CN112980933B - SNP (Single nucleotide polymorphism) typing detection method based on CRISPR-Cas (CRISPR-Cas) system and application of SNP typing detection method - Google Patents
SNP (Single nucleotide polymorphism) typing detection method based on CRISPR-Cas (CRISPR-Cas) system and application of SNP typing detection method Download PDFInfo
- Publication number
- CN112980933B CN112980933B CN202011613279.2A CN202011613279A CN112980933B CN 112980933 B CN112980933 B CN 112980933B CN 202011613279 A CN202011613279 A CN 202011613279A CN 112980933 B CN112980933 B CN 112980933B
- Authority
- CN
- China
- Prior art keywords
- crispr
- cas12a
- sequence
- detection method
- snp typing
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention provides a SNP typing detection method based on a CRISPR-Cas system, which comprises the following steps: (1) Amplifying target nucleic acid, wherein the 5' end of a mutation site on the obtained amplified product comprises a PAM sequence; (2) And (3) performing SNP typing detection on the amplified product obtained in the step (1) by using a CRISPR-Cas detection system. The SNP typing detection method based on the CRISPR-Cas system can be used for quickly typing detection of mutation sites on DNA to be detected, has low cost, and can judge the mutation type of a target gene in a short time only through the change of fluorescent signals without large-scale instruments.
Description
Technical Field
The invention belongs to the technical field of nucleic acid detection, and particularly relates to a SNP typing detection method based on a CRISPR-Cas system and application thereof.
Background
As a third generation molecular marker with the most development potential in recent years, single nucleotide polymorphisms (single nucleotide polymorphism, SNP) are stable polymorphic sites widely distributed in human genome, exist in the forms of single base transversions, transitions, insertions, deletions and the like, are most abundant in SNP resolution as compared with other molecular markers, have a large coverage genome range, are genetically stable, and in human genome, 1 SNP is estimated for every 1000 base pairs on average, and the total number thereof is estimated to be 300 ten thousand or more, and are the third generation genetic markers following microsatellites.
SNPs are unevenly distributed and have more non-transcribed sequences than transcribed sequences, most of which are located in non-coding regions of the protein. In general, the mutation of a allele is usually a transition, i.e., a pyrimidine base is changed to another pyrimidine base, or a purine base is changed to another purine base, and the ratio of transition to transversion is 2:1. SNPs occur most frequently in CG sequences and are often C.fwdarw.T, since C, cytosine, in CG is often methylated and becomes thymine upon spontaneous deamination. SNP can better reflect the genetic background of individuals, identify the individual differences among patients, realize rapid, automatic and large-scale detection, and has wide application prospect in the aspect of prognosis evaluation of tumors.
Traditional SNP studies rely mainly on sequencing and allele specific PCR (AS-PCR). The main problem of sequencing is that a large instrument is needed, and the sequencing difficulty is high and the cost is high under the condition that the target chain is too short (< 150 bp); the AS-PCR requires primer screening, and the genotyping is detected by whether successful amplification is possible, and the most important problem is that the primer screening workload is large, and sometimes even proper specific primers cannot be screened.
The CRISPR technology is a rapid nucleic acid detection technology discovered in the last two years, and the CRISPR-Cas nucleic acid detection method has very high specificity due to the strict matching requirement of crRNA and target nucleic acid sequences. When crRNA binds to double-stranded DNA containing PAM sequence, if mismatches occur at multiple bases after the PAM sequence, the cleavage activity of the CRISPR system is greatly affected (see Chen J S, ma E, harrington L B, et al CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity [ J ]. Science,2018,360 (6387):436-439.).
Therefore, whether the high specificity of the CRISPR-Cas nucleic acid detection method can be utilized to improve the detection method of the SNP in the prior art, so that the problems of high difficulty, high cost and the like of SNP typing detection are solved.
Disclosure of Invention
In view of the problems existing in the prior art, the invention provides a SNP typing detection method based on a CRISPR-Cas system and application thereof. The SNP typing detection method omits the traditional AS-PCR primer screening process, and can realize on-site rapid detection without large instruments.
To achieve the purpose, the invention adopts the following technical scheme:
in a first aspect, the invention provides a SNP typing detection method based on a CRISPR-Cas system, comprising the following steps:
(1) Amplifying target nucleic acid, wherein the 5' end of a mutation site on the obtained amplified product comprises a PAM (protospacer adjacent motif) sequence;
(2) And (3) performing SNP typing detection on the amplified product obtained in the step (1) by using a CRISPR-Cas detection system.
Since CRISPR targeting specificity is determined by two parts, one part is base pairing between RNA chimera (crRNA) and target DNA and the other part is interaction of Cas protein and one short DNA sequence (usually at the 3' end of the target DNA), which is called PAM sequence. Thus, the CRISPR-Cas system strongly depends on the PAM sequence in the target DNA, i.e. when no PAM sequence is contained in the target DNA, the Cas protein in the CRISPR-Cas system cannot bind to the target DNA via the gRNA.
