted to G by A and the 170th bit base is converted to A by G, can think that then individuality has leukemic susceptibility.
Description of drawings
Fig. 1 is the SNP sequence of PDCD5 upstream region of gene 5 ' control region of the present invention.
Fig. 2 is the active detected result behind 154G/170A genotype and the 154A/170G genotype promotor transfection HEK293 cell
Fig. 3 is for removing under the apoptosis-induced condition of serum the active detected result behind 154G/170A genotype and the 154A/170G genotype promotor transfection Hela cell
Fig. 4 is under the apoptosis-induced condition of TNF-α, the active detected result behind 154G/170A genotype and the 154A/170G genotype promotor transfection Hela cell
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these examples to only limit to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, or the condition of advising according to manufacturer.
The acquisition of embodiment 1.SNP
Step 1: the extraction of genomic dna
Adopt the quick extracting and purifying test kit of peripheral blood leucocyte genomic dna (Shanghai China Shun biotechnology company limited) in a small amount, get people's whole blood 2ml and extract genomic dna; Concentration correction is used for conventional pcr amplification to 50ng/ μ l.
The acquisition of step 2:SNP
The genomic dna that extracts in the step 1 is carried out the specific PCR amplification, directly check order behind the amplified production purifying, each pcr amplification product sequence of measuring is compared, thereby draw the difference of sequence, obtain SNP.Wherein, the PCR reaction conditions is 95 ℃, 3 minutes, carries out 95 ℃ of 35 round-robin 30 seconds, 68 ℃ 1 minute, last 72 ℃ 7 minutes.Primer is:
Adopted primer: 5 '-CGGGGAATCGGGCCTCTGC-3 ' (SEQ ID NO:2) is arranged
Antisense primer: 5 '-CAAGCTCCTCGTCCGCCATG-3 ' (SEQ ID NO:3)
Amplified production can observe 154 GA heterozygous after order-checking all the time and 170 AG heterozygous always occur simultaneously.
Embodiment 2. detection kit
The extraction of step 1:DNA template
Extract human peripheral 2ml with ordinary method, ordinary method is extracted the genomic dna in these blood samples.
Step 2:PCR reaction
Preparation one detects the detection kit of PDCD5 gene-correlation disease susceptibility, and wherein, it is right to contain the following primer that amplifies 154 and 170 SNP:
Adopted primer: 5 '-GCTCCGGGCTGGATTGGTG-3 ' (SEQ ID NO:6) is arranged
Antisense primer: 5 '-CATGGCTCGGCGTCAGCG-3 ' (SEQ ID NO:12)
The PCR reaction conditions is 95 ℃, 3 minutes, carries out 95 ℃ of 35 round-robin 30 seconds, 68 ℃ 1 minute, last 72 ℃ 7 minutes.
Step 3: genetic analysis
Amplified production is carried out gene type assay with the RFLP technology, because the 170th G multiformity produces a Nar I endonuclease site and Nar I restriction enzyme site of the 154th A destruction, cut the SNP that can detect 154 A → G and 170 G → A easily with the enzyme that Nar I enzyme carries out, the result also shows the 154G anomaly and 170A complete linkage imbalance; Wherein 154AA/170GG wild-type enzyme slitting band is 20bp and 101bp; The 154AG/170GA heterozygous enzyme slitting band of leucocythemia susceptibility is 20bp, 37bp, 84bp and 101bp, and the polymorphic homozygous enzyme slitting band of the 154GG/170AA of leucocythemia susceptibility is 37bp and 84bp.
The structure of the functional effect analytical procedure 1 of embodiment 3.PDCD5 promoter region 154A＞G/170G＞A polymorphism, 154G/170A genotype and 154A/170G genotype promoter region report carrier
The dna fragmentation of a 743bp that will contain 91 to the transcription initiation site downstream of the 643rd of the PDCD5 promoter region transcription initiation site upstreams of 154G/170A mutator gene type and 154A/170G wild gene type is cloned in pGL3-Basic (Promega company) reporter plasmid, constructs luciferase reporter gene plasmid pGL3-PDCD5-170A (154G/170A) that contains the 154G/170A mutant and the luciferase reporter gene plasmid that contains 154A/170G wild-type pGL3-PDCD5-170G (154A/170G).
