CN102108409B - Kit for detecting susceptibility to leukemia - Google Patents
Kit for detecting susceptibility to leukemia Download PDFInfo
- Publication number
- CN102108409B CN102108409B CN 201010598843 CN201010598843A CN102108409B CN 102108409 B CN102108409 B CN 102108409B CN 201010598843 CN201010598843 CN 201010598843 CN 201010598843 A CN201010598843 A CN 201010598843A CN 102108409 B CN102108409 B CN 102108409B
- Authority
- CN
- China
- Prior art keywords
- site
- gene
- leukemia
- genes
- susceptibility
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention discloses a kit for detecting susceptibility to leukemia. The kit is used for detecting three types of genes closely related to leukemia, namely CYP1A1 genes and NQO1 genes which are related to toxicant metabolization, and XRCC1 genes related to DNA restoration. SNP loci which can be detected simultaneously include rs4646903 loci of CYP1A1 genes, rs1800566 loci of NQO1, and rs1799782 and rs25487 loci of XRCC1. The kit is used, particularly a group of genes and loci which are related to the susceptibility to leukemia are detected, a primer with specificity and a probe are utilized and mononucleotide extension technology is adopted in combination with micro-array chip technology, so that whether persons to be detected carry 'leukemia susceptibility gene' or not can be judged, persons who are susceptible to leukemia are screened, bad living habits are changed and the prevention purpose is achieved.
Description
Technical field
The present invention relates to the test kit that a kind of disease susceptibility detects usefulness, especially a kind of test kit that detects leucocythemia susceptibility, by detecting the mononucleotide polymorphism site (SNP) of CYP1A1, NQO1, XRCC1, predict individual to leukemic susceptibility.
Background technology
Leukemia sickness rate in population of China is high, is children and young modal malignant tumour.Its sickness rate is in rising trend in recent years, and the cause of disease is not yet illustrated so far.The viewpoint of generally acknowledging at present is that leukemia is that environment-gene interaction causes.The gene aspect relates to the variation of metabolism, dna damage reparation gene etc.The research discovery, the metabolic enzyme family in the carcinogens metabolic pathway is polymorphism in the crowd, and Different Individual has huge difference to specific carcinogenic metabolic capacity.Equally, also there is significant individual difference in the DNA repair ability.Human Genome Project achievement in research shows, everyone gene is the same, but in sequence minimum variation such as mononucleotide polymorphic (SNPs) is arranged.The SNP polymorphism of these genes has caused the function difference of gene product just, thereby determines the difference of repair ability behind individual specific carcinogenic metabolic capacity to the leukemogenesis morbidity and the dna damage.Therefore, the polymorphism of metabolism genoid, DNA-repair gene etc. is the inherited genetic factors of the sick susceptibility of decision crowd dialogue blood.
Biotransferase participates in metabolism, activation or the detoxification processes of many common chemical carcinogens.Environmental carcinogen mostly is the former carcinogens of non-activity, enter behind the human body most of through being that the I phase enzymes metabolism activation of representative is as electrophilic ultimate carcinogens take the CYP450 enzyme, again by II phase metabolic enzyme metabolism inactivation, be converted into hydroaropic substance and excrete, can carcinogens cause that the target cell canceration depends on activity and the equilibrium relationship thereof of this two fermentoid to a great extent.The biotransferase gene presents polymorphism and distributes in the crowd, genes involved disappearance or variation might cause body can not produce activated zymoprotein or the expression amount of enzyme is reduced, the detoxification ability of body reduces, and carcinogens is accumulated in vivo, thereby makes institute tire out the danger increase of individual trouble cancer.Molecule epidemic disease-ology research show in a large number, and Genetic predispostion is relevant with the metabolic enzyme genetic polymorphism among the crowd.