In the invention, when the upstream of the mutation site contains a PAM sequence, the primer sequence is normally designed, and when the upstream of the mutation site to be detected does not contain the PAM sequence, the PAM sequence is introduced into the 5' end adjacent to the mutation site through the primer, so that target DNA containing the PAM sequence is successfully amplified, and then the genotyping detection is realized through the high specificity of CRISPR. In other words, in the method provided by the invention, a plurality of bases T can be introduced according to actual conditions, and if the gene to be detected contains PAM sequence, the gene does not need to be introduced from a primer; if the gene to be detected contains 2T bases, one T base is introduced through the primer.
The rapid typing detection of SNP is realized by combining with a CRISPR-Cas system, the on-site detection can be realized without a large instrument, and the mutation type of the target gene can be judged in a short time only through the change of fluorescent signals after the target gene is amplified.
As a preferred embodiment of the present invention, the amplification method in the step (1) comprises PCR amplification, RPA amplification, LAMP amplification, or the like. Namely, an amplification method capable of amplifying a target nucleic acid to obtain an amplification product having a PAM sequence can be used.
Preferably, the PCR amplification system comprises DNA polymerase, dNTPs, reverse primer and forward primer containing PAM sequence. Wherein the DNA polymerase may be LA Taq DNA polymerase (TAKaRa) or Pyrobest DNA polymerase (TAKaRa), and the dNTPs comprise dATP, dTTP, dCTP and dGTP.
Preferably, the molar ratio of the forward primer to the reverse primer is (1-1.5): 1, which may be, for example, 1:1, 1.1:1, 1.2:1, 1.3:1, 1.4:1, or 1.5:1, etc.
Preferably, the conditions for the PCR amplification in step (1) are: denaturation at 94 to 98 ℃ (e.g., 95 ℃, 96 ℃, 97 ℃ or the like) for 25 to 30s (e.g., 26s, 27s, 28s, 26s or the like), annealing at 45 to 55 ℃ (e.g., 46 ℃, 48 ℃,50 ℃, 52 ℃, 54 ℃ or the like) for 25 to 30s (e.g., 26s, 27s, 28s or 26s or the like), elongation at 70 to 72 ℃ (e.g., 70 ℃, 71 ℃ or 72 ℃ or the like) for 20 to 30s (e.g., 22s, 24s, 26s or 28s or the like), and cycling 30 to 40 times (e.g., 32 times, 34 times, 35 times, 36 times or 38 times or the like).
Preferably, the denaturation at 95 ℃ for 30s, annealing at 50 ℃ for 30s and elongation at 72 ℃ for 20s, and the cycle is 40 times.
Preferably, the volume ratio of amplification product to CRISPR-Cas detection system obtained in step (1) is 1 (3-5), e.g. can be 1:3, 1:3.2, 1:3.4, 1:3.5, 1:3.6, 1:3.8, 1:4, 1:4.2, 1:4.5, 1:4.6, 1:4.8 or 1:5, etc.
As a preferred technical solution of the present invention, the CRISPR-Cas detection system of step (2) comprises a Cas protein and a crRNA.
Preferably, the Cas protein comprises Cas12a and/or Cas12b.
Preferably, the Cas protein comprises any one or a combination of at least two of AsCas12a, lbCas12a, fnCas12a, aaCas12b, bhCas12b or AkCas12 b.
As a preferred embodiment of the invention, the crRNA comprises additional mismatched bases on its sequence.
The additional mismatched base refers to a mismatched base that is not complementary to the target sequence, except for the mutation site. In other words, the crRNA is complementary or mismatched to the mutation site of the wild-type and mutant genes, respectively, and can be detected without additional mismatches, which, however, can amplify the signal difference.
Preferably, the number of the additional mismatched bases is 1 to 3, for example, 1, 2 or 3.
Preferably, the additional mismatched base is adjacent to the mutation site. Introducing the additional mismatched base can further increase the signal difference, and the mismatch can be adjacent to the mutant base or can be separated from the mutant base by several bases; theoretically, the effect is better and the signal difference is more obvious when adjacent.
Preferably, the working concentration of the crRNA is 0.3 to 0.6. Mu.M, for example, 0.3. Mu.M, 0.35. Mu.M, 0.4. Mu.M, 0.45. Mu.M, 0.5. Mu.M, 0.55. Mu.M, or 0.6. Mu.M, and the like, and preferably 0.4. Mu.M.
Preferably, the working concentration of the Cas protein is 0.1 to 0.5 μm, for example, 0.1 μm, 0.15 μm, 0.2 μm, 0.25 μm, 0.3 μm, 0.35 μm, 0.4 μm, 0.45 μm or 0.5 μm, etc., preferably 0.2 μm.
Preferably, the CRISPR-Cas detection system of step (2) further comprises a probe DNA.
Preferably, the probe DNA is modified at the 5 'end with a fluorescent group and modified at the 3' end with a quenching group. For probe DNA, theoretically, the smaller the number of bases is, the better the quenching effect is, and the lower the fluorescence background is; the choice of the fluorescent group and the quenching group is not limited, and the function of the probe DNA can be realized.