The detection of step 2,154G/170A genotype and 154A/170G genotype promoter activity is distinguished transfection in the HEK293 cell with negative control pGL3-Basic, positive control pGL3-SV40 (Promega company), pGL3-PDCD5-170A and pGL3-PDCD5-170G, collecting cell after 24 hours, the cell of the specific activity transfection pGL3-PDCD5-170G of luciferase low 80% in the cell of transfection pGL3-PDCD5-170A, prompting 154G/170A mutator gene type has reduced the transcriptional activity of promotor, makes target gene expression level decline (Fig. 2).We have also obtained similar result in Hela, U937 and Raji clone.
Step 3, removing under the apoptosis-induced condition of serum the detection of 154G/170A genotype and 154A/170G genotype promoter activity
With negative control pGL3-Basic, positive control pGL3-SV40, pGL3-PDCD5-170A and the transfection of pGL3-PDCD5-170G difference are in the Hela cell, recession serum was cultivated in 24 hours, after removing serum 0,12, detected the activity of luciferase in the cell in 24 and 36 hours respectively, find that the uciferase activity of transfection pGL3-PDCD5-170A all significantly is lower than the cell of transfection pGL3-PDCD5-170G at each time point, and increase along with the apoptosis induction time, the former does not have considerable change by the uciferase activity of (mutant), and latter's (wild-type) continues to increase with the induction time uciferase activity, prompting is being removed under the apoptosis-induced condition of serum, mutant promoter transcription activity is starkly lower than wild-type, and to apoptosis induction insensitive (Fig. 3).
Step 4, induce down the detection of 154G/170A genotype and 154A/170G genotype promoter activity at TNF-α
PGL3-PDCD5-170A and pGL3-PDCD5-170G are distinguished transfection in the Hela cell, after 24 hours, add TNF-α (the CHX 5ug/ml+0 of different concns with the CHX (cycloheximide) of 5ug/ml same dose, CHX 5ug/ml+TNF-α 1ng/ml, CHX 5ug/ml+TNF-α 10ng/ml, CHX 5ug/ml+TNF-α 50ng/ml) in cell, collecting cell detects the activity of luciferase after 24 hours, find that the uciferase activity of transfection pGL3-PDCD5-170A all significantly is lower than the cell of transfection pGL3-PDCD5-170G in each concentration, and increase along with TNF-α concentration, the former does not have considerable change by the uciferase activity of (mutant), and latter's (wild-type) continues to increase with TNF-α concentration increase uciferase activity, prompting is under the apoptosis-induced condition of TNF-α, mutant promoter transcription activity is starkly lower than wild-type, and to apoptosis induction insensitive (Fig. 4).
The correlative study of embodiment 4.PDCD5 upstream region of gene 5 ' control region SNPs and chronic myelogenous leukemia susceptibility
Step 1: the collection of chronic myelogenous leukemia patient and normal control sample
Chronic myelogenous leukemia group peripheral blood sample picks up from hemopathy institute of The People's Hospital of Peking University, totally 83 parts; Normal control group sample is selected from Peking University First Hospital DNA sample storehouse and healthy individual, and totally 211 parts, the method shown in the embodiment 1 of pressing is extracted genomic dna.
Step 2:SNP locus gene phenotypic analysis
1) RFLP gene type.The sequence of employing shown in SEQ ID NO:6 and SEQ ID NO:12 is forward and reverse primer, carries out the pcr amplification of sample to be checked, and amplified production is with the enzymic digestion of Nar I endonuclease, behind the electrophoresis according to band location determination genotype.
2) sequencing and typing.Get 20% sample and carry out sequencing and typing, with the accuracy of checking RFLP somatotype through the RFLP somatotype.
The somatotype result confirms 154G anomaly and 170A complete linkage imbalance, and their gene frequencies in the crowd are identical.
In case group and control group, allelic frequency and genotype frequency see Table 2.Carry out statistical procedures, 154G
+/ 170A
+Genotype is significantly higher than control group in the case group, x
2Detect P＜0.05,154G is described
+/ 170A
+Genotype is relevant with chronic myelogenous leukemia, and PDCD5 is a tumor susceptibility gene of chronic myelogenous leukemia.