CYP1A1 is a member of I phase metabolic enzyme CYP450 family, its assignment of genes gene mapping is in human chromosomal 15q22-q24, contain 5934 base pairs, the protein of coding contains 512 amino-acid residues, its length is 6311bp, comprise 7 exons and 6 introns, wherein first exon coded protein not.CYP1A1 main code product is aryl hydrocarbon hydroxylase (aryl hydrocarbon hydroxylase, AHH).Most of carcinogenss all are the substrates of CYP1A1 in the environment, main metabolic polycyclic aromatic hydrocarbons carcinogen.Its MspI polymorphic (rs4646903) is by the 6235 sites generation T of CYP1A13 ' end non-coding region → C sudden change, form Msp I restriction endonuclease recognition sequence, wild-type (TT), heterozygous (TC), 3 kinds of genotype of homozygous mutation type (CC) are arranged.The research discovery, CYP1A1 mutator gene type can improve the Enzyme induced formation activity, accelerates carcinogenic activation.Therefore, the individuality that carries CYP1A1 Msp I mutator gene type CC is more responsive to environmental carcinogen, thereby has increased individual leukemic danger.
NQO1, i.e. NAD (P) H: quinone oxidoreductase, claim again the D-lipoamide dehydrogenase, be a kind of important II phase reaction enzyme in the body, mainly exist in the kytoplasm, but in endoplasmic reticulum, plastosome and golgi body, also exist.The NQO1 assignment of genes gene mapping is in human chromosomal 16p22, and full length gene 20kb contains 6 exons.NQO1 can pass to the electronics of NADH or NADPH quinones and derivative thereof take NAD (P) H as acceptor, and the Double electron reduction reaction occurs, and generates the hydroquinone compound of low toxicity.Its catalysis characteristics is to form without oxidation productss such as single electron reduzate semiquinone and free radicals, has avoided the damage to cell, reduces the harm of the quinones with carinogenicity and teratogenecity.NQO1 has consisted of in the body the metabolism network of external source carcinogenic substance with other I, II phase metabolic enzyme, plays an important role in the metabolic detoxification of body.
There is C → T single nucleotide polymorphism in (rs1800566) on NQO1 gene cDNA 609 sites, by the heredity of Mendelian's mode, meets the Hardy-Weinberg balance.This loci polymorphism causes 187 amino acids of NQO1 genes encoding to become Serine by proline(Pro), though do not affect the synthetic of its mRNA, may change the secondary structure of enzyme, makes the activity decreased of enzyme, has increased the generation of oxyradical.The wild gene type that isozygotys CC has completely NQO1 enzymic activity, and the enzymic activity of heterozygous genes type CT reduces by 3 times than homozygous wildtype, and the enzymic activity of homozygous mutation genotype TT then completely loses.Therefore, the NQO1 defective can reduce the cell carcinogenic ability of detoxifying, thereby affects the cellular metabolism approach, increases the carcinogens load and can cause some susceptible individual malignant change.Studies show that, adult's homozygous mutation genotype TT can increase the danger of benzolism, and can increase leukemic danger,
Staggered complementary gene 1 (the X-ray repair cross-complementinggroup 1 that repairs of human x-ray, XRCC1) be first be separated to affect cell to the mammalian genes of ionizing rays susceptibility, the reparation of its wide participation dna damage is to study at present more a kind of DNA-repair gene.XRCC1 is positioned human chromosomal 19q13.2-13.3, and size is 33kb, comprises 17 exons, the protein of 1 70kD that is comprised of 633 amino acid that encodes.XRCC1 is as scafffold proteins, by direct and archaeal dna polymerase β, dna ligase III and poly adenosine diphosphate (ADP) (adenosinediphosphate, ADP) ribose polymerase (poly ADP-ribose polymerase, PARP) form mixture, the common participation repaired and the single-strand break reparation because of the base excision that ionizing rays and oxidative damage cause, the stability of keeping gene is brought into play very crucial effect.Find in the XRCC1 gene in 2 polymorphic sites, they are (rs1799782) C26304T and (rs25487) G28152A, cause respectively the change of corresponding amino-acid residue Arg194Trp and Arg399Gln.These amino acid variations have high conservative in evolution, therefore these 2 amino acid whose variations in site, change the function of XRCC1 gene coded protein, thereby cause generation and the development of malignant tumour, wherein the AA genotype in the TT genotype in rs1799782 site, rs25487 site increases individual danger of suffering from acute leukemia.
Prior art detects leukemia Susceptible population, adopts hybridization hybrid chip method or sheet glass chip method, and utilizes the taqman probe, and the method accuracy rate is low, false negative and false positive rate are higher, and can not batch detection; Another kind of direct sequencing, though accuracy rate is high, its cost is high, can not realize batch detection equally, therefore existing method all can't satisfy the requirement of extensive genescreen.