As a preferred technical scheme of the invention, the SNP typing detection method comprises the following steps:
(1) Introducing PAM sequence at the 5' end of the target nucleic acid mutation site by PCR amplification;
the PCR amplification system comprises DNA polymerase, dNTPs, a reverse primer and a forward primer containing a PAM sequence, wherein the molar ratio of the forward primer to the reverse primer is (1-1.5): 1;
(2) Performing SNP typing detection on the amplification product obtained in the step (1) by using a CRISPR-Cas detection system;
wherein the CRISPR-Cas detection system comprises Cas protein, crRNA and probe DNA, and the volume ratio of the amplified product to the CRISPR-Cas detection system is 1 (3-5).
In a second aspect, the invention provides a kit for detection using the SNP typing detection method as described in the first aspect, the kit comprising a PCR amplification system and a CRISPR-Cas detection system.
Preferably, the PCR amplification system comprises forward primers, reverse primers, DNA polymerase and dNTPs.
Preferably, the CRISPR-Cas detection system comprises a Cas protein, a crRNA and a probe.
Preferably, the probe is modified at the 5 'end with a fluorescent group and at the 3' end with a quenching group.
In a third aspect, the present invention also provides a method for genotyping the SNP typing detection method as set forth in the first aspect or the use of the kit as set forth in the second aspect in genotyping detection.
The numerical ranges recited herein include not only the recited point values, but also any point values between the recited numerical ranges that are not recited, and are limited to, and for the sake of brevity, the invention is not intended to be exhaustive of the specific point values that the recited range includes.
Compared with the prior art, the invention has at least the following beneficial effects:
(1) The invention provides a SNP typing detection method based on a CRISPR-Cas system, which is characterized in that an amplification product with a PAM sequence is obtained through a proper amplification method, the CRISPR-Cas detection system is combined, and matched crRNA is designed to detect mutation sites; in addition, if extra mismatched bases are added in crRNA, signal difference can be further increased, and accuracy of detection results is improved;
(2) The SNP typing detection method can realize on-site detection without a large instrument, and can judge the mutation type of the target gene, including wild type, homozygous mutation, heterozygous mutation and the like, in a short time of 10-15 minutes only through the change of fluorescent signals after amplifying the target gene;
(3) The CRISPR-Cas system is applied to SNP parting detection, so that parting detection can be realized no matter whether the target DNA to be detected contains a PAM sequence or not, and universality is realized; and because of the low cost of the CRISPR-Cas12a detection system, compared with other SNP typing detection technologies, the method provided by the invention has lower cost and is suitable for large-scale popularization and use.
Drawings
FIG. 1 is a schematic diagram of the detection principle of the SNP typing detection method provided by the invention; wherein, 1-a_crRNA,2-g_crRNA, 3-cleaved fluorescent probe and 4-uncleaved fluorescent probe.
FIG. 2 is a graph showing fluorescence signals obtained when detecting a wild-type A/A sample in example 1.
FIG. 3 is a graph showing fluorescence signals obtained when detecting a G/G sample in example 1.
FIG. 4 is a graph showing fluorescence signals obtained when A/G samples were tested in example 1.
Detailed Description
The following embodiments are further described with reference to the accompanying drawings, but the following examples are merely simple examples of the present invention and do not represent or limit the scope of the invention, which is defined by the claims.
The specific techniques or conditions are not identified in the examples and are described in the literature in this field or are carried out in accordance with the product specifications. The reagents or apparatus used were conventional products commercially available through regular channels, with no manufacturer noted.
First, the simple principle of the SNP typing detection method provided in the present invention will be described with reference to fig. 1:
in the invention, the forward/reverse primer with PAM sequence is used for PCR amplification of the gene to be detected, thus obtaining the amplified product with PAM sequence. Then, two crrnas for mutation sites were designed based on CRISPR-Cas system, a_crrna1 and g_crrna2 were designed, respectively, taking wild type as base a and mutant type as base G as an example.
Due to the high specificity of the CRISPR-Cas nucleic acid detection method when reacting with the CRISPR-Cas system, the detection system can rapidly generate a strong fluorescent signal if the crRNA matches with the base of the post-mutation site of the PAM sequence; in contrast, when the crRNA is mismatched with the bases of the mutation sites, the cleavage activity of the CRISPR system is greatly affected, and the detection system cannot generate fluorescent signals.
Therefore, in the figure, a_crr1 is in base matching with a mutation site A, so that the fluorescent probe is cut, the cut fluorescent probe 3 generates a strong fluorescent signal, the fluorescent intensity is obviously increased, and g_crr1 is in base mismatch with the mutation site A, so that the fluorescent probe is not cut, the uncleaved fluorescent probe 4 cannot generate fluorescence, and the fluorescent intensity is basically unchanged; after a fluorescence intensity curve graph of the system is obtained, whether the type of the site is a wild type A base or a mutant type G base can be judged according to the fluorescence curve graph, so that rapid and convenient SNP typing detection is realized.
Example 1
The embodiment provides a SNP typing detection method based on a CRISPR-Cas system, and experiments are carried out by taking a P450 gene (rs 1048943) of a CPY1A1 gene as an example. The 5' end of the mutation site of the target gene does not contain a PAM sequence, so that the PAM site needs to be introduced by using a forward primer when designing the primer.
