CN101033487A - Method of detecting KLK1 gene rs5517 polymorphism correlated to primary hypertension - Google Patents

Abstract

The invention relates to a method for detecting KLK1gene rs5517 polymorphism relating to essential hypertension. The method includes detecting A/G polymorphism located at 3812 bp of KLK1 gene coding sequence, in which, the distributed frequency of allele A has positive correlation with the risk rate of essential hypertension. The invention also involves the kits to detect rs5517 polymorphism of KLK1 gene.

Description

Detect the KLK1 gene rs5517 polymorphic method relevant with essential hypertension

Technical field

The present invention relates to a kind of essential hypertension dependency gene and detection method and purposes.More particularly, the present invention relates to KLK1 gene rs5517 polymorphic detection method and the purposes relevant, for example the purposes in the reagent of preparation hypertensive reagent of diagnosing primary or judgement trouble essential hypertension relative risk with essential hypertension.The invention still further relates to and detect the relevant polymorphic test kit of KLK1 gene rs5517 of essential hypertension.

Background technology

The tissue kallikrein gene English name is kallikrein 1, and renal/pancreas/salivary (abbreviation: KLK1), its protein product: tissue kallikrein.KLK1 gene clone in 1988 is positioned human chromosome 19q13.3, is about 5kb, comprises 5 exons.

Kallikrein is one group of serine protease that is present in different tissues and the body fluid, comprises plasma kallikrein and tissue kallikrein.Tissue kallikrein extensively is present in many tissues such as kidney, pancreas, gastrointestinal tract mucous and central nervous system, it is synthetic in tissue with the form of prekallikrein, activate the formative tissue kallikrein through trypsinase again, and can be released into blood circulation.Tissue kallikrein acts on prokinin, makes it to discharge to generate the active result pancreokinin, and can enter blood plasma, generates bradykinin through the aminopeptidase hydrolysis.Have special receptor bound energy rising nitrogen protoxide (NO) on vasoactive bradykinin and the target organ, prostacyclin, EDHF (the endothelium derivation hyperpolarization factor) and tPA, produce vasodilation, bring high blood pressure down, a series of biological effects such as antiproliferative, anti-oxidation stress.The generation of kassinin kinin depends primarily on the activity and the quantity of kallikrein.

Bradykinin and pancreokinin are one of vasodilator substances the strongest in the body.The intravenous injection bradykinin can cause the diastole of whole body arteriole, significantly reduces the peripheral blood vessel circulation resistance, and vascular permeability strengthens, thereby causes blood pressure drops.Bradykinin also has powerful diuresis sodium effect, and the renal blood flow amount is increased, and PCP increases, and suppress uriniferous tubules and absorb again, and by stimulating afferent glomerular arteriole pressure receptor and macula densa to produce the effect of diuresis sodium.On the other hand, bradykinin can suppress distal renal tubular sodium and water are heavily absorbed and suppress the effect of antidiuretic hormone, thereby promotes the water sodium excretion.

At part primary hypertension patient and spontaneous hypertensive rat, the level of kallikrein all significantly reduces in the urine.Epidemiological study finds that also the kallikrein level is low than white man in Black people's urine, and the hypertensive sickness rate of Black people is also than white man's height.Essential hypertension and renal hypertension patient, blood vessel strengthens the step-down significant reaction of bradykinin, thereby prompting lacks the endogenous kassinin kinin.Other has the research report, and the antihypertensive function of angiotensin converting enzyme inhibitor increases relevant with kassinin kinin level in the body.Because use kassinin kinin antibody simultaneously, its hypotensive effect just obviously weakens.After low renin type essential hypertension was used angiotensin converting enzyme inhibitor, the kidney kallikrein kinin system is active to be increased, and the renal blood flow amount increases simultaneously, had report to think that its hypotensive effect mainly is owing to increased the plasmakinin level.Therefore, essential hypertension may be lowly relevant with the tissue kallikrein systematicness.

Molecule genetics research finds, (single nucleotidepolymorphism SNP) can modify the function of individual gene to mononucleotide polymorphic, causes the hypertension phenotype of determining.Infer that thus the base mutation on the DNA may change the expression of specific gene or the function of its proteins encoded.Studies show that in spontaneously hypertensive rat model, the KLK1 gene polymorphic is relevant with blood pressure regulation.Transgenic animal cross expresses human KLK1 gene generation ypotension phenotype.Afterwards, one is studies show that of basis with 57 Utah, in dominant allele and the urine tissue kallikrein's activity increase with hypertension incidence dangerous reduce relevant, prompting influence that key-gene effect of UK excretory can explain that this proterties always makes a variation 51%.Berge in 1991 and Berg have reported in the TaqI of Norwegian's group discovery restriction fragment length polymorphism and Arg53His missense mutation, but have not found that TaqI is polymorphic related with the blood pressure existence.HYPERGENE in the works people such as Slim study Arg53His is polymorphic, find that the urine tissue kallikrein activity of this polymorphic heterozygous individual is significantly higher than other individualities.Richards etc. and Song etc. are the Caucasian, non-descendants American and Aisa people find in 108 objects altogether, have a polymorphic zone before the KLK1 gene 5 ' regional transcription initiation site between-121 to-133 Nucleotide, afterwards discover that this polymorphic zone is relevant with hypertension.

Rs5517 is positioned at KLK1 gene the 4th exon, and is polymorphic for A/G, and (Lys is AAA) to L-glutamic acid (Glu, change GAA) can to cause the 186th amino acid lysine.Relation between KLK1 gene rs5517 site variation at present and essential hypertension, and detection method, test kit and the application prospect in prediction and new drug development thereof that should make a variation still do not have patent report both at home and abroad.

Summary of the invention

The present invention relates to detect the KLK1 gene rs5517 polymorphic method relevant with essential hypertension, this method comprises the A/G polymorphism of 3812 (the 60th bit bases of the 4th exon) detecting the KLK1 gene coded sequence, wherein the ill relative risk of allelic distribution frequency of A and essential hypertension is proportionate, the distribution frequency that is allelotrope A is high more, and the relative risk of suffering from essential hypertension is high more.