The distribution in CML group and normal healthy controls group of table 2.PDCD5 gene polymorphism sites genotype and allelotrope
| CML(N＝83) | Normal healthy controls (N=211) | ||
| PDCD5-154/170 | N(％) | ||
| Genotype * AA/GG AG/GA GG/AA G +/A +Allelotrope A/G G/A | 65(78.31) 18(21.69) 0(0) 18(21.69) 148(89.16) 18(10.84) | 186(88.15) 23(10.90) 2(0.095) 11(11.85) 395(93.6) 27(6.4) | |
: 154 and 170 SNPs complete linkage imbalances of PDCD5 upstream region of gene 5 ' control region, the oblique line left side is 154 SNPs genotype or allelotrope, the right side is the situation in 170 sites of complete correspondence
*: because the frequency of polymorphic homozygous genotype (GG/AA) is lower, so this genotype and heterozygous genes type (GA/AG) are merged into polymorphic positive gene type (G
+/ A
+).154G
+/ 170A
+Genotype is significantly higher than control group in the case group, x
2=4.88, P＜0.05
FPI05193 sequence listing
SEQUENCE LISTING
＜110〉Peking University
＜120〉a kind of test kit and method that detects leucocythemia susceptibility
<130>FPI05193
<160>13
<170>PatentIn version 3.1
<210>1
<211>300
<212>DNA
<213>Homo sapiens
<400>1
aggcgccgat cacgggtggg aggtggatcc cggaggcccc gccccaggcc ccgcccctcc 60
gtgcgcccaa gctcgaccgc ctgaaatcgg ggaatcgggc ctctgccggc gccctggcag 120
cggcgcgggg cgtggctccg ggctggattg gtgacgcctg ggccccgcgg gcgcctgcgc 180
agtggtcaag gccgcgctcg cgccgagggg ctgcgagagt gaccgcggct gctccagcgc 240
tgacgccgag ccatggcgga cgaggagctt gaggcgctga ggagacagag gctggccgag 300
<210>2
<211>19
<212>DNA
<213>Artificial
<220>
<223>primer
<400>2
cggggaatcg ggcctctgc 19
<210>3
<211>20
<212>DNA
<213>Artificial
<220>
<223>primer
<400>3
caagctcctc gtccgccatg 20
<210>4
<211>18
<212>DNA
<213>Artificial
<220>
<223>primer
<400>4
ctccgggctg gattggtg 18
<210>5
<211>18
<212>DNA
<213>Artificial
<220>
<223>primer
<400>5
ctggattggt ggcgcctg 18
FPI05193 sequence listing
<210>6
<211>19
<212>DNA
<213>Artificial
<220>
<223>primer
<400>6
gctggattgg tggcgcctg 19
<210>7
<211>18
<212>DNA
<213>Artificial
<220>
<223>primer
<400>7
gctccgggct ggattggt 18
<210>8
<211>18
<212>DNA
<213>Artificial
<220>
<223>primer
<400>8
aagctcctcg tccgccat 18
<210>9
<211>18
<212>DNA
<213>Artificial
<220>
<223>primer
<400>9
ctcaagctcc tcgtccgc 18
<210>10
<211>19
<212>DNA
<213>Artificial
<220>
<223>primer
<400>10
caagctcctc gtccgccat 19
<210>11
<211>18
<212>DNA
<213>Artificial
<220>
<223>primer
<400>11
cctcaagctc ctcgtccg 18
<210>12
FPI05193 sequence listing
<211>18
<212>DNA
<213>Artificial
<220>
<223>primer
<400>12
catggctcgg cgtcagcg 18
<210>13
<211>18
<212>DNA
<213>Artificial
<220>
<223>primer
<400>13
tcaagctcct cgtccgcc 18
Claims (4)
1. test kit that detects leucocythemia susceptibility comprises: the Auele Specific Primer that detects among people's apoptosis molecule 5 upstream region of gene 5 ' control region SEQ ID NO:1 two SNPs of the 154th and the 170th; And the restriction enzyme that detects this SNPs site.
2. test kit according to claim 1 is characterized in that, described primer is selected from any one group of sequence in the table 1.
3. test kit according to claim 2 is characterized in that, described primer is selected from group 7 sequences in the table 1.
4. test kit according to claim 1 is characterized in that, described restriction enzyme is Nar I or Kas I or Sfo I or Ehe I.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200510084348 CN1306043C (en) | 2005-07-19 | 2005-07-19 | Reagent and method for detecting leucocythemia susceptibility |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200510084348 CN1306043C (en) | 2005-07-19 | 2005-07-19 | Reagent and method for detecting leucocythemia susceptibility |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1724692A CN1724692A (en) | 2006-01-25 |
| CN1306043C true CN1306043C (en) | 2007-03-21 |
Family
ID=35924323
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200510084348 Expired - Fee Related CN1306043C (en) | 2005-07-19 | 2005-07-19 | Reagent and method for detecting leucocythemia susceptibility |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1306043C (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100376689C (en) * | 2006-03-28 | 2008-03-26 | 北京大学 | Method for predicting medicine safety of oseltamivir phosphate medicines |
| CN101684492A (en) * | 2008-09-26 | 2010-03-31 | 上海裕隆生物科技有限公司 | Kit for detecting genes of leukemia of children |
| CN102135542A (en) * | 2010-01-21 | 2011-07-27 | 北京大学 | ELISA (Enzyme Linked Immunosorbent Assay) method and kit for detecting soluble protein PDCD5 (Programmed Cell Death 5) |
| CN101864421B (en) * | 2010-05-21 | 2012-07-25 | 中国人民解放军军事医学科学院放射与辐射医学研究所 | Structure and application of target programmed cell death protein 5 (PDCD5) anti-influenza virus oligonucleotide |
| CN102108409B (en) * | 2010-12-22 | 2013-02-20 | 协和干细胞基因工程有限公司 | Kit for detecting susceptibility to leukemia |
| CN109735617A (en) * | 2019-03-25 | 2019-05-10 | 西藏海容唐果药业有限公司 | Leucoderma genetic test marker and its application |
-
2005
- 2005-07-19 CN CN 200510084348 patent/CN1306043C/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN1724692A (en) | 2006-01-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1306043C (en) | Reagent and method for detecting leucocythemia susceptibility | |
| CN1710102A (en) | PCR detecting method of tumour associated gene mutation and reagent system | |
| CN101056990A (en) | Polymorphisms in the epidermal growth factor receptor gene promoter | |
| CN101041854A (en) | Polymorphism sites of primary liver cancer correlative coding small molecule RNA and usage thereof | |
| CN1285002A (en) | Analysis of predisposition based on buman airway tripsin protease gene polymorphism | |
| CN1891822A (en) | PH gene with specific mononucleotide pleimorphism, and its detecting method and use | |
| CN1749417A (en) | Real time quantitative PCR detecting reagent kit and method for epidermal growth factor receptor exon 19 deletion mutation | |
| CN1687455A (en) | Reagent and method for separating and determining dissociative DNA in blood | |
| CN1151188A (en) | Method of detecting human cytochrome P4501A2 gene polymorphism | |
| CN101033487A (en) | Method of detecting KLK1 gene rs5517 polymorphism correlated to primary hypertension | |
| CN1291018C (en) | Using pig slow contraction type troponin coded gene TNN 11 as genetic marker of pig productive character | |
| CN1257987C (en) | Molecule labelling method for specific PCR detection of genes related to chicken growth and egg-laying deseription by employing allelomorph and use thereof | |
| CN100347316C (en) | AML-1 matator as one of leuckemia quick change major gene and its use | |
| CN1478149A (en) | Method of screening physiologically active substance | |
| CN1244700C (en) | Human acetylcholinesterase isomer protein (AR-ACHE) and its gene coding sequence | |
| CN101065483A (en) | Method of identifying nucleotide polymorphisms | |
| CN1490404A (en) | Human high metas tasis breast cancer cell line and setting method thereof | |
| CN1809638A (en) | Method of detecting beta 3 adrenaline receptor mutant gene and nucleic acid probe and kit therefor | |
| CN1730655A (en) | Human genetic deaf related GJB6 mutant gent and its uses in gennetic deaf diagnosis | |
| CN1304046C (en) | Liver cancer relative gene DLK1 and its use | |
| CN100347299C (en) | GATA-2 mutator as one of leukemia rapid change major genes and its use | |
| CN100342032C (en) | Detecting method of the schizophrenia susceptible gene and susceptible gene and use | |
| CN1940086A (en) | Method for determining patient's brain ictus genetic susceptibility | |
| CN1966685A (en) | Upstream transcription control element for human oesophagus cancer cell ezrin gene | |
| CN1266273C (en) | Promoter for regulating and controlling mouse orphan nucleus recepter and its use |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20070321 Termination date: 20140719 |
|
| EXPY | Termination of patent right or utility model |