Wherein, the P450 gene of the CPY1A1 gene is at the 4889 gene locus of the seventh exon, and the A base can be mutated into the G gene, thereby forming three genotypes:
1. wild type a/a (neither chromosome mutated);
2. heterozygous mutation a/G (mutation in one of the two chromosomes);
3. homozygous mutant G/G (both chromosomes are mutated).
Therefore, the standard DNA sequences are shown as SEQ ID NO. 1 and SEQ ID NO. 2;
the A/A standard sequence is shown in SEQ ID NO. 1 (the mutation gene locus is underlined):
5′-ACGGTTTCTCACCCCTGATGGTGCTATCGACAAGGTGTTAAGTGAGAAGGTGATTATCTTTGGCATGGGCAAGCGGAAGTGTATCGGTGAGACCATTGCCCGCTGGGAGGTCTTTCTCTT-3′；
the G/G standard sequence is shown in SEQ ID NO. 2 (the mutation gene locus is underlined):
5′-ACGGTTTCTCACCCCTGATGGTGCTATCGACAAGGTGTTAAGTGAGAAGGTGATTATCTTTGGCATGGGCAAGCGGAAGTGTATCGGTGAGACCGTTGCCCGCTGGGAGGTCTTTCTCTT-3′。
the specific steps of SNP typing detection are as follows:
(1) Introducing PAM sequence at the 5' end of the mutation site by PCR amplification;
the sequence of the forward primer used for amplification is shown in SEQ ID NO. 3: 5' -AAGAGAAAGACCTCCCAGTTTGCAA-3' (wherein the PAM sequence introduction site is shown underlined);
the sequence of the reverse primer used for amplification is shown in SEQ ID NO. 4: 5'-CACCCCTGATGGTGCTATCGACAAG-3'
Using a 100. Mu.L amplification system as an example, A/A, G/G and 1:1 mixed analog A/G samples were amplified as shown in Table 1 below:
TABLE 1
Wherein the template DNA is A/A standard sequence, G/G standard sequence and 1:1 mixed analog A/G sample respectively.
(2) The nucleic acid amplification process is realized by using a Veriti PCR amplification instrument of Thermo Fisher Science company, and the parameters are set to be denaturation at 95 ℃ for 30s, annealing at 50 ℃ for 30s and extension at 72 ℃ for 20s, and the cycle is repeated for 40 times;
taking 5 mu L of the three amplification products obtained in the step (1) respectively, and adding a CRISPR-Cas detection system to carry out genotyping detection:
the sequence of the a_crRNA is shown as SEQ ID NO. 5:
UAAUUUCUACUAAGUGUAGAUCAAUuGUCUCACCGAUACAC；
the sequence of the g_crRNA is shown as SEQ ID NO: 6:
UAAUUUCUACUAAGUGUAGAUCAACuGUCUCACCGAUACAC；
wherein, the underlined shows the crRNA differences corresponding to the mutation sites; lower case u is an additionally introduced mismatched base.
The mismatched base is also not complementary to the target sequence, and is an additional introduced mismatch, and introduction of the mismatched base can further increase the signal difference.
The sequence of the probe ssDNA (SEQ ID NO: 7) is: 5'-FAM-TTATT-BHQ1-3'.
CRISPR-Cas detection system containing a_crrna (20 μl) is shown in table 2 below:
TABLE 2
| Component (A) | Volume of |
| LbCAs12a protein (1.0 mu M) | 5μL |
| a_crRNA(5.0μM) | 2μL |
| Probe ssDNA (10. Mu.M) | 0.5μL |
| 10×Buffer | 2.0μL |
| Enzyme-free water | 5.5μL |
CRISPR-Cas detection system containing g_crrna (20 μl) is shown in table 3 below:
TABLE 3 Table 3
| Component (A) | Volume of |
| LbCAs12a protein (1.0 mu M) | 5μL |
| g_crRNA(5.0μM) | 2μL |
| Probe ssDNA | 0.5μL |
| 10×Buffer | 2.0μL |
| Enzyme-free water | 5.5μL |
The final detection results are shown in fig. 2, 3 and 4.
For the A/A sample, as shown in FIG. 2, it can be seen that the curve signal increase rate corresponding to the a_RNA is significantly greater than the curve corresponding to the g_RNA; for the G/G samples, as shown in FIG. 3, it can be seen from the graph that the curve signal growth rates corresponding to the a_RNA and the g_RNA are obviously opposite to those of the A/A samples; for the A/G sample, as shown in FIG. 4, the curve signal growth rates corresponding to the a_RNA and the g_RNA are obviously increased as can be seen from the graph; therefore, the method provided by the invention can be used for quickly and accurately carrying out typing detection on SNP loci, has accurate detection results and high efficiency, and can be completed without the assistance of large-scale instruments and equipment.
Example 2
The embodiment provides a SNP typing detection method based on a CRISPR-Cas system, and experiments are carried out by taking an ALDH2 gene (rs 671) as an example, and the gene sequence contains a PAM sequence at the 5' end of a mutation site, so that no additional PAM sequence is required to be introduced, and CRISPR detection is directly carried out after amplification.