Pleomorphism site of the present invention by biomedical data storehouse-NIH of world authority (NCBI, Http:// www.ncbi.nlm.nih.gov) include, be the variation of A/G, (Lys is AAA) to L-glutamic acid (Glu, change GAA) can to cause the 186th amino acid lysine.This polymorphic the 4th exon that is positioned at the KLK1 gene, exon sequence is as follows, and wherein the 60th of marking of italics is rs5517 (referring to Fig. 2).This pleomorphism site can be determined by unique on human genome, be positioned 3812 of genes encoding.Polymorphic gene of the present invention and encoded protein thereof be respectively referring to the SEQID NO:1 in the sequence table, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4.

Polymorphism is meant on the locus and has a plurality of allelotrope.On some locus, body can have two allelotrope one by one.Epidemiological study shows that essential hypertension is relevant with inherited genetic factors, and father and mother are starkly lower than the probability that father and mother all have the hyperpietic for its children of normal arterial pressure person suffer from hypertensive probability.The contriver is by selecting Jilin, Beijing, Shandong, Shaanxi, Guizhou, Fujian, Hubei, Sichuan, Guangxi etc. 2411 of totally 9 provinces and cities independently hypertension is individual and age-based, sex, independently contrast is individual for 2348 of residence couplings, the laggard performing PCR amplification target gene of taking a sample, and carry out the restriction fragment length polymorphism analysis, wherein genotype is GG person, case group and control group respectively have 808 and 859 examples, genotype is AG person, case group and control group have 1114 example and 1094 examples respectively, and genotype is AA person, and case group and control group have 451 example and 364 examples respectively, the A gene frequency of case group is 42.48%, the A gene frequency of control group is 39.32%, and the P value is 0.0019, has the significance difference.It is the highest that AA genotype person suffers from hypertensive probability, under allelic recessive model with respect to A, compare with G allelotrope carrier (AG and GG genotype person), it is 1.26 times that AA genotype carrier suffers from hypertensive danger, has shown that KLK1 gene rs5517 polymorphic (A/G) is relevant with essential hypertension.Judge thus, the relative risk that essential hypertension takes place the polymorphic A allelotrope of KLK1 gene rs5517 carrier significantly raises, and the discovery of the polymorphic site relevant with essential hypertension of the present invention has great importance for hypertensive diagnosis, prevention and treatment.

In a particular, the invention provides the KLK1 gene rs5517 polymorphic method relevant that detect with essential hypertension, this method comprises design primer amplification target gene and utilizes the restriction fragment length polymorphism method to identify the polymorphic genotype of KLK1 gene rs5517 that wherein allelic distribution frequency of A and the ill risk of essential hypertension are proportionate.

The primer of Shi Yonging comprises the oligonucleotide of sufficient length and suitable sequence in the present invention, is used to target nucleotide to synthesize special beginning is provided.This primer can comprise for example 15-30 Nucleotide, and generally complementary with every chain of the nucleotide sequence that will increase, and for example is

5’CAGTGAAGCAGATGCCTGGT 3’，

5’TCCTGCCTAATGATGAGTTC 3’。

Restriction fragment length polymorphism is with genomic dna or the some gene of a certain restriction enzyme cutting from Different Individual, because polymorphic genotype, and obtain the dna fragmentation of different lengths and number, differently determine different polymorphic genotype by what detect DNA length after enzyme is cut and number.

In another particular, the invention provides the KLK1 gene rs5517 polymorphic method relevant that detect with essential hypertension, this method comprises design primer amplification target gene and adopts direct sequencing to measure KLK1 gene rs5517 polymorphic, and wherein allelic distribution frequency of A and the ill risk of essential hypertension are proportionate.

In another particular, the invention provides the KLK1 gene rs5517 polymorphic method relevant that detect with essential hypertension, this method comprises design primer amplification target gene and adopts the polymorphic genotype of nucleic acid probe determining KLK1 gene rs5517 of mark that wherein allelic distribution frequency of A and the ill risk of essential hypertension are proportionate.

Nucleic acid probe can be used radio isotope, enzyme, luminescent material (for example fluorescence and phosphor material) mark.These radio isotope, enzyme, luminescent material that are used for mark etc. are that those skilled in the art is known, for example but be not limited to ³²P, ¹²⁵I, ¹⁴C, horseradish peroxidase, fluorescein etc.Nucleic acid probe can be the gene order complementation of G with polymorphic gene locus, can be the gene order complementation of A with polymorphic gene locus also.Perhaps, can exist simultaneously with polymorphic gene locus be the gene order of G complementary and with polymorphic gene locus be two kinds of nucleic acid probes of gene order complementary of A.The length of probe for example can be 10-50 or polybase base more, or 15-30 base.For example, in one embodiment, probe can be the nucleic acid fragment with the nucleic acid array complementation of Fig. 2.

Except above method, can also adopt well known by persons skilled in the art other to detect the method for polymorphic site.

The present invention also provides and can be used for detecting the KLK1 gene rs5517 polymorphic test kit relevant with essential hypertension, and this test kit mainly comprises the dNTP that is used for PCR, primer, the Taq enzyme, dna profiling, and the restriction endonuclease that is used for the restriction fragment length polymorphism method, for example Taq I restriction endonuclease.

In addition, the invention provides and can be used for detecting the KLK1 gene rs5517 polymorphic test kit relevant with essential hypertension, this test kit mainly comprises the dNTP that is used for PCR, primer, the Taq enzyme, dna profiling, and the labeling nucleic acid probe that is used to detect the gene polymorphic site.

In addition, the invention provides and can be used for detecting the KLK1 gene rs5517 polymorphic test kit relevant with essential hypertension, this test kit mainly comprises the dNTP that is used for PCR, primer, the Taq enzyme, dna profiling, and the sequencing kit that is used to detect the gene polymorphic site.