Summary of the invention
Technical problem to be solved by this invention is, by detecting one group of gene relevant with leucocythemia susceptibility and site, utilize Auele Specific Primer and probe, by the mononucleotide elongation technology in conjunction with the micro-array chip technology, comprehensive detection and analysis are subjected to the inspection crowd whether to carry " leukemia tumor susceptibility gene ", leukemia Susceptible population is screened from the crowd, change bad living habit, reach the purpose of prevention.
In order to solve the problems of the technologies described above, the technical solution used in the present invention is: a kind of detection kit for detection of leucocythemia susceptibility, it detects three genes in close relations with leukemia: the CYP1A1 gene of toxicant metabolism class, NQO1 gene, DNA repairs the XRCC1 gene of class.
Comprise following SNP site: rs1799782 and the rs25487 site of the rs4646903 site of CYP1A1 gene, the rs1800566 site of NQO1, XRCC1.
The described assortment of genes for detection of the leukemia susceptible is used for designing specific primer pair and probe for described site.
The Auele Specific Primer of described assortment of genes design for detection of the leukemia susceptible, the right sequence of described Auele Specific Primer is as follows, is used for carrying out the multiplex PCR amplification, can amplify simultaneously the gene fragment in above-mentioned 4 sites:
For rs4646903 site: AGAGGCTGAGGTGGGAGAAT (SEQ ID NO:1)
GCAGTCTGTTTGAGGGACAAG(SEQ?ID?NO：2)
For rs 1800566 sites: CTGGAGTGTGCCCAATGCT (SEQ ID NO:3)
GAATTGGTTGACTTACCTCTCTGT(SEQ?ID?NO：4)
For rs1799782 site: AGTCTAGGTCTCAACCCTACTCACT (SEQ ID NO:5)
GAAGGTGACAGTGACCAAGCTT(SEQ?ID?NO：6)
For rs25487 site: CAGTCTGACTCCCCTCCAGATT (SEQ ID NO:7)
TGCTGGACTGTCACCGCAT(SEQ?ID?NO：8)
The specific probe of described assortment of genes design for detection of the leukemia susceptible is characterized in that, described specific probe sequence is as follows, can carry out detection and genotyping to 4 sites simultaneously:
For the rs4646903 site:
ACGCACGTCCACGGTGATTTTTGTTTCACTGTAACCTCCACCTCC
(SEQ?ID?NO：9)
For the rs1800566 site:
GGATGGCGTTCCGTCCTATTTGCCCAATGCTATATGTCAGTTGAG
(SEQ?ID?NO：10)
For the rs1799782 site:
CGTGCCGCTCGTGATAGAATTCACCTGGRGATGTCTTGTTGATCC
(SEQ?ID?NO：11)
For the rs25487 site:
AGCGATCTGCGAGACCGTATCGCATGCGTCGGCGGCTGCCCTCCC。
(SEQ?ID?NO：12)
Described primer or probe are used for detecting the leukemia tumor susceptibility gene by the mononucleotide elongation technology in conjunction with micro-array chip technology specificity.
Component and the content of this test kit comprise:
250ul 10 * PCR reaction buffer,
20ul 10mM dNTP mixed solution,
450ul 25mM MgCl2 solution,
45ul (5U/ul) Taq archaeal dna polymerase,
50ul Auele Specific Primer (8) mixed solution (10uM each),
15ul specificity extension probes (4) mixed solution (10uM),
90ul?ExoI(10U/ul)，
450ul?SAP(1U/ul)，
140ul 10 * SAP reaction buffer,
1700ul?Extension?Dilution?Buffer，
90ul?10×Extension?Mix，
10ul?DNA?polymerase，
3500ul?Hybridization?Solution，
200ul?Hybridization?Additive，
2500ul?20×Wash?Buffer?1，
800ul?64×Wash?Buffer?2，
384 holes, 12 heavy micro-array chips
Deionized water 20ml,
This test kit detects for 380 person-portions and uses, and the test kit storage temperature is-20 ℃.