Wherein, the 37030 gene locus of the ALDH2 gene, the G base can be mutated into the A gene, thereby forming three genotypes:
1. wild type G/G (neither chromosome mutated);
2. heterozygous mutation G/a (mutation in one of the two chromosomes);
3. homozygous mutant A/A (both chromosomes are mutated).
The G/G standard sequence (SEQ ID NO: 8) is:
5′-GTAACCCATAACCCCCAAGAGTGATTTCTGCAATCTCGTTTCAAATTACAGGGTCAACTGCTATGATGTGTTTGGAGCCCAGTCACCCTTTGGTGGCTACAAGATGTCGGGGAGTGGCCGGGAGTTGGGCGAGTACGGGCTGCAGGCATACACTGAAGTGAAAACTGTGAGTGTGGGACC-3′；
the A/A standard sequence (SEQ ID NO: 9) is:
5′-GTAACCCATAACCCCCAAGAGTGATTTCTGCAATCTCGTTTCAAATTACAGGGTCAACTGCTATGATGTGTTTGGAGCCCAGTCACCCTTTGGTGGCTACAAGATGTCGGGGAGTGGCCGGGAGTTGGGCGAGTACGGGCTGCAGGCATACACTAAAGTGAAAACTGTGAGTGTGGGACC-3′；
the sequence of the forward primer used for amplification is shown in SEQ ID NO. 10: 5' -GGTCCCACACTCACAGTTTTCACTT-3' (wherein the PAM sequence introduction site is shown underlined);
the sequence of the reverse primer used for amplification is shown in SEQ ID NO. 11: 5'-GTAACCCATAACCCCCAAGAGTGA-3';
the sequence of the a_crRNA is shown as SEQ ID NO. 12:
UAAUUUCUACUAAGUGUAGAUACUUUuGUGUAUGCCUGCAG；
the sequence of the g_crRNA is shown as SEQ ID NO: 13:
UAAUUUCUACUAAGUGUAGAUACUUCuGUGUAUGCCUGCAG；
wherein, the difference of crRNA corresponding to the mutation site is shown under the dash, and the lower case u is the mismatch base additionally introduced.
The sequence of the probe ssDNA (SEQ ID NO: 14) is: 5'-FAM-TTATT-BHQ1-3'.
Example 3
The embodiment provides a SNP typing detection method based on a CRISPR-Cas system, and experiments are carried out by taking NAT2 x 6 (G590A) (rs 1799930) as an example, and the gene sequence contains two T bases at the 5' end of a mutation site, so that the PAM sequence can be introduced only by changing one adjacent base, and CRISPR detection is directly carried out after amplification.
Wherein, the 9312 gene locus of NAT2 gene, G base can be mutated into A gene, thus forming three genotypes:
1. wild type G/G (neither chromosome mutated);
2. homozygous mutant A/A (both chromosomes are mutated);
3. heterozygous mutation G/A (mutation occurs in one of the two chromosomes).
The G/G standard sequence (SEQ ID NO: 15) is:
5′-CCCAGATGTGGCAGCCTCTAGAATTAATTTCTGGGAAGGATCAGCCTCAGGTGCCTTGCATTTTCTGCTTGACAGAAGAGAGAGGAATCTGGTACCTGGACCAAATCAGGAGAGAGCAGTATATTACAAACAAAGAATTTCTTAATTCTCATCTCCTGCCAAAGAAGAAACACCAAAAAATATACTTATTTACGCTTGAACCTCGAACAATTGAAGATTTTGAGTCTATGAAT-3′；
the A/A standard sequence (SEQ ID NO: 16) is:
5′-CCCAGATGTGGCAGCCTCTAGAATTAATTTCTGGGAAGGATCAGCCTCAGGTGCCTTGCATTTTCTGCTTGACAGAAGAGAGAGGAATCTGGTACCTGGACCAAATCAGGAGAGAGCAGTATATTACAAACAAAGAATTTCTTAATTCTCATCTCCTGCCAAAGAAGAAACACCAAAAAATATACTTATTTACGCTTGAACCTCAAACAATTGAAGATTTTGAGTCTATGAAT-3′；
the sequence of the forward primer used for amplification is shown in SEQ ID NO. 17:
5′-ATTCATAGACTCAAAATCTTCATTTGTT-3' (wherein the PAM sequence introduction site is shown underlined);
the sequence of the reverse primer used for amplification is shown as SEQ ID NO. 18:
5′-CCCAGATGTGGCAGCCTCTAGAATTAAT-3′；
the sequence of the a_crRNA is shown as SEQ ID NO. 19:
UAAUUUCUACUAAGUGUAGAUUUUuAGGUUCAAGCGUAAAUAAGUAUAUUUUU；
the sequence of the g_crRNA is shown as SEQ ID NO: 20:
UAAUUUCUACUAAGUGUAGAUUUCuAGGUUCAAGCGUAAAUAAGUAUAUUUUU；
wherein, the difference of crRNA corresponding to the mutation site is shown under the dash, and the lower case u is the mismatch base additionally introduced.
The sequence of the probe ssDNA (SEQ ID NO: 21) is: 5'-FAM-TTATT-BHQ1-3'.