For example, according to a specific embodiment, test kit contains the following reagent that is useful on PCR:

Primer:

5’CAGTGAAGCAGATGCCTGGT 3’，

5 ' TCCTGCCTAATGATGAGTTC, 3 ' each 0.2 μ l (5 μ M),

dNTP MIX 0.4μl(10mM)，

Taq enzyme 0.1 μ l (5u/ μ l),

PCR buffer 1.0μl(10X)，

Dna profiling 1.0 μ l (10ng/ μ l);

Contain the following reagent that is useful on the restriction fragment length polymorphism method in addition:

Taq I buffer 1.5 μ l (10X); With

Taq I 0.1μl(10u/μl)。

The using method that is used to detect the polymorphic test kit of the KLK1 gene rs5517 relevant with essential hypertension of the present invention comprises the following steps: A, obtains biological specimen from live body, by above-mentioned PCR primer, carries out pcr amplification reaction; B, purifying PCR reaction product are with restriction enzyme inscribe PCR reaction product; C, electrophoresis evaluation enzyme are cut dna fragmentation.

KLK1 gene rs5517 proposed by the invention is polymorphic can be detected in such as blood, living tissue at human sample.Method of the present invention can be used to carry out examination in the crowd, thereby can judge the relative risk of suffering from essential hypertension according to the polymorphic genotype of KLK1 gene rs5517 of individuality.Simultaneously, can also adopt this method early diagnosis essential hypertension.By detecting this gene polymorphic, for hypertension excessive risk individuality, can take preventive measures early, prevent hypertensive generation.

In case essential hypertension is the stubborn disease that a kind of ill need are taken medicine throughout one's life, does not still have treatment means completely at present.Hypertension is modal cardiovascular disorder, morbidity height not only, and can cause the serious heart, brain, kidney complication, be a kind of to the great disease of human health risk.The proposition in essential hypertension gene polymorphic of the present invention site provides a kind of new approach for thoroughly treating essential hypertension.By correcting polymorphic genetic flaw,, might reach prevention or treat hypertensive purpose perhaps by reducing or eliminating defective KLK1 gene product.Therefore, the KLK1 gene rs5517 polymorphic proposition relevant with essential hypertension of the present invention provides possibility for developing essential hypertension gene therapy medicament and gene therapy method.And the proposition in gene polymorphic of the present invention site for the cause of disease of essential hypertension has proposed new viewpoint, has been deepened the understanding to the essential hypertension disease.

Description of drawings

Fig. 1 shows the structural representation of KLK1 gene.

Fig. 2 shows the gene order of the 4th exon of KLK1 gene, this polymorphic the 4th exon that is positioned at the KLK1 gene, and wherein the 60th of marking of italics is rs5517, is the variation of A/G.

Fig. 3 shows genotype electrophoresis synoptic diagram, and the right side band is Marker, i.e. the standard electrophoretogram.When rs5517 is polymorphic when A allelotrope occurring, electrophoresis is the band of 194bp, and when G allelotrope occurring, electrophoresis is two bands of 174bp and 20bp.

Embodiment

1, detects polymorphic test sample and the method for rs5517

Combine with the restriction fragment length polymorphism method by PCR that to detect rs5517 polymorphic.

1.1 the acquisition of test sample

All dna samples and clinical data all from the international cardiovascular diseases cooperating research in Asia (the International Collaborative Study of Cardiovascular Disease in Asia, InterASIA).The approval of local Ethics Committee has been passed through in this plan, and each participant has signed Informed Consent Form voluntarily.Have 15,838 volunteers of representational 35 to 74 years old have participated in this plan, we have therefrom selected Jilin, Beijing, Shandong, Shaanxi, Guizhou, Fujian, Hubei, Sichuan, Guangxi etc. 2411 of totally 9 provinces and cities independently hypertension individual and by sex, age, independently contrast is individual for 2348 of residence couplings.The participator all fills out a questionnaire in detail, comprises disease personal history, family history, smoking and history of drinking history and drug use situation, and measures height, body weight, waistline and every biochemical indicators such as hip circumference and blood plasma lipide.Every volunteer's blood pressure is all by doing some training very often and measuring three times by the investigator who authenticates.All research objects are Han nationality and consanguinity-less relation.This study selected hypertensive being defined as: systolic pressure 〉=150mmHg and or diastolic pressure 〉=95mmHg; But take depressor systolic pressure＜150mmHg, diastolic pressure＜95mmHg.The individuality of suffering from secondary sexual type hypertension, coronary heart disease and diabetes is not within the field of investigation.

1.2rs5517 the acquisition of polymorphic amplified fragments

By the mispairing primer of design, use the precious biotechnology Taq of company limited of 9700PCR instrument and the Dalian enzyme of ABI company to carry out polymerase chain reaction (PCR) the acquisition polymorphic amplified fragments of rs5517 (194bp).Amplimer and amplification condition see Table 1 and table 2.

The amplimer that table 1 rs5517 is polymorphic

Primer	Sequence
		The downstream, upstream	5’CAGTGAAGCAGATGCCTGGT 3’ 5’TCCTGCCTAATGATGAGTTC 3’

Polymorphic pcr amplification system of table 2 rs5517 and amplification condition

	The amplification system composition	Consumption	Amplification condition
				10 μ l	Dna profiling PCR buffer dNTP MIX primer Taq enzyme water	1.0 each 0.2 μ l (5 μ M), 0.1 μ l (5u/ μ l), 7.1 μ l of μ l (10ng/ μ l) 1.0 μ l (10 *) 0.4 μ l (10mM)	Pre-94 ℃ of 5min of sex change, 94 ℃ of 15s of sex change, 58 ℃ of 15s anneal, extend 72 ℃ of 30s, react 40 circulations, extend 72 ℃ of 10min at last.

1.3 the restriction fragment length polymorphism method is identified the polymorphic genotype of rs5517

After containing the polymorphic dna fragmentation of rs5517 and increasing successfully, with restriction enzyme product is carried out enzyme and cut, can tell the genotype in this site from gel electrophoresis spectrum.

Taq I restriction endonuclease with the precious biotechnology in Dalian company limited makes the amplified production of 194bp cut 10h at 65 ℃ of enzymes.The enzyme system of cutting sees Table 3.

The polymorphic enzyme of table 3 rs5517 is cut system and enzyme tangent condition

	Enzyme is cut the system composition	Consumption	The enzyme tangent condition
				15μl	PCR product Taq I Taq I buffer water	10μl 0.1μl(10u/μl) 1.5μl(10×) 3.4μl	65℃ 10h

1.4 agarose gel electrophoresis inspection enzyme is cut product

In the concentration of ethidium bromide staining is that electrophoresis enzyme is cut product in 3% the sepharose, and 250 volts of voltages, electrophoresis time are 50 minutes.When rs5517 is polymorphic when A allelotrope occurring, electrophoresis is the band of 194bp, and when G allelotrope occurring, electrophoresis is two bands of 174bp and 20bp.Fig. 3 shows genotype electrophoresis synoptic diagram, and the right side band is Marker, i.e. the standard electrophoretogram.

The dependency of the polymorphic and human essential hypertension of 2rs5517

2.1 case-control sample Clinical symptoms is described

The sex of case group and control group, age, smoking rate and the difference of drinking rate there are no significant.Compare the weight index of case group (BMI), total cholesterol (CHO) with control group, triglyceride level (TG), blood sugar (Glu), low density lipoprotein cholesterol (LDL_C), (Cr) is higher for creatinine level, and high density lipoprotein cholesterol (HDL_C) level is lower, all has significant difference.See Table 4.

Table 4 case-control sample Clinical symptoms is described

	Case (n=2411)	Contrast (n=2348)	The P value
				Age (year) sex, man/women systolic pressure, the mmHg diastolic pressure, the mmHg weight index, kg/m 2Total cholesterol, the mg/dl triglyceride level, mg/dl blood sugar, the mg/dl high density lipoprotein cholesterol, the mb/dl low density lipoprotein cholesterol, the mg/dl serum creatinine, μ mol/L smoker alcohol user	54.60±10.11 1206/1205 149.05±22.14 90.62±12.08 25.22±3.66 198.23±37.89 139.03±65.73 98.87±18.21 49.19±12.82 121.32±34.59 72.68±14.77 915 749	54.16±9.34 1198/1150 114.35±10.19 73.28±7.45 23.15±3.45 190.26±39.18 120.06±58.09 95.24±17.37 51.01±12.75 115.30±35.38 71.60±13.01 952 716	0.122 0.49 ＜0.001 ＜0.001 ＜0.001 ＜0.001 ＜0.001 ＜0.001 ＜0.001 0.002 0.008 0.067 0.678

Numerical value is means standard deviation

2.2rs5517 polymorphic frequency distribution in the case-control sample

The difference that the polymorphic three kinds of genotype of rs5517 distribute in case and contrast has significance.The frequency of A allelotrope in case is apparently higher than control group, and difference has significance.See Table 5.

The polymorphic frequency distribution in the case-control sample of table 5 rs5517

Genotype	Case (n=2411)	Contrast (n=2348)	The P value
				GG AG AA	808 1114 451	859 1094 364	0.0056
A gene frequency (%)	42.48	39.32	0.0019

2.3rs5517 polymorphic and hypertensive relative risk

Under the allelic recessive inheritance model (promptly merging two kinds of genotype of GG and AG) with respect to A, the individual danger that essential hypertension takes place of AA genotype significantly raises than G allelotrope carrier.Carry out the non-conditional Logistic Regression of multivariate, adjust the age, sex, smoking is drunk, BMI, TG, CHO, Glu, Cr, after the conventional risk factors such as HDL_C, rs5517 recessive inheritance model still keeps significantly related with hypertensive generation.The carrier compares with G allelotrope, and hypertensive risk takes place AA genotype carrier has increased by 25%, sees Table 6.

The polymorphic relative risk of table 6 rs5517 with respect to essential hypertension

Genotype	Case (n=2411)	Contrast (n=2348)	OR value (95%CI) P value	#OR value (95%CI) #P value
					AG+GG AA	1922 451	1953 364	- 1.26(1.08，1.47) P＝0.0029	- 1.25(1.07，1.47) P＝0.0063

# is for after adjusting traditional environmental risk factor

3 are used to detect the KLK1 gene rs5517 polymorphic test kit relevant with essential hypertension

3.1 primer:

5’CAGTGAAGCAGATGCCTGGT 3’，

5 ' TCCTGCCTAATGATGAGTTC, 3 ' each 0.2 μ l (5 μ M),

dNTP MIX 0.4μl(10mM)，

Taq enzyme 0.1 μ l (5u/ μ l),

PCR buffer 1.0μl(10X)，

Dna profiling 1.0 μ l (10ng/ μ l);

3.2 contain the following reagent that is useful on the restriction fragment length polymorphism method in addition:

Taq I buffer 1.5 μ l (10X); With

Taq I 0.1μl(10u/μl)。

3.3 operation steps

3.3.1 obtain biological specimen from live body,, carry out pcr amplification reaction by above-mentioned PCR primer.

3.3.2 purifying PCR reaction product is with digestion with restriction enzyme PCR reaction product.

3.3.3 electrophoresis evaluation enzyme is cut dna fragmentation.

4 are used to detect the KLK1 gene rs5517 polymorphic test kit relevant with essential hypertension

This test kit comprises:

Primer:

5’CAGTGAAGCAGATGCCTGGT 3’，

5 ' TCCTGCCTAATGATGAGTTC, 3 ' each 0.2 μ l (5 μ M),

dNTP MIX 0.4μl(10mM)，

Taq enzyme 0.1 μ l (5u/ μ l),

PCR buffer 1.0μl(10X)，

Dna profiling 1.0 μ l (10ng/ μ l);

Operation steps

A, obtain biological specimen,, carry out pcr amplification reaction by above-mentioned PCR primer from live body.

B, purifying PCR reaction product directly check order to the PCR reaction product.

SEQUENCE LISTING

＜110〉Sinogenomax Co., Ltd.