The invention has the beneficial effects as follows: accuracy is up to more than 99% as a result for (1) somatotype, and good reproducibility does not have False Positive Effect; (2) detect simultaneously a plurality of SNP site, testing cost is low; (3) flux is high, can once detect 384 samples; (4) easy and simple to handle; (5) highly sensitive, each DNA consumption that detects is 2ng only.The present invention in conjunction with the micro-array chip technology, utilizes Auele Specific Primer and probe that the gene type accuracy rate of single nucleotide polymorphism (SNP) is surpassed 99% by the mononucleotide elongation technology.
Embodiment
Below in conjunction with specific embodiment the present invention is described in further detail.The experiment of unreceipted actual conditions is amplified in the following example, usually according to normal condition, or the condition of advising according to manufacturer.
The extraction of 1DNA:
Get person under inspection's peripheric venous blood, the cell pyrolysis liquid that adds equal volume, twice of cracking, abundant cracking white corpuscle, centrifugal abandoning adds Proteinase K damping fluid and Proteinase K (50ug/ml) behind the supernatant, hatched 10 minutes for 65 ℃, isopropanol precipitating, 75% washing with alcohol twice are dissolved in after drying in an amount of TB solution.
The 2PCR amplification
The extracting genome DNA liquid of getting the person under inspection adds in 96 orifice plates, carries out the multiplex PCR amplification:
Reaction cumulative volume 5ul, 10M mol/L dNTPs 0.0375ul wherein, 10 * PCR Buffer0.5ul, 25mmol/L MgCl
21ul, template DNA 30ng, 6 heavy primer mixed solution 10uM/L each0.025ul, Amplitaq Gold (5U/ul) 0.1ul supplies water to 5ul.Place on the PCR instrument and react: 94 ℃ of 1min of denaturation; 94 ℃ of 30sec, 55 ℃ of 30sec, 72 ℃ of 1min, 40 circulations; 4 ℃ of Hold.
The amplimer mixed solution comprises following primer:
1F?AGAGGCTGAGGTGGGAGAAT(SEQ?ID?NO：1)
1R?GCAGTCTGTTTGAGGGACAAG(SEQ?ID?NO：2)
2F?CTGGAGTGTGCCCAATGCT(SEQ?ID?NO：3)
2R?GAATTGGTTGACTTACCTCTCTGT(SEQ?ID?NO：4)
3F?AGTCTAGGTCTCAACCCTACTCACT(SEQ?ID?NO：5)
3R?GAAGGTGACAGTGACCAAGCTT(SEQ?ID?NO：6)
4F?CAGTCTGACTCCCCTCCAGATT(SEQ?ID?NO：7)
4R?TGCTGGACTGTCACCGCAT(SEQ?ID?NO：8)
3 purifying
In pcr amplification product, add 0.2ul ExoI, 1ul SAP, 0.3ul 10 * SAP reaction buffer and 1.5ul deionized water.96 orifice plates are put into the PCR instrument carry out purifying, purifying procedure: 37 ℃ of 30min, 96 ℃ of 10min, 4 ℃ of Hold.
4 primer extension reactions
Add the extension mixture in the PCR product behind the purifying: extension Dilution Buffer3.76ul, extension probes mixed solution (1010uM/L each) 0.03ul, 20 * Extension Mix 0.2ul, archaeal dna polymerase 0.02ul, deionized water 3ul.96 orifice plates that the extension mixture is housed are put into the PCR instrument again carry out extension, response procedures: 96 ℃ of 3min of Hold; 94 ℃ of 20sec, 40 ℃ of 11sec, 46 circulations; 4 ℃ of Hold.
The extension probes mixed solution comprises following probe:
1P?ACGCACGTCCACGGTGATTTTTGTTTCACTGTAACCTCCACCTCC(SEQ?ID?NO：9)
2P?GGATGGCGTTCCGTCCTATTTGCCCAATGCTATATGTCAGTTGAG(SEQ?ID?NO：10)
3P?CGTGCCGCTCGTGATAGAATTCACCTGGRGATGTCTTGTTGATCC(SEQ?ID?NO：11)
4P?AGCGATCTGCGAGACCGTATCGCATGCGTCGGCGGCTGCCCTCCC(SEQ?ID?NO：12)
Above extension probes 5 ' end has the address sequence of answering with micro-array chip address primer pair.