In summary, the invention provides the SNP typing detection method, which combines with the CRISPR-Cas system to detect the DNA to be detected, rapidly and accurately completes SNP typing.
The applicant declares that the above is only a specific embodiment of the present invention, but the scope of the present invention is not limited thereto, and it should be apparent to those skilled in the art that any changes or substitutions that are easily conceivable within the technical scope of the present invention disclosed by the present invention fall within the scope of the present invention and the disclosure.
SEQUENCE LISTING
<110> university of south science and technology
<120> SNP typing detection method based on CRISPR-Cas system and application thereof
<130> 20201110
<160> 21
<170> PatentIn version 3.3
<210> 1
<211> 120
<212> DNA
<213> Synthesis
<400> 1
acggtttctc acccctgatg gtgctatcga caaggtgtta agtgagaagg tgattatctt 60
tggcatgggc aagcggaagt gtatcggtga gaccattgcc cgctgggagg tctttctctt 120
<210> 2
<211> 120
<212> DNA
<213> Synthesis
<400> 2
acggtttctc acccctgatg gtgctatcga caaggtgtta agtgagaagg tgattatctt 60
tggcatgggc aagcggaagt gtatcggtga gaccgttgcc cgctgggagg tctttctctt 120
<210> 3
<211> 25
<212> DNA
<213> Synthesis
<400> 3
aagagaaaga cctcccagtt tgcaa 25
<210> 4
<211> 25
<212> DNA
<213> Synthesis
<400> 4
cacccctgat ggtgctatcg acaag 25
<210> 5
<211> 41
<212> RNA
<213> Synthesis
<400> 5
uaauuucuac uaaguguaga ucaauugucu caccgauaca c 41
<210> 6
<211> 41
<212> RNA
<213> Synthesis
<400> 6
uaauuucuac uaaguguaga ucaacugucu caccgauaca c 41
<210> 7
<211> 5
<212> DNA
<213> Synthesis
<400> 7
ttatt 5
<210> 8
<211> 180
<212> DNA
<213> Synthesis
<400> 8
gtaacccata acccccaaga gtgatttctg caatctcgtt tcaaattaca gggtcaactg 60
ctatgatgtg tttggagccc agtcaccctt tggtggctac aagatgtcgg ggagtggccg 120
ggagttgggc gagtacgggc tgcaggcata cactgaagtg aaaactgtga gtgtgggacc 180
<210> 9
<211> 180
<212> DNA
<213> Synthesis
<400> 9
gtaacccata acccccaaga gtgatttctg caatctcgtt tcaaattaca gggtcaactg 60
ctatgatgtg tttggagccc agtcaccctt tggtggctac aagatgtcgg ggagtggccg 120
ggagttgggc gagtacgggc tgcaggcata cactaaagtg aaaactgtga gtgtgggacc 180
<210> 10
<211> 25
<212> DNA
<213> Synthesis
<400> 10
ggtcccacac tcacagtttt cactt 25
<210> 11
<211> 24
<212> DNA
<213> Synthesis
<400> 11
gtaacccata acccccaaga gtga 24
<210> 12
<211> 41
<212> RNA
<213> Synthesis
<400> 12
uaauuucuac uaaguguaga uacuuuugug uaugccugca g 41
<210> 13
<211> 41
<212> RNA
<213> Synthesis
<400> 13
uaauuucuac uaaguguaga uacuucugug uaugccugca g 41
<210> 14
<211> 5
<212> DNA
<213> Synthesis
<400> 14
ttatt 5
<210> 15
<211> 233
<212> DNA
<213> Synthesis
<400> 15
cccagatgtg gcagcctcta gaattaattt ctgggaagga tcagcctcag gtgccttgca 60
ttttctgctt gacagaagag agaggaatct ggtacctgga ccaaatcagg agagagcagt 120
atattacaaa caaagaattt cttaattctc atctcctgcc aaagaagaaa caccaaaaaa 180
tatacttatt tacgcttgaa cctcgaacaa ttgaagattt tgagtctatg aat 233
<210> 16
<211> 233
<212> DNA
<213> Synthesis
<400> 16
cccagatgtg gcagcctcta gaattaattt ctgggaagga tcagcctcag gtgccttgca 60
ttttctgctt gacagaagag agaggaatct ggtacctgga ccaaatcagg agagagcagt 120
atattacaaa caaagaattt cttaattctc atctcctgcc aaagaagaaa caccaaaaaa 180
tatacttatt tacgcttgaa cctcaaacaa ttgaagattt tgagtctatg aat 233
<210> 17
<211> 28
<212> DNA
<213> Synthesis
<400> 17
attcatagac tcaaaatctt catttgtt 28
<210> 18
<211> 28
<212> DNA
<213> Synthesis
<400> 18
cccagatgtg gcagcctcta gaattaat 28
<210> 19
<211> 53
<212> RNA
<213> Synthesis
<400> 19
uaauuucuac uaaguguaga uuuuuagguu caagcguaaa uaaguauauu uuu 53
<210> 20
<211> 53
<212> RNA
<213> Synthesis
<400> 20
uaauuucuac uaaguguaga uuucuagguu caagcguaaa uaaguauauu uuu 53
<210> 21
<211> 5
<212> DNA
<213> Synthesis
<400> 21
ttatt 5
Claims (9)
1. The SNP typing detection method based on the CRISPR-Cas12a system is characterized by comprising the following steps:
(1) Amplifying target nucleic acid, wherein the 5' end of a mutation site on the obtained amplified product comprises a PAM sequence;
(2) Performing SNP typing detection on the amplification product obtained in the step (1) by using a CRISPR-Cas12a detection system;
the amplification method in the step (1) is PCR amplification;
the PCR amplification system comprises: a DNA polymerase, dntps, a reverse primer, and a forward primer comprising a PAM sequence;
the molar ratio of the forward primer to the reverse primer is 1.5:1;
the target nucleic acid is the rs1048943 locus of the CPY1A1 gene, and the A base is mutated into the G base, so that three genotypes are formed:
a. wild type A/A;
b. heterozygous mutation A/G;