＜120〉detect the KLK1 gene rs5517 polymorphic method relevant with essential hypertension

<130>

<160>4

<170>PatentIn version 3.1

<210>1

<211>4640

<212>DNA

＜213〉people

<400>1

agttcctcca cctgctggcc cctggacacc tctgtcacca tgtggttcct ggttctgtgc 60

ctcgccctgt ccctgggggg gactggtgag acagtggggg gatgtgggag ggggaacggg 120

ccctgattct cttgctggcc tcacatcccc ccccgataag accttcccct ccaacacccc 180

accctcatcc ctctggccca cagtctatcc tagtccgggg tgccccggct cttatctatc 240

ttgcgcggcc ccaccctaaa cttccacccc cgctcctcca tgttgtcata gtgctcactc 300

ccacaccaga ttcctgctcc tcccaggaag cctcagtact ttctcctctt ccctagccaa 360

cgccctgtcc caccgcttta ccaaaggggc agattctggg ccatctctgt ctctctctgg 420

aggaccccaa ccctcccatg ggcttccccc accccacagg actctgatca tcccctcctg 480

ccccctagtt ccctgcggcc acctatttgg ctcctgagtc tacaaatccc accacactcc 540

agtgactttt tccatccagc tgtccgctct caactgtgtc ctccagaccc tgacatctgg 600

tctccccagt ccttccaggg tcccccaaat ttcaccagaa aaccctgctt cccaaactgg 660

catgtgggat cccccatctg gtatgggggg gggtctgcaa atgtcccttc ccacccagca 720

cccccagctc tcccaggaaa aacaccacac cctcccacca catgctcctt tccttgggga 780

agttccatcc cgccccaggc cccagccctt ctctgcctga attgttccta cacagctctg 840

gttttctgga accccacccc aaggatcctg aatgccttct cagccagcgc ttctgccctg 900

gcctccccca agtcagtatg tgattctaca acctcacgtc aagtgggtcc tgcattgcat 960

tcccacagct gcttggcgcc tgttctcacc acttctccaa tcctcttcct aggattgcct 1020

ccaagaggac cccatatcct tccagtaccc tcagaccatg aaccccatcc ccatgagaaa 1080

cgaagatccc atccttcacc ctgtccgaga aggactgcca ctcacgcctc cctcctcctg 1140

agccccgtcc cagtcctgac cgcaactgtg ttctcagggc cccaacctcc cctcagattg 1200

ccattcctgg ttcacaggaa ggaccccaaa acctctcgga agcccacctc tagccttaac 1260

catagccctt tcttttaccc tttaaccagg aagccctgaa atctaactgt cccagccaag 1320

ctggcccctt ccaaccccaa tgtagggacc ccaagtcacc cccaaactct tcagtccaga 1380

tgctcttctt tacctctcag acctggttcc ctaaagctgc atcctttcct gaacctcaaa 1440

agcccaaccc aggtcctgtt tccctagcct aggagcccct tagccctcca gattcttcct 1500

cagtgagcct ctgatcctgt cccacccttg gcgccttgat ccctggtttc cagaatccct 1560

ttccactccc ctaacccacc acctcccatc ccccagcccc agaccccaaa tgacctgacg 1620

cccagatgca gtgtctgctc cagacactgt ctcctgtctc ctaccctgat ccctggaggc 1680

tgctctactg tcagagcaca aaatctcccc accaggtcca gccaccactc caaaagccca 1740

gggaacagtc cagagtccca ccccttccca acaccccttg cccatgtccc caacctccag 1800

ccctggtcct ctacccgcaa tgtcccttca gacccacagc ccagctccct ctcctagcct 1860

tgtccctggc ctctcctgcc aaccctgccc ttcctgaccc agcaccgcct ctgcaggtgc 1920

tgcgcccccg attcagtccc ggattgtggg aggctgggag tgtgagcagc attcccagcc 1980

ctggcaggcg gctctgtacc atttcagcac tttccagtgt gggggcatcc tggtgcaccg 2040

ccagtgggtg ctcacagctg ctcattgcat cagcgagtga gtaggggcct ggggtctggg 2100

aggagggcat ctatgctgcc acaggattga caggccagtg gcattcccct tggataacct 2160

caggcaagac tggggggctg aggcagagag gaaggctctg gcgcaggtcg cctggcaggg 2220

cagagctggg ctggacaccc ctctccaagg ctgcctgggt ctcttgggat ctggttctgc 2280

ttgtgtctct gtgtgactgt gttctggtct ctgtcttcct ctctctcctc tgtctccttg 2340

tctctgcatc tcccctgtct ctgtctgtct ctgagtctct ctgcggcatc tctgtcactg 2400

tgtctcaccc tccatctctc tacccatctc tctctctctg ggtctctacc tcaccgctcc 2460

ctcatcccta ctaaacacac acccagatgg acctaaggga ggccccagag taaaggaagg 2520

gctttatccc caacttgtgt gcctgggagg gggcgcctct ccctctgtcc agctccccgc 2580

cccacaggat atccctccac tctggagaga cacagggaag ggctggtttc agcgggagct 2640

gggtggggca actgagggag gaggaaggag gaggcggggc gagaaacgcg cgggagggtg 2700

ctgggaaggg aagggggcct cgaccttgga cttcaggcca ggccacctgc ccctggggag 2760

cccgcaccac agccccagct gcagctgagc cgctctcagg cctcccctcc tccctacctg 2820

cccccaccct ccccacctgc ccccaccctc ccccagggcc tccctccctt ttctctccca 2880

cactcggtca ctcctgcttc ctctctgcct ctgtttctag ttctcactct gacgtcccgc 2940

gtcctttttc atttgtctgc ttctcgctcc cttccgtgtt ctgttccctc ttcctccctc 3000

ttccctgggc ctgtttctcg ctgtccctgt cttttatcct tctcatctgc ctcttttttg 3060

ctcaccctgt ttctcactgc cctcccctcc gcctttttca cccctctgtc cttttgagct 3120

cttttttgct ctgtctcttc atttgccttt tgcactctca aaatctttca tcttcccatt 3180

cgctgtctgt atttctccat aactatatct ttcttcctct gtctccgccc acccacattt 3240

ttctctttcc ctttctctct ttggggaccc tcccccatgc tcccctgccc catccccttt 3300

tccccttccc gtcttctcat ccctccattc ccatctttcc ccagcaatta ccagctctgg 3360

ctgggtcgcc acaacttgtt tgacgacgaa aacacagccc agtttgttca tgtcagtgag 3420

agcttcccac accctggctt caacatgagc ctcctggaga accacacccg ccaagcagac 3480

gaggactaca gccacgacct catgctgctc cgcctgacag agcctgctga taccatcaca 3540