After 5 extensions finished, adding hybridization solution can carry out hybridization with micro-array chip.
42 ℃ of incubation temperature, incubation time 2 hours.
6 laser scanning inspection fluorescent signals
Detect simultaneously above-mentioned 3 gene pairss prediction, relatively more individual leucocythemia susceptibility is significant.The present invention will make up with leukemia susceptible, the closely-related gene of generation, show described 3 genes by a large amount of garbled datas: CYP1A1 gene, NQO1 gene, XRCC1 gene, have the site to undergo mutation such as 3 genes, the probability of then suffering from acute leukemia is the highest; There is not gene to have the site leukemic probability of undergoing mutation less.
The method that the present invention adopts mononucleotide elongation technology and micro-array chip technology to combine, for above-mentioned 4 sites, design one cover multiple PCR primer, 4 gene fragments in SNP site are carried in simultaneously amplification in an amplified reaction, according to the sequences Design oligonucleotide probe of upstream, SNP site 5 ' end 23-25bp, 3 ' end is positioned at snp5 ' end 1bp place, upstream behind this probe and the sequence hybridization.Base ddNTP who carries fluorescence in the probe end combination that polysaccharase carries according to SNP during detection, ddNTP according to combination is different, its entrained fluorescence color is not identical yet, hold basis and the different designs of micro-array chip binding site that the Tag address sequence of different 20bp is arranged at 5 ' of probe, complementary with sequence corresponding on the micro-array chip, sequence hybridization on probe after the extension and the micro-array chip on the corresponding zone, different probes is combined in the different zones of chip, by detecting the fluorescence of correspondence position, reach the purpose of carrying out simultaneously a plurality of SNP somatotypes.
Disease be a very complicated process, be subject to the joint effect of a plurality of albumen and gene, wherein the change of any one enzyme all can affect the susceptibility of disease.The method of traditional gene test disease is subject to the restriction of method, often can only analyze one to two gene polynorphisms, can only cover a part of ill risk population, for the timely early warning of the ill risk of disease that causes owing to the polymorphism on other genes, therefore the accuracy that detects can significantly reduce, and the person under inspection can not comprehensively understand the susceptible situation of self-disease.
The present invention is directed to the different ill approach of a kind of disease and detect a plurality of relevant genes and its pleomorphism site, can more accurately more fully detect the ill risk of the different ill approach of person under inspection, can propose pointed and Health ﹠ Fitness Tip effectively to the person under inspection, avoid timely and effectively the generation of its disease.
Because the detection method that the present invention uses can high-throughput, the detection SNP of automatization, significantly reduced testing cost, can a plurality of genes of the ill approach of difference be detected simultaneously, 4 pleomorphism sites have been selected in the key gene searching that the present invention is directed to the different ill approach of leukemia, can more accurately more fully detect the ill risk of the different ill approach of person under inspection, can propose pointed Health ﹠ Fitness Tip to the person under inspection, avoid timely and effectively the generation of its disease.The present invention passes through the mononucleotide elongation technology in conjunction with the micro-array chip technology, utilize Auele Specific Primer and probe that the gene type accuracy rate of single nucleotide polymorphism (SNP) is surpassed 99%, detect simultaneously that above-mentioned 3 gene pairss detect, relatively more individual leucocythemia susceptibility is significant.
In sum, content of the present invention is not limited in the above-described embodiment, and the knowledgeable people in the same area can propose other embodiment easily within technical director's thought of the present invention, but this embodiment comprises within the scope of the present invention.
Claims (4)
1. test kit for detection of leucocythemia susceptibility, it is characterized in that, comprise: detect simultaneously the rs1800566 site of rs4646903, the NQO1 of CYP1A1 gene, the rs1799782 of XRCC1 and Auele Specific Primer and the corresponding extension probes in rs25487 site, the Taq enzyme, the dNTP mixed solution, MgCl
2Solution, 10 * PCR reaction buffer, ExoI, SAP, 10 * SAP reaction buffer, ExtensionDilution Buffer, 10 * ExtensionMix, DNA polymerase, HybridizationSolution, Hybridization Additive, 20 * Wash Buffer 1,64 * Wash Buffer2, deionized water, micro-array chip; Contained Auele Specific Primer is to being SEQID NO:1, the primer pair of nucleotide sequence shown in 2, SEQID NO:3, the primer pair of nucleotide sequence shown in 4, SEQ IDNO:5, the primer pair of nucleotide sequence shown in 6 and SEQID NO:7, the primer pair of nucleotide sequence shown in 8; Contained specificity extension probes is the extension probes shown in the SEQ IDNO:9,10,11 and 12.
2. the test kit for detection of leucocythemia susceptibility according to claim 1, it is characterized in that: described Auele Specific Primer is to being the rs1799782 of rs1800566 site, XRCC1 of rs4646903 site, NQO1 for the CYP1A1 gene and rs25487 site and design, and can specific amplification goes out to comprise the primer pair of the dna fragmentation in above-mentioned SNP site.
3. the test kit for detection of leucocythemia susceptibility according to claim 1, it is characterized in that: described specificity extension probes is the rs1799782 of rs1800566 site, XRCC1 of rs4646903 site, NQO1 for the CYP1A1 gene and rs25487 site and design, and can extend and microarray technology detect the probe of these four SNPs loci gene types by mononucleotide.
4. the test kit for detection of leucocythemia susceptibility according to claim 1, it is characterized in that: the component of test kit and content comprise 250ul 10 * PCR reaction buffer, 20ul 10mM dNTP mixed solution, 450ul 25mM MgCl
2Solution, 45ul 5U/ul Taq archaeal dna polymerase, article 8, the Auele Specific Primer mixed solution 50ul of every 10uM, article 4, the specificity extension probes mixed solution 15ul of every 10uM, 90ul 10U/ul ExoI, 450ul 1U/ul SAP, 140ul 10 * SAP reaction buffer, 1700ul Extension Dilution Buffer, 90ul 10 * Extension Mix, 10ulDNApolymerase, 3500ul Hybridization Solution, 200ul HybridizationAdditive, 2500ul 20 * Wash Buffer 1,800ul 64 * Wash Buffer 2, deionized water 20ml, confession 380 person-portions detect 384 holes, the 12 heavy micro-array chips of using, and the test kit storage temperature is-20 ℃.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010598843 CN102108409B (en) | 2010-12-22 | 2010-12-22 | Kit for detecting susceptibility to leukemia |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010598843 CN102108409B (en) | 2010-12-22 | 2010-12-22 | Kit for detecting susceptibility to leukemia |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102108409A CN102108409A (en) | 2011-06-29 |
| CN102108409B true CN102108409B (en) | 2013-02-20 |
Family
ID=44172694
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201010598843 Active CN102108409B (en) | 2010-12-22 | 2010-12-22 | Kit for detecting susceptibility to leukemia |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102108409B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104593511A (en) * | 2015-01-30 | 2015-05-06 | 上海派森诺生物科技有限公司 | Method and kit for detecting polymorphism of XRCC1 gene |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1724692A (en) * | 2005-07-19 | 2006-01-25 | 北京大学 | Reagent and method for detecting leucocythemia susceptibility |
-
2010
- 2010-12-22 CN CN 201010598843 patent/CN102108409B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1724692A (en) * | 2005-07-19 | 2006-01-25 | 北京大学 | Reagent and method for detecting leucocythemia susceptibility |
Non-Patent Citations (5)
| Title |
|---|
| CC Hong et al.Genetic variability in iron-related oxidative stress pathways(Nrf2,NQ01,NOS3 AND HO-1),iron intake, and risk of postmenopausal breast cancer.《Cancer epidemiology biomarkers & prevention》.2007,第16卷1784-1794. |
| CC Hong et al.Genetic variability in iron-related oxidative stress pathways(Nrf2,NQ01,NOS3 AND HO-1),iron intake, and risk of postmenopausal breast cancer.《Cancer epidemiology biomarkers & * |
| Cyp1a1 and Xrcc1 gene polymorphisms in SCC of the larynx;G Varzim et al;《European journal of cancer prevention》;20031231;第12卷(第6期);495-499 * |
| G Varzim et al.Cyp1a1 and Xrcc1 gene polymorphisms in SCC of the larynx.《European journal of cancer prevention》.2003,第12卷(第6期),495-499. |
| prevention》.2007,第16卷1784-1794. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102108409A (en) | 2011-06-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6216486B2 (en) | Association of low-frequency recurrent genetic variation with attention-deficit / hyperactivity disorder and its use for diagnosis and treatment | |
| CN102146438A (en) | Kit for detecting alcoholic liver disease susceptibility | |
| CN112980933B (en) | SNP (Single nucleotide polymorphism) typing detection method based on CRISPR-Cas (CRISPR-Cas) system and application of SNP typing detection method | |
| Tsai et al. | Analysis of the CYP21A1P pseudogene: indication of mutational diversity and CYP21A2-like and duplicated CYP21A2 genes | |
| CN102108408B (en) | Kit used for detecting susceptibility to type 1 diabetes | |
| CN102108413A (en) | Kit used for detecting susceptibility to femoral head necrosis | |
| CN102108411A (en) | Kit for detecting gastric cancer susceptibility | |
| CN101962670A (en) | Gene combination, primer and probe for detecting leukemia susceptibility and application | |
| CN102108409B (en) | Kit for detecting susceptibility to leukemia | |
| US20140072966A1 (en) | Genetic biomarkers for glucose-6-phosphate dehydrogenase deficiency | |
| AU2005259787B2 (en) | Method of detecting mutations in the gene encoding cytochrome P450-2D6 | |
| KR101249635B1 (en) | Novel EGR2 SNPs Related to Bipolar Disorder, Microarrays and Kits Comprising them for Diagnosing Bipolar Disorder | |
| WO2006010266A1 (en) | Method of detecting mutations in the gene encoding cytochrome p450-2c19 | |
| CN102108410A (en) | Gene combinations, primer, probe and applications thereof for determining PDS gene mutation of large vestibular aqueduct syndrome deafness | |
| US20100151459A1 (en) | Marker for detecting the proposed efficacy of treatment | |
| Hao et al. | Allele and genotype frequencies of polymorphic FMO3 gene in two genetically distinct populations | |
| CN101962667A (en) | Gene combination, primer and probe for detecting gastric cancer susceptibility and application | |
| CN102108412A (en) | Kit for detecting susceptibility of large vestibular aqueduct syndrome epicophosis | |
| JPWO2008066161A1 (en) | NAT2 gene amplification primer set, NAT2 gene amplification reagent containing the same, and use thereof | |
| Khavandegar et al. | Allelic and Genotype Frequencies of CYP2B6∗ 2 (64C> T) and CYP2B6∗ 3 (777C> A) in Three Dominant Ethnicities of the Iranian Population | |
| Khavandegar et al. | Research Article Allelic and Genotype Frequencies of CYP2B6 2 (64C> T) and CYP2B6 | |
| Iovannisci et al. | The READIT™ Assay as a Method for Genotyping NAT1* 10 Polymorphisms | |
| KR101095852B1 (en) | Polynucleotides comprising single nucleotide polymorphism, microarrays and diagnostic kits comprising the same, and detection methods using the same | |
| KR101061542B1 (en) | Polynucleotides comprising single nucleotide polymorphism, microarrays and diagnostic kits comprising the same, and detection methods using the same | |
| KR101095850B1 (en) | Polynucleotides comprising single nucleotide polymorphism, microarrays and diagnostic kits comprising the same, and detection methods using the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| ASS | Succession or assignment of patent right |
Owner name: ZHONGYUAN XIEHE GENE TECHNOLOGY CO., LTD. Free format text: FORMER OWNER: XIEHE STEM CELL GENE ENGINEERING CO., LTD. Effective date: 20150910 Free format text: FORMER OWNER: TIANJIN BINHAI UNION GENE TECHNOLOGY CO., LTD. Effective date: 20150910 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20150910 Address after: 300456 No. 15, Haian, Binhai New Area, Tianjin Patentee after: Source Concord Gene Technology Co., Ltd. Address before: 300384 Mei Nankai District Huayuan Industrial District of Tianjin City Court Road, No. 12 Patentee before: Xiehe Stem Cell Gene Engineering Co., Ltd. Patentee before: Tianjin Binhai Union Gene Technology Co., Ltd. |