c. homozygous mutant G/G;
the standard sequence of the wild type A/A is shown as SEQ ID NO. 1;
the homozygous mutant G/G standard sequence is shown as SEQ ID NO. 2;
the sequence of the forward primer used for amplification is shown as SEQ ID NO. 3;
the sequence of the reverse primer used for amplification is shown as SEQ ID NO. 4;
the sequence of the a_crRNA in the CRISPR-Cas12a detection system is shown as SEQ ID NO. 5;
the sequence of the g_crRNA in the CRISPR-Cas12a detection system is shown as SEQ ID NO. 6;
the CRISPR-Cas12a detection system of step (2) further comprises a probe DNA;
the 5 'end of the probe DNA is modified with a fluorescent group, and the 3' end is modified with a quenching group.
2. The CRISPR-Cas12a system-based SNP typing detection method according to claim 1, wherein the PCR amplification conditions are:
denaturation at 94-98 ℃ for 25-30 s, annealing at 45-55 ℃ for 25-30 s, extension at 70-72 ℃ for 20-30 s, and circulation for 30-40 times.
3. The CRISPR-Cas12a system-based SNP typing detection method according to claim 1, wherein the PCR amplification conditions are:
denaturation at 95℃for 30s, annealing at 50℃for 30s, elongation at 72℃for 20s, and circulation 40 times.
4. The SNP typing detection method based on the CRISPR-Cas12a system according to claim 1, wherein the volume ratio of the amplification product obtained in the step (1) to the CRISPR-Cas12a detection system is 1 (3-5).
5. The CRISPR-Cas12a system-based SNP typing detection method of claim 1, wherein the Cas protein of the CRISPR-Cas12a detection system is LbCas12a.
6. The SNP typing detection method based on the CRISPR-Cas12a system of claim 1, wherein the crRNA of the CRISPR-Cas12a detection system has a working concentration of 0.3-0.6 μm.
7. The method for SNP typing detection based on CRISPR-Cas12a system according to claim 6, wherein the working concentration of crRNA of the CRISPR-Cas12a detection system is 0.4 μΜ.
8. The SNP typing detection method based on the CRISPR-Cas12a system of claim 1, wherein the working concentration of Cas protein of the CRISPR-Cas12a detection system is 0.1-0.5 μm.
9. The method for SNP typing detection based on the CRISPR-Cas12a system according to claim 8, wherein the working concentration of Cas protein of the CRISPR-Cas12a detection system is 0.2 μΜ.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011613279.2A CN112980933B (en) | 2020-12-30 | 2020-12-30 | SNP (Single nucleotide polymorphism) typing detection method based on CRISPR-Cas (CRISPR-Cas) system and application of SNP typing detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011613279.2A CN112980933B (en) | 2020-12-30 | 2020-12-30 | SNP (Single nucleotide polymorphism) typing detection method based on CRISPR-Cas (CRISPR-Cas) system and application of SNP typing detection method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112980933A CN112980933A (en) | 2021-06-18 |
| CN112980933B true CN112980933B (en) | 2023-08-29 |
Family
ID=76345183
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011613279.2A Active CN112980933B (en) | 2020-12-30 | 2020-12-30 | SNP (Single nucleotide polymorphism) typing detection method based on CRISPR-Cas (CRISPR-Cas) system and application of SNP typing detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112980933B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113388691B (en) * | 2021-07-23 | 2022-08-30 | 中国疾病预防控制中心传染病预防控制所 | Nucleic acid detection method based on PCR amplification and CRISPR-Cas12a and application |
| CN113897416B (en) * | 2021-12-09 | 2022-05-20 | 上海科技大学 | CRISPR/Cas12f detection system and application thereof |
| CN116286734B (en) * | 2022-11-29 | 2024-04-02 | 武汉大学 | Mutant of wild LbCAs12a protein and SNP detection application |
| CN116732167B (en) * | 2023-07-28 | 2023-12-08 | 湖南永和阳光生物科技股份有限公司 | AD carrying gene detection method based on CRISPR gene editing technology |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110923314A (en) * | 2019-12-30 | 2020-03-27 | 广州白云山拜迪生物医药有限公司 | Primer group for detecting SNP locus rs9263726, crRNA sequence and application thereof |
| CN111455046A (en) * | 2020-03-13 | 2020-07-28 | 深圳市罗湖区人民医院 | Nucleic acid detection method for mutation of ADGRG6 enhancer and kit thereof |
| CN111662968A (en) * | 2020-06-23 | 2020-09-15 | 南方科技大学 | Detection method of PAM-sequence-free DNA based on CRISPR and application thereof |
| CN111808947A (en) * | 2020-07-13 | 2020-10-23 | 中南大学 | CRISPR-Cas system for diagnosing spinal muscular atrophy and application thereof |