gatgctgtga aggtcgtgga gttgcccacc gaggaacccg aagtggggag cacctgtttg 3600

gcttccggct ggggcagcat cgaaccagag aattgtatgt gggggcagac tgtgtagccc 3660

aaggcgggga tggggactcc tgcgtccaag ggagaaaggg ccagggaagc aggtgaggtc 3720

gggctgcagc cctttttctc ccgggttcgt agtctcattt ccagatgatc tccagtgtgt 3780

ggacctcaaa atcctgccta atgatgagtg caaaaaagcc cacgtccaga aggtgacaga 3840

cttcatgctg tgtgtcggac acctggaagg tggcaaagac acctgtgtgg tgaggcagcc 3900

ctgcccccag ggtctggaag ggctgaggga ggggactcag cctctgaact ggcttctgag 3960

agctaaccag gcatctgctt cactgcttcc cagctagctg tagccactcg ccccatcagt 4020

gccccagctc cccctccttc ccccgcccat ccagggacaa ctgcatctca ccccccacac 4080

cagagttcac cgttcctcgt ggtaatgtgt tgttaccgtc gagtcagaga gtagtcctgg 4140

agaggtggcc tctgcgatgt gcccgcaggg gcagcgtcct gcagatggtc ctgcccctcc 4200

tccccctaac ctgtctgcag gcactgtcca cctggaccct gccccatgtg caggagctgg 4260

accctgaggt cccttccccc ttggccagga ctggagaccc tgtcccctct gtgggaatcc 4320

ctgcccacct tcctctggga gtgggcactg gaggccctgt ctgcgagctg gggctcccca 4380

ggcagaactt gggccccgta gacctttctc actctcccct cccaccttgt gctcccaggg 4440

tgattcaggg ggcccgctga tgtgtgatgg tgtgctccaa ggtgtcacat catggggcta 4500

cgtcccttgt ggcaccccca ataagccttc tgtcgccgtc agagtgctgt cttatgtgaa 4560

gtggatcgag gacaccatag cggagaactc ctgaacgccc agccctgtcc cctaccccca 4620

gtaaaatcaa atgtgcatcc 4640

<210>2

<211>4640

<212>DNA

＜213〉people

<400>2

agttcctcca cctgctggcc cctggacacc tctgtcacca tgtggttcct ggttctgtgc 60

ctcgccctgt ccctgggggg gactggtgag acagtggggg gatgtgggag ggggaacggg 120

ccctgattct cttgctggcc tcacatcccc ccccgataag accttcccct ccaacacccc 180

accctcatcc ctctggccca cagtctatcc tagtccgggg tgccccggct cttatctatc 240

ttgcgcggcc ccaccctaaa cttccacccc cgctcctcca tgttgtcata gtgctcactc 300

ccacaccaga ttcctgctcc tcccaggaag cctcagtact ttctcctctt ccctagccaa 360

cgccctgtcc caccgcttta ccaaaggggc agattctggg ccatctctgt ctctctctgg 420

aggaccccaa ccctcccatg ggcttccccc accccacagg actctgatca tcccctcctg 480

ccccctagtt ccctgcggcc acctatttgg ctcctgagtc tacaaatccc accacactcc 540

agtgactttt tccatccagc tgtccgctct caactgtgtc ctccagaccc tgacatctgg 600

tctccccagt ccttccaggg tcccccaaat ttcaccagaa aaccctgctt cccaaactgg 660

catgtgggat cccccatctg gtatgggggg gggtctgcaa atgtcccttc ccacccagca 720

cccccagctc tcccaggaaa aacaccacac cctcccacca catgctcctt tccttgggga 780

agttccatcc cgccccaggc cccagccctt ctctgcctga attgttccta cacagctctg 840

gttttctgga accccacccc aaggatcctg aatgccttct cagccagcgc ttctgccctg 900

gcctccccca agtcagtatg tgattctaca acctcacgtc aagtgggtcc tgcattgcat 960

tcccacagct gcttggcgcc tgttctcacc acttctccaa tcctcttcct aggattgcct 1020

ccaagaggac cccatatcct tccagtaccc tcagaccatg aaccccatcc ccatgagaaa 1080

cgaagatccc atccttcacc ctgtccgaga aggactgcca ctcacgcctc cctcctcctg 1140

agccccgtcc cagtcctgac cgcaactgtg ttctcagggc cccaacctcc cctcagattg 1200

ccattcctgg ttcacaggaa ggaccccaaa acctctcgga agcccacctc tagccttaac 1260

catagccctt tcttttaccc tttaaccagg aagccctgaa atctaactgt cccagccaag 1320

ctggcccctt ccaaccccaa tgtagggacc ccaagtcacc cccaaactct tcagtccaga 1380

tgctcttctt tacctctcag acctggttcc ctaaagctgc atcctttcct gaacctcaaa 1440

agcccaaccc aggtcctgtt tccctagcct aggagcccct tagccctcca gattcttcct 1500

cagtgagcct ctgatcctgt cccacccttg gcgccttgat ccctggtttc cagaatccct 1560

ttccactccc ctaacccacc acctcccatc ccccagcccc agaccccaaa tgacctgacg 1620

cccagatgca gtgtctgctc cagacactgt ctcctgtctc ctaccctgat ccctggaggc 1680

tgctctactg tcagagcaca aaatctcccc accaggtcca gccaccactc caaaagccca 1740

gggaacagtc cagagtccca ccccttccca acaccccttg cccatgtccc caacctccag 1800

ccctggtcct ctacccgcaa tgtcccttca gacccacagc ccagctccct ctcctagcct 1860

tgtccctggc ctctcctgcc aaccctgccc ttcctgaccc agcaccgcct ctgcaggtgc 1920

tgcgcccccg attcagtccc ggattgtggg aggctgggag tgtgagcagc attcccagcc 1980

ctggcaggcg gctctgtacc atttcagcac tttccagtgt gggggcatcc tggtgcaccg 2040

ccagtgggtg ctcacagctg ctcattgcat cagcgagtga gtaggggcct ggggtctggg 2100

aggagggcat ctatgctgcc acaggattga caggccagtg gcattcccct tggataacct 2160

caggcaagac tggggggctg aggcagagag gaaggctctg gcgcaggtcg cctggcaggg 2220

cagagctggg ctggacaccc ctctccaagg ctgcctgggt ctcttgggat ctggttctgc 2280

ttgtgtctct gtgtgactgt gttctggtct ctgtcttcct ctctctcctc tgtctccttg 2340

tctctgcatc tcccctgtct ctgtctgtct ctgagtctct ctgcggcatc tctgtcactg 2400

tgtctcaccc tccatctctc tacccatctc tctctctctg ggtctctacc tcaccgctcc 2460

ctcatcccta ctaaacacac acccagatgg acctaaggga ggccccagag taaaggaagg 2520

gctttatccc caacttgtgt gcctgggagg gggcgcctct ccctctgtcc agctccccgc 2580

cccacaggat atccctccac tctggagaga cacagggaag ggctggtttc agcgggagct 2640

gggtggggca actgagggag gaggaaggag gaggcggggc gagaaacgcg cgggagggtg 2700

ctgggaaggg aagggggcct cgaccttgga cttcaggcca ggccacctgc ccctggggag 2760

cccgcaccac agccccagct gcagctgagc cgctctcagg cctcccctcc tccctacctg 2820

cccccaccct ccccacctgc ccccaccctc ccccagggcc tccctccctt ttctctccca 2880

cactcggtca ctcctgcttc ctctctgcct ctgtttctag ttctcactct gacgtcccgc 2940

gtcctttttc atttgtctgc ttctcgctcc cttccgtgtt ctgttccctc ttcctccctc 3000

ttccctgggc ctgtttctcg ctgtccctgt cttttatcct tctcatctgc ctcttttttg 3060

ctcaccctgt ttctcactgc cctcccctcc gcctttttca cccctctgtc cttttgagct 3120

cttttttgct ctgtctcttc atttgccttt tgcactctca aaatctttca tcttcccatt 3180

cgctgtctgt atttctccat aactatatct ttcttcctct gtctccgccc acccacattt 3240

ttctctttcc ctttctctct ttggggaccc tcccccatgc tcccctgccc catccccttt 3300

tccccttccc gtcttctcat ccctccattc ccatctttcc ccagcaatta ccagctctgg 3360

ctgggtcgcc acaacttgtt tgacgacgaa aacacagccc agtttgttca tgtcagtgag 3420

agcttcccac accctggctt caacatgagc ctcctggaga accacacccg ccaagcagac 3480

gaggactaca gccacgacct catgctgctc cgcctgacag agcctgctga taccatcaca 3540

gatgctgtga aggtcgtgga gttgcccacc gaggaacccg aagtggggag cacctgtttg 3600

gcttccggct ggggcagcat cgaaccagag aattgtatgt gggggcagac tgtgtagccc 3660

aaggcgggga tggggactcc tgcgtccaag ggagaaaggg ccagggaagc aggtgaggtc 3720

gggctgcagc cctttttctc ccgggttcgt agtctcattt ccagatgatc tccagtgtgt 3780

ggacctcaaa atcctgccta atgatgagtg cgaaaaagcc cacgtccaga aggtgacaga 3840

cttcatgctg tgtgtcggac acctggaagg tggcaaagac acctgtgtgg tgaggcagcc 3900

ctgcccccag ggtctggaag ggctgaggga ggggactcag cctctgaact ggcttctgag 3960

agctaaccag gcatctgctt cactgcttcc cagctagctg tagccactcg ccccatcagt 4020

gccccagctc cccctccttc ccccgcccat ccagggacaa ctgcatctca ccccccacac 4080

cagagttcac cgttcctcgt ggtaatgtgt tgttaccgtc gagtcagaga gtagtcctgg 4140

agaggtggcc tctgcgatgt gcccgcaggg gcagcgtcct gcagatggtc ctgcccctcc 4200

tccccctaac ctgtctgcag gcactgtcca cctggaccct gccccatgtg caggagctgg 4260

accctgaggt cccttccccc ttggccagga ctggagaccc tgtcccctct gtgggaatcc 4320

ctgcccacct tcctctggga gtgggcactg gaggccctgt ctgcgagctg gggctcccca 4380

ggcagaactt gggccccgta gacctttctc actctcccct cccaccttgt gctcccaggg 4440

tgattcaggg ggcccgctga tgtgtgatgg tgtgctccaa ggtgtcacat catggggcta 4500

cgtcccttgt ggcaccccca ataagccttc tgtcgccgtc agagtgctgt cttatgtgaa 4560

gtggatcgag gacaccatag cggagaactc ctgaacgccc agccctgtcc cctaccccca 4620

gtaaaateaa atgtgcatcc 4640

<210>3

<211>262

<212>PRT

＜213〉people

<400>3

Met Trp Phe Leu Val Leu Cys Leu Ala Leu Ser Leu Gly Gly Thr Gly

1 5 10 15

Ala Ala Pro Pro Ile Gln Ser Arg Ile Val Gly Gly Trp Glu Cys Glu

20 25 30

Gln His Ser Gln Pro Trp Gln Ala Ala Leu Tyr His Phe Ser Thr Phe

35 40 45

Gln Cys Gly Gly Ile Leu Val His Arg Gln Trp Val Leu Thr Ala Ala

50 55 60

His Cys Ile Ser Asp Asn Tyr Gln Leu Trp Leu Gly Arg His Asn Leu

65 70 75 80

Phe AspAsp Glu Asn Thr Ala Gln Phe Val His Val Ser Glu Ser Phe

85 90 95

Pro His Pro Gly Phe Asn Met Ser Leu Leu Glu Asn His Thr Arg Gln

100 105 110

Ala Asp Glu Asp Tyr Ser His Asp Leu Met Leu Leu Arg Leu Thr Glu

115 120 125

Pro Ala Asp Thr Ile Thr Asp Ala Val Lys Val Val Glu Leu Pro Thr

130 135 140

Glu Glu Pro Glu Val Gly Ser Thr Cys Leu Ala Ser Gly Trp Gly Ser

145 150 155 160

Ile Glu Pro Glu Asn Phe Ser Phe Pro Asp Asp Leu Gln Cys Val Asp

165 170 175

Leu Lys Ile Leu Pro Asn Asp Glu Cys Lys Lys Ala His Val Gln Lys

180 185 190

Val Thr Asp Phe Met Leu Cys Val Gly His Leu Glu Gly Gly Lys Asp

195 200 205

Thr Cys Val Gly Asp Ser Gly Gly Pro Leu Met Cys Asp Gly Val Leu

210 215 220

Gln Gly Val Thr Ser Trp Gly Tyr Val Pro Cys Gly Thr Pro Asn Lys

225 230 235 240

Pro Ser Val Ala Val Arg Val Leu Ser Tyr Val Lys Trp Ile Glu Asp

245 250 255

Thr Ile Ala Glu Asn Ser

260

<210>4

<211>262

<212>PRT

＜213〉people

<400>4

Met Trp Phe Leu Val Leu Cys Leu Ala Leu Ser Leu Gly Gly Thr Gly

1 5 10 15

Ala Ala Pro Pro Ile Gln Ser Arg Ile Val Gly Gly Trp Glu Cys Glu

20 25 30

Gln His Ser Gln Pro Trp Gln Ala Ala Leu Tyr His Phe Ser Thr Phe

35 40 45

Gln Cys Gly Gly Ile Leu Val His Arg Gln Trp Val Leu Thr Ala Ala

50 55 60

His Cys Ile Ser Asp Asn Tyr Gln Leu Trp Leu Gly Arg His Asn Leu

65 70 75 80

Phe Asp Asp Glu Asn Thr Ala Gln Phe Val His ValSer Glu Ser Phe

85 90 95

Pro His Pro Gly Phe Asn Met Ser Leu Leu Glu Asn His Thr Arg Gln

100 105 110

Ala Asp Glu Asp Tyr Ser His Asp Leu Met Leu Leu Arg Leu Thr Glu

115 120 125

Pro Ala Asp Thr Ile Thr Asp Ala Val Lys Val Val Glu Leu Pro Thr

130 135 140

Glu Glu Pro Glu Val Gly Ser Thr Cys Leu Ala Ser Gly Trp Gly Ser

145 150 155 160

Ile Glu Pro Glu Asn Phe Ser Phe Pro Asp Asp Leu Gln Cys Val Asp

165 170 175

Leu Lys Ile Leu Pro Asn Asp Glu Cys Glu Lys Ala His Val Gln Lys

180 185 190

Val Thr Asp Phe Met Leu Cys Val Gly His Leu Glu Gly Gly Lys Asp

195 200 205

Thr Cys Val Gly Asp Ser Gly Gly Pro Leu Met Cys Asp Gly Val Leu

210 215 220

Gln Gly Val Thr Ser Trp Gly Tyr Val Pro Cys Gly Thr Pro Asn Lys

225 230 235 240

Pro Ser Val Ala Val Arg Val Leu Ser Tyr Val Lys Trp Ile Glu Asp

245 250 255

Thr Ile Ala Glu Asn Ser

260

Claims (10)

1, the polymorphic method of KLK1 gene rs5517 that detection is relevant with essential hypertension, this method comprises 3812 the A/G polymorphism that detects the KLK1 gene coded sequence, and wherein the ill relative risk of allelic distribution frequency of A and essential hypertension is proportionate.

2, the polymorphic method of KLK1 gene rs5517 that detection is relevant with essential hypertension, this method comprises design primer amplification target gene and utilizes the restriction fragment length polymorphism method to identify the polymorphic genotype of KLK1 gene rs5517 that wherein allelic distribution frequency of A and the ill risk of essential hypertension are proportionate.

3, the polymorphic method of KLK1 gene rs5517 that detection as claimed in claim 2 is relevant with essential hypertension, wherein said primer is:

5’CAGTGAAGCAGATGCCTGGT 3’，

5’TCCTGCCTAATGATGAGTTC 3’。

4, the polymorphic method of KLK1 gene rs5517 that detection is relevant with essential hypertension, this method comprises design primer amplification target gene and adopts direct sequencing to measure KLK1 gene rs5517 polymorphic, and wherein allelic distribution frequency of A and the ill risk of essential hypertension are proportionate.

5, the polymorphic method of KLK1 gene rs5517 that detection is relevant with essential hypertension, this method comprises design primer amplification target gene and adopts the polymorphic genotype of nucleic acid probe determining KLK1 gene rs5517 of mark that wherein allelic distribution frequency of A and the ill risk of essential hypertension are proportionate.

6, can be used for detecting the KLK1 gene rs5517 polymorphic test kit relevant with essential hypertension, this test kit mainly comprises the dNTP that is used for PCR, primer, the Taq enzyme, dna profiling, and the restriction endonuclease that is used for the restriction fragment length polymorphism method, for example Taq I restriction endonuclease.

7, can be used for detecting the KLK1 gene rs5517 polymorphic test kit relevant with essential hypertension, this test kit mainly comprises the dNTP that is used for PCR, primer, Taq enzyme, dna profiling, and the labeling nucleic acid probe that is used to detect the gene polymorphic site.

8, can be used for detecting the KLK1 gene rs5517 polymorphic test kit relevant with essential hypertension, this test kit mainly comprises the dNTP that is used for PCR, primer, Taq enzyme, dna profiling, and the sequencing kit that is used to detect the gene polymorphic site.

9, can be used for detecting the KLK1 gene rs5517 polymorphic test kit relevant with essential hypertension, test kit contains the following reagent that is useful on PCR:

Primer:

5’CAGTGAAGCAGATGCCTGGT 3’，

5 ' TCCTGCCTAATGATGAGTTC, 3 ' each 0.2 μ l (5 μ M),

dNTP MIX 0.4μl(10mM)，

Taq enzyme 0.1 μ l (5u/ μ l),

PCR buffer 1.0μl(10X)，

Dna profiling 1.0 μ l (10ng/ μ l);

Contain the following reagent that is useful on the restriction fragment length polymorphism method in addition:

Taq I buffer 1.5 μ l (10X); With

Taq I 0.1μl(10u/μl)。

10, the using method that is used to detect the polymorphic test kit of the KLK1 gene rs5517 relevant with essential hypertension comprises the following steps: A, obtains biological specimen from live body, by above-mentioned PCR primer, carries out pcr amplification reaction; B, purifying PCR reaction product are with restriction enzyme inscribe PCR reaction product; C, electrophoresis evaluation enzyme are cut dna fragmentation.

Images