| CN111808931A (en) * | 2020-07-15 | 2020-10-23 | 南方科技大学 | One-step RPA-CRISPR nucleic acid detection method, kit and application |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE102010025496A1 (en) * | 2009-10-09 | 2011-04-21 | Universität Duisburg-Essen | Method for the detection of gene alterations, in particular mutations |
| US11041165B2 (en) * | 2012-10-31 | 2021-06-22 | Two Blades Foundation | Identification of a Xanthomonas euvesicatoria resistance gene from pepper (Capsicum annuum) and method for generating plants with resistance |
-
2020
- 2020-12-30 CN CN202011613279.2A patent/CN112980933B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110923314A (en) * | 2019-12-30 | 2020-03-27 | 广州白云山拜迪生物医药有限公司 | Primer group for detecting SNP locus rs9263726, crRNA sequence and application thereof |
| CN111455046A (en) * | 2020-03-13 | 2020-07-28 | 深圳市罗湖区人民医院 | Nucleic acid detection method for mutation of ADGRG6 enhancer and kit thereof |
| CN111662968A (en) * | 2020-06-23 | 2020-09-15 | 南方科技大学 | Detection method of PAM-sequence-free DNA based on CRISPR and application thereof |
| CN111808947A (en) * | 2020-07-13 | 2020-10-23 | 中南大学 | CRISPR-Cas system for diagnosing spinal muscular atrophy and application thereof |
| CN111808931A (en) * | 2020-07-15 | 2020-10-23 | 南方科技大学 | One-step RPA-CRISPR nucleic acid detection method, kit and application |
Non-Patent Citations (1)
| Title |
|---|
| CRISPR-Cas12a-assisted nucleic acid detection;Li等;《Cell Discovery》;20180424;第1页左栏第2段-第3页左栏第2段、补充材料方法部分 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112980933A (en) | 2021-06-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112980933B (en) | SNP (Single nucleotide polymorphism) typing detection method based on CRISPR-Cas (CRISPR-Cas) system and application of SNP typing detection method | |
| US11519028B2 (en) | Compositions and methods for identifying nucleic acid molecules | |
| EP3115468B1 (en) | Increasing confidence of allele calls with molecular counting | |
| US7638280B2 (en) | Method for detecting mutations and/or polymorphisms | |
| US7175985B1 (en) | Method of detecting variation or polymorphism | |
| US20060172324A1 (en) | Methods of genotyping using differences in melting temperature | |
| US20030082566A1 (en) | Method for determining allele frequencies | |
| US20070207494A1 (en) | Method for detecting mutated polynucleotides within a large population of wild-type polynucleotides | |
| CN110607356B (en) | Genome editing detection method, kit and application | |
| US20200277654A1 (en) | Method for Detecting multiple DNA Mutations and Copy Number Variations | |
| CN112029837A (en) | Kit for detecting SNP (Single nucleotide polymorphism) sites based on locked nucleic acid modified recombinase-mediated isothermal amplification method and detection method thereof | |
| CN110699425B (en) | Enrichment method and system of gene target region | |
| CN110295218B (en) | Method for quantifying mutant allele burden of target gene | |
| US20180237853A1 (en) | Methods, Compositions and Kits for Detection of Mutant Variants of Target Genes | |
| CN108624652A (en) | Multiple pyrophosphorylation activity polymerisation expands the substantially identical template of the multiple sequences of unit point in being reacted at one | |
| KR20030042581A (en) | Method for improving discrimination between allele primers in allele-specific primer extension | |
| KR101731619B1 (en) | Polynucleotide marker composition for identifying father and daughter and its use | |
| CN111549120A (en) | ALDH2 gene G1510A locus typing method without nucleic acid amplification and used probe and reaction system | |
| WO2006070666A1 (en) | Method of simultaneously detecting gene polymorphisms | |
| CN114686581A (en) | Detection method and kit for 19bp insertion mutation of DHFR gene intron and use method of kit | |
| CN114686583A (en) | Detection method and kit for RFC gene 80GA mutation site and use method thereof | |
| AU2021302551A1 (en) | Detection of methylation status | |
| CN117448441A (en) | Single nucleotide polymorphism isothermal typing method based on RNase HII enzyme dependency-locked nucleic acid-blocking probe-loop-mediated isothermal amplification | |
| KR20150009658A (en) | Composition for identifying primate species or primate individual marker using minisatellite of SCK/SLI gene | |
| CN115873926A (en) | Single nucleic acid for real-time detection of SNP for analyzing ApoE gene and detection method using same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |