CN1932016A - Polynucleotide affecting SRE activity and its coding polypeptides and use - Google Patents

Abstract

The present invention discloses one new kind of polynucleotide encoding human protein with function of affecting SRE activity, and its coding polypeptide and the antibody of the polypeptide. The present invention also discloses the application of the exogenous expression of the polynucleotide in host cell in affecting SRE activity. The present invention also discloses the use of the polypeptide and antibody in preparing medicine for preventing and treating muscle system diseases or tumors related with proliferation and muscle differentiation.

Description

Influence the active polynucleotide of SRE and coded polypeptide and purposes

Technical field

The invention belongs to biological technical field, relate to the gene expression regulation field, specifically, the present invention relates to the new coding of a class and have the proteic polynucleotide of the people who influences the active function of SRE, and encoded polypeptides, the antibody of polypeptide.The invention still further relates to the new polynucleotide of this class in host cell heterogenous expression to the application of the active influence of SRE.The invention still further relates to described polypeptide, the purposes of antibody on the medicine for preparing prevention and treatment musculature disease relevant or tumour with propagation or muscle differentiation.

Background technology

Serum response element SRE (serum response element) is the cis-acting elements of weak point that mainly is present in the promoter region of two genoids.Wherein a class is upright early gene, c-fos for example, fosB, junB, egr-1 and-2 etc.Can mediate the activation of the upright early gene that serum or somatomedin cause, thus stimulate cell growth.Another kind of gene is the gene of unstriated muscle special (SMC), its member mainly is some genes relevant with Muscle contraction and cytoskeletal protein gene, actins and myosins etc. for example also comprises the gene and the signal conduction factor gene of some transcription factors in addition.The core sequence of SRE is CArG box (CC (A/T) ₆GG, CC (A/T-rich) GG) (Minty, A.and Kedes, L.Upstream regions of the human cardiacactin gene that modulate its transcription in muscle cells:presence of an evolutionarily conservedrepeated motif.Mol.Cell.Biol., 6:2125-2136,1986.).At present known have more than 60 gene to contain CArG box, has more than 20 gene that may contain CArG box to await further experimental verification in addition.CArG box is regulating and control the different gene of two covers: muscle differentiation associated gene and cell growth related gene.In particular organization, this two covers gene is normally mutually exclusive, for example, in dormant cells of vascular wall, only expresses some CArG box genes relevant with unstriated muscle differentiation, and the express cell CArG box gene of growing and being correlated with not.In case the regulation and control generation problem of this two covers gene will cause pathology, if for example expressed the growth related gene that contains CArG box in the smooth muscle cell of vessel wall, as c-fos, PDGF-A will produce angiosarcoma.

The conjugated protein of SRE is serum response factor SRF (serum response factor).SRF can be activated by a lot of different stimulator, serum for example, and somatomedin, and influence the reagent etc. of cellular calcium concentration.SRF belongs to the MADS protein family, have DNA combination and Dimerized bifunctional structural domain MADS box, it by phosphorylation after, can form dimer, and with some other accessory protein factor and SRE combination, form mixture, thereby the expression of regulation and control downstream gene, and a lot of important biological procedureses of mediation are as hematosis, muscle generates, injury repairing and fetal development etc.In the promotor of c-fos, SRF and the effect of TCF albumen.TCF (Ternary complex factor) is the important transcription factor family of a class, and its member has elk-1, SAP-1, ERP/NET etc.In some specific heart genes, SRF and GATA-4, TEF-1, ATF6, or myocardin interacts.In Skeletal Muscle Cell, SRF and helix-loop-helix albumen, as MyoD, myogenin, or E12 forms mixture.These and the interactional albumen of SRF are regulated and control the transcriptional activity of SRE as cofactor.SRF can also directly combine with the big subunit RAP74 of TFIIF, forms the primary element of initial transcription complex and TFIIF is a rna plymerase ii, and can promote transcription elongation.Therefore, SRF combines with SRE and can play the effect that the transcription initiation mixture forms of raising.The promoter region of SRF gene also has 2 can show that SRF can strengthen the expression of self by feedback in conjunction with the conservative CArG box of SRF self.

Have at least two signal transduction pathway can mediate the reaction of SRE to extracellular signal.Article one, path is the signal path that depends on TCF protein family member that is subjected to the MAPK regulation and control.SRE, SRF, and the member of TCF protein family can form ternary complex.TCFs can be by Ras/MAPK path phosphorylation, thereby can regulate and control the transcriptional activity of SRE.Another path be SRF directly by phosphorylation, do not rely on the signal path of TCF, activated by Rho signal path or PI3K approach.Some member of Rho GTPase family (RhoA, Rac1 and CDC42) can directly activate SRF.This path may be by certain unknown cofactor mediation.Short tumor reagent TPA also can activate SRF by the PI3K approach that does not rely on TCFs.SRF can be by tyrosine phosphorylation in a plurality of sites, thereby is activated.For example, 103 Serine can be by serine/threonine kinases pp90RSK, MAPKAP kinases 2 (belonging to MAPK p38 path), and CaMKII and IV phosphorylation respectively activate.

Because the expression of the relevant upright early gene of cell growth muscle specific gene this two genoid relevant with cytodifferentiation in the SRF major control, these two kinds of different roles must have strict regulation and control in different tissues, otherwise just occur the disease or the tumour of musculature easily.

1.SRF and muscle hyperplasia

SRF regulates and control the expression of a lot of myocardium specific genes.In myocardium hyperplasia process, the genetic expression of a lot of SRF regulation and control changes, and this has hinted that SRF may participate in adjusting wherein.The research of transgenic method has also confirmed this viewpoint.Continue in healthy young mouse heart, to cross expression SRF and cause cardiac hypertrophy, mild fibrosis, cardiomyopathy and premature death.In Skeletal Muscle Cell, excessive stretching of birds and the muscle hyperplasia that load causes can increase the level of the SRF in nucleus and the tenuigenin.Studies show that in addition also can increase the level of SRF to mechanical heavy burden of the skeletal muscle of mouse, and reduce the reduction that load level can cause the level of SRF accordingly.Asthma can cause the variation of airway smooth muscle load, does not know whether this causes SRF concentration or active variation.

2.SRF reinvent with muscle

The undesired propagation of smooth muscle cell often causes that blood vessel and respiratory tract reinvent, and cause some pathologies, the nervous pulmonary hypertension of lung for example, arteriosclerosis arteriosclerosis, LAM, with asthma asthma. in the heart of people's depletion, found the spliceosome SRF Δ 4,5 of a kind of different SRF.Compare with normal heart, total length SRF has reduced in the diseased heart.Also observe the same variation in the experiment inductive rabbit heart.The more important thing is that experiment in vitro finds that SRF Δ 4,5 can suppress the expression of total length SRF, thereby suppress the genetic expression of SRF regulation and control.

3.SRF with aging

The concrete mechanism of SRF in aging is also unclear.But old and young adult mice heart is compared, and SRF has increase in nucleus and the tenuigenin.The more important thing is that when myocardial infarction, the heart of young mice can be beaten again by adding SRF, old mouse then can not.The difference of this SRF may cause the inducibility of the upright early gene that observed aging causes to reduce, thereby makes cell lose the ability that adapts to extreme condition.Curiously, in the inoblast of rate aging, SRF has reduced in conjunction with the ability of DNA on the other hand.This may be because SRF is by the peroxophosphoric acid change in the senile cell.Perhaps, the myocyte also causes this different discovery to a certain extent with difference in the inoblast heredity.In the heart failure process, the reduction of SRF level causes its change to the effect of specific heart transcriptional control in the cardiac muscle, thereby causes that these protein transcribe the change of growing amount so that the pathologic factor is made adaptive variation.If in the therapeutic process of heart failure, express to increase α 2MHC by the level that increases SRF, reach the purpose that increases myocardial contraction, this will open up a new thinking for the treatment of heart failure undoubtedly.

4.SRF with tumour

SRF can promote or suppress tumour and produce, and for different cells, different effects is arranged, this get exhausted in the kind and the quantity of the interactional cofactor of SRF.In the pernicious smooth muscle cell knurl, observe SM-g-actin and disappear, and the SRF/MEF2/NK-2 mixture also has different with normal cell.Studies show that in addition, in the epithelioma cell that mesenchymal transfer takes place, SRF is excessive and the height activated.The SRF activity that increases has not only increased the expression of SRF self, has also increased myosin, and the glutinous albumen vinculin of company and all rely on the gene of SRF regulation and control.The appearance of these variations and spindle sample form depends on the mediation of RhoA signal.

Anticarcinogen distamycin A can disturb the combination of SRF, thereby optionally reduces the promoter activity that relies on SRF, and then suppresses the muscle generation.In experiment, use distamycin A to handle the 10T1/2 cell of the pluripotency of cultivating, it no longer can be divided into muscle, and on the contrary, the ability that is divided into lipofibroma has but strengthened.

Summary of the invention

The research of people's gene group is international focus at present, except that the method for large scale sequencing, also lacks the high flux screening that begins from functional study and has the method for the gene of certain function.Deficiency at this present situation and existing medicine or reagent the purpose of this invention is to provide the new coding of a class and has the proteic polynucleotide SREIF1 of the people who influences the SRE active function, 2,3,4,5,6,7,8,9.

Another object of the present invention provides this class polynucleotide encoded polypeptide.

Another object of the present invention provides carrier and this class polynucleotide that contain these class polynucleotide and carrier transforms or the host cell of transduction.

Another object of the present invention provides the antibody of this class polynucleotide encoded polypeptide and the nucleic acid molecule that is used to detect.

Another object of the present invention provides the new polynucleotide of this class heterogenous expression in host cell influences the active application of SRE.

Another object of the present invention provides produces these polynucleotide and the method for its encoded polypeptides and the purposes of this polynucleotide and encoded polypeptides thereof.

For achieving the above object, the present invention is by the following technical solutions:

In a first aspect of the present invention, novel isolating polynucleotide are provided, it comprises coding and has the proteic nucleotide sequence that influence the active function of SRE, and this nucleotide sequence is selected from: the polynucleotide that at least 70% similarity (a) is arranged with the polynucleotide of the polypeptide of the aminoacid sequence contain SEQ ID NO:2, SEQ ID NO:4, SEQ IDNO:6, SEQ ID NO:8, SEQ ID NO:1O, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQID NO:18 of encoding; (b) coding contains the polynucleotide of polypeptide that aminoacid sequence with SEQID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8, SEQ ID NO:10, SEQ ID NO:12, SEQ IDNO:14, SEQ ID NO:16, SEQ ID NO:18 has the aminoacid sequence of at least 70% similarity; (c) with (a) or polynucleotide complementary polynucleotide (b).

Preferably, the polypeptide of this polynucleotide encoding has the aminoacid sequence of the group of being selected from down: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18.

Preferably, the sequence of these polynucleotide is shown at least 85% similarity with the nucleotides sequence that is selected from down group: (a) coding region sequence or the full length sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17; (b) at least one sequence of the sequence of in genetic code degeneracy scope, mentioning in corresponding to (a); (c) with (a) or at least one sequence of the sequence complementary sequence hybridization of mentioning (b).

More preferably, the sequence of these polynucleotide is selected from coding region sequence or the full length sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17.

In a second aspect of the present invention, above-mentioned Nucleotide encoded polypeptide is provided, and it comprises the polypeptide with the aminoacid sequence in the group of being selected from down: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18; Or the polypeptide that has similarity more than at least 90% with above arbitrary aminoacid sequence, or its conservative property variation polypeptide or its active fragments or its reactive derivative.

Preferably, this polypeptide is the polypeptide with aminoacid sequence of the group of being selected from down: SEQ ID NO:2, SEQ ID NO:4, SEQ IDNO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQID NO:18.

In a third aspect of the present invention, the carrier that contains above-mentioned polynucleotide is provided, and, also provides the host cell that is transformed or transduce by above-mentioned polynucleotide by the host cell that this carrier transforms or transduces.

In a fourth aspect of the present invention, provide and aforementioned polypeptides specificity bonded antibody, the nucleic acid molecule that can be used for detecting also is provided, it contains 8-100 successive Nucleotide in above-mentioned arbitrary polynucleotide.

In a fifth aspect of the present invention, provide above-mentioned polynucleotide heterogenous expression in host cell to influence the active application of SRE.Preferably, this application comprises that the polynucleotide external source expression inhibiting SRE activatory in host cell with the coding region that is selected among SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, the SEQID NO:9 or full length sequence is used and polynucleotide external source expressing promoting in host cell with the coding region that is selected among SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, the SEQ ID NO:17 or full length sequence is advanced the SRE activatory and used.

In a sixth aspect of the present invention, provide above-mentioned polynucleotide and polypeptide to prevent and/or treat purposes in the medicine of the disease of the musculature relevant or tumour with propagation or muscle differentiation in preparation.Preferably, prevent and/or treat purposes in the medicine of relative diseases such as muscle hyperplasia, muscle are reinvented, aging or tumour in preparation.

Aspect the present invention ground the 7th, a kind of pharmaceutical composition is provided, it contains the polypeptide and the pharmaceutically acceptable carrier of inducing the human body cell apoptosis function that have among the present invention of safe and effective amount.

In a eighth aspect of the present invention, provide a kind of and broken up the disease of relevant musculature or the external detection method of tumour with propagation or muscle, utilize above-mentioned antibody or nucleic acid fragment to detect the existence or the level of the polypeptide in host's sample.

Other aspects of the present invention since disclosing of the technology of this paper will be apparent to those skilled in the art.

As used herein, " isolating " is meant that material separates (if natural substance, primal environment promptly is a natural surroundings) from its primal environment.Do not have separation and purification as polynucleotide under the native state in the active somatic cell and polypeptide, if but same polynucleotide or polypeptide from native state, separate with common other materials that exist, then be separation and purification.Such polynucleotide may be the parts of a certain carrier, the part that also possible such polynucleotide or polypeptide are a certain composition, since carrier or composition are not the compositions of their natural surroundings, these polynucleotide or polypeptide remain isolating.

As used herein, " similarity " is meant and is used for describing the height that detects same DNA base between sequence and the target sequence or amino-acid residue order proportion in Nucleotide or the peptide sequence comparison process, it is a kind of direct quantitative relation, recently measure degree similar between nucleotide sequence or the peptide sequence by the same or analogous percentage of part, this similarity per-cent can calculate by the existing comparison method in this area, example has the comparison method FASTA program (Pearson between sequence in twos, W.R.and Lipman, D.J.1988.Improved tools for biological sequence comparison.Proc.Natl.Acad.Sci.85:2444-2448), blast program (Altschul, S.F., et al.1990Basic local alignment search tool.J.Mol.Biol.215:403-410) etc., or Multiple Sequence Alignment Method CLUSTAL W (CORPET, F.1998Multiple sequencealignment with hierarchical clustering.Nucleic Acids Res., 16:10881-10890) etc.Homologous sequence is meant the different sequences that form through divergent evolution from a certain common ancestor, can judge homology between aligned sequences according to similarity per-cent.When similarity degree is very high between gene or protein, represents that they have one section common evolution course, thereby judge that they can have similar biological function.When similarity degree, detect sequence and target sequence may be a homologous sequence than being easier to infer with at least 50%.Preferably, has at least 70% similarity degree; More preferably, has at least 85% similarity degree; Best, has at least 90% similarity degree.And when the similarity degree is lower than 20%, just be difficult to determine or can't determine at all whether it has homology.

Polynucleotide of the present invention comprise that its complementary strand can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.As used herein, " coding has the polynucleotide of the polypeptide of cell death inducing function " can be the polynucleotide that comprise this polypeptide of encoding, and also can be the polynucleotide that also comprise additional code sequence and/or non-coding sequence.With the SREIF1 encoded polypeptide is example, and the coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:1 or the varient of genetic code degeneracy.As used herein, " genetic code degeneracy " is meant that an amino acid has the phenomenon of several codons.The varient of the genetic code degeneracy of SREIF1 encoded polypeptide refer to the encode Nucleotide of polypeptide in the present invention for example with SEQ ID NO:2, and the coding region sequence shown in this Nucleotide and the SEQ IDNO:1 has difference.Have the polypeptide of inducing the human body cell apoptosis function for other, can the rest may be inferred.

The invention still further relates to the varient of above-mentioned polynucleotide, its coding has the polypeptide of identical aminoacid sequence or fragment, analogue and the derivative of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing the function of its encoded polypeptides in fact.

The invention still further relates to and the complementary sequence hybridization of polynucleotide sequence of the present invention and two sequences between have at least 50%, preferably at least 70%, the polynucleotide of at least 80% homogeny more preferably.The present invention be more particularly directed under stringent condition the interfertile polynucleotide of the complementary sequence of polynucleotide sequence therewith.In the present invention, " stringent condition " is meant: (1) than hybridization under low ionic strength and the comparatively high temps and wash-out, as 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time is added with denaturing agent, as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 95%, be more preferably 97% and just hybridize when above.And the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with polypeptide of the present invention.

Polynucleotide sequence of the present invention can obtain with this area existent method.These technology including, but not limited to: (1) is by hybridization technique DNA isolation sequence; (2) artificial chemical synthesising DNA sequence; (3) by the required polynucleotide of the extensive acquisition in construction cDNA library; (4) pcr amplification technology.

First method is to make up genomic library or cDNA library earlier, filters out goal gene or sequence by technology such as molecular hybridizations from genomic library or cDNA library then.When the biological gene group was smaller, this method is success easily; When the biological gene group is very big, make up difficulty of its complete genomic library, the quantities of removing to clone goal gene again from huge library is also very big.

Second method is by the long dna fragmentation of the once synthetic 100-200bp of the sequence that designs, and connects into complete gene with these synthetic fragment combination again.The price of the method for the gene order of this synthetic length is very expensive.This method be mainly used in synthetic as primer, connect the first grade nucleic acid fragment.

The third method is with usual method construction cDNA library, this area, repeatedly after the order-checking, in conjunction with bioinformatic analysis technology (Ota et al.Nat Genet.2004 Jan; 36 (1): 40-5), obtain purpose cDNA clone on a large scale.The bioinformatic analysis technology includes but not limited to BLAST or BLAT and the comparison of existing public database, as the refseq database etc.; With Phred algorithm assessment sequencing quality; ATGpr algorithm with the probability of occurrence that calculates transcription initiation codon ATG screens full length cDNA sequence etc.

The 4th kind of method method (Saiki, the et al.Science 1985 of round pcr DNA amplification/RNA; 230:1350-1354).The primer that is used for PCR can suitably be selected according to sequence information of the present invention disclosed herein, and available ordinary method is synthetic.Available ordinary method is as the DNA/RNA fragment by gel electrophoresis separation and purifying amplification.The method of advantageous applications of the present invention is that the amplification in mixing the cDNA library of two-step approach flux RT-PCR technology obtains a large amount of cDNA clones.Mix the cDNA library and comprise existing cDNA library and tumour library.

Gene of the present invention, the perhaps available ordinary method of mensuration of nucleotide sequence such as various dna fragmentations, as dideoxy chain termination (Sanger et al.PNAS, 1977,74:5463-5467); Also available commercial sequencing kit etc.In order to obtain the cDNA sequence of total length, order-checking need be carried out repeatedly.Sometimes need to measure a plurality of clones' cDNA sequence, just can be spliced into the cDNA sequence of total length.

Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic polypeptide, preferred recombinant polypeptide.Polypeptide of the present invention can be the product of natural purifying, or the product of chemosynthesis, or uses recombinant technology to produce from protokaryon or eucaryon host (as bacterium, yeast, higher plant, insect and mammalian cell).Polypeptide of the present invention can be glycosylated, also can be nonglycosylated.Polypeptide of the present invention can comprise or not comprise initial methionine residues.

The present invention also comprises fragment, derivative and the analogue of the people's protein polypeptide with the polynucleotide encoding of inducing the human body cell apoptosis function.Term " fragment ", " derivative " are meant basically with " analogue " and keep and the natural identical biological function or the active polypeptide of people's protein polypeptide of inducing the human body cell apoptosis function that have of the present invention.Polypeptide fragment of the present invention, derivative and analogue can be: one or more conservative or substituted polypeptide of non-conservation amino-acid residue (preferential conservative amino acid residue) (a) are arranged, and the amino-acid residue that replaces like this can be also can not encoded by genetic code, or (b) in one or more amino-acid residues, has a polypeptide of substituted radical, or (c) mature polypeptide and another compound (such as the compound that prolongs the polypeptide transformation period) merge formed polypeptide, or (d) additional aminoacid sequence is fused to this peptide sequence and the polypeptide that forms (as leader sequence or secretion sequence or be used for the sequence or the proteinogen sequence of this polypeptide of purifying).

Polypeptide of the present invention can be by conventional recombinant DNA technology, the protein polypeptide (Science, 1984 that utilize polynucleotide sequence of the present invention to express or produce having of reorganization to induce the human body cell apoptosis function; 224:1431).May further comprise the steps:

(1), or transforms or the transduction proper host cell with the expression vector that contains these polynucleotide with polynucleotide of the present invention (or its varient);

(2) host cell that culturing step (1) obtains in suitable medium;

(3) separation, the required protein polypeptide of purifying from substratum or cell.

Polynucleotide among the present invention and polypeptide preferably provide with isolating form, more preferably are purified to homogeneous.

The present invention also relates to comprise the carrier of polynucleotide of the present invention.Among the present invention, the polynucleotide sequence that coding has people's protein polypeptide of inducing the human body cell apoptosis function can be inserted in the recombinant expression vector.Term " recombinant expression vector " refers to bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus, as adenovirus, retrovirus, and perhaps other carriers.The carrier of Shi Yonging can be a prokaryotic expression carrier in the present invention, also can be carrier for expression of eukaryon, as the expression vector (Rosenberg based on T7 that expresses in bacterium, et al.Gene, 1987,56:125), the carrier for expression of eukaryon pcDNA of high expression level in mammalian cell ^TM3.1/myc-hisB (-) (Invitrogen), pcDNA3.1/V5-His-TOPO (Invitrogen below is abbreviated as pcDT).The preferred pcDT of the present invention, it can directly be connected with the PCR product and makes up carrier for expression of eukaryon, has improved the efficient of large-scale production greatly.As long as can duplicate in host and stablize, any plasmid and carrier can be used.A key character of expression vector is to contain replication orgin, promotor, marker gene and translation controlling elements usually.Making up the expression vector that contains polynucleotide sequence of the present invention and transcribe/translate control signal with method well-known to those having ordinary skill in the art gets final product.These methods comprise (Sambrook such as extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant DNA technology of body, et al.Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory.New York, 1989).

Polynucleotide sequence of the present invention can be connected to effectively and instruct mRNA synthetic on the suitable promotor in the expression vector.The representative example of these promotors has: colibacillary lac or trp promotor; The PL promotor of lambda particles phage; Eukaryotic promoter comprises LTRs and some other known may command gene expression promoter in protokaryon or eukaryotic cell or its virus of CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retrovirus.Expression vector also comprises ribosome bind site and the transcription terminator that translation initiation is used.Expression vector preferably comprises one or more selected markers, being provided for selecting the phenotypic character of transformed host cells, as being used for colibacillary tsiklomitsin or amicillin resistance or eukaryotic cell and cultivating green fluorescent protein (GFP), neomycin resistance and the Tetrahydrofolate dehydrogenase of usefulness.

The invention still further relates to the host cell that produces through genetically engineered with above-mentioned carrier or polynucleotide of the present invention.Carrier of the present invention and polynucleotide can be used to transform appropriate host cell, have the protein of inducing the human body cell apoptosis function so that it can be expressed.Host cell can be a prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria; Vegetable cell; The insect cell of fruit bat S2 or Sf9; The zooblast of CHO, COS or Bowes melanoma cells; 293T, Hela cell etc.

When polynucleotide of the present invention are expressed, transcribe enhancing if will make when in carrier, inserting enhancer sequence in higher eucaryotic cells.Enhanser is the cis acting factor of DNA, and 10-300 base pair arranged usually, acts on promotor transcribing with enhancing gene.Example has: at the SV40 enhanser of 100-270 the base pair in replication origin downstream, at the polyoma enhanser in replication origin downstream and adenovirus enhanser etc.

Those of ordinary skill in the art knows how to select appropriate carriers, promotor, enhanser and host cell.

Can carry out with routine techniques well known to those skilled in the art with the recombinant DNA transformed host cell.When host cell was prokaryotic cell prokaryocyte such as intestinal bacteria, the competent cell that can absorb DNA can be collected at the exponential growth after date, uses CaCl ₂Method is handled, and used step is well-known in the art.Alternative is MgCl ₂Handle, also the method for available electroporation is handled.When the host is eukaryotic cell, can select following transfection method: coprecipitation of calcium phosphate method, conventional mechanical method such as microinjection, electroporation, liposome packing etc.The transformant that obtains can be cultivated with ordinary method, expresses polynucleotide encoded polypeptide of the present invention.Select suitable conventional substratum according to selected host cell, under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, with appropriate means such as temperature inversion or chemical induction, induce the promotor of selection, cell is cultivated for some time again.

Recombinant polypeptide in the aforesaid method can wrap by in cell, extracellular or on cytolemma, express or be secreted into the extracellular.If desired, can utilize its physics, chemical separating and the purification of Recombinant polypeptide by various separation methods with other characteristics.These methods are well-known to those skilled in the art, handle as the renaturation of routine, handle the combination of (salt analysis method), centrifugal, the broken bacterium of infiltration, ultrasonication, super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography and other various liquid chromatography (LC) technology or these methods with protein precipitant.

The invention still further relates to any a part of homologous nucleic acid fragment with polynucleotide of the present invention.As used herein, the length of " nucleic acid fragment " contains 15 Nucleotide at least, is preferably at least 30 Nucleotide, is more preferably at least 50 Nucleotide, and best is at least 100 Nucleotide.This nucleic acid fragment is the dna sequence dna of chemosynthesis on the basis of nucleotide sequence information of the present invention normally.Above-mentioned nucleic acid fragment can be used for pcr amplification technology (as primer) and have the polynucleotide of inducing the human body cell apoptosis function to determine and/or to separate coding; Also can be used as the used probe of hybridization.Also can be used for the RNA perturbation technique.Part or all of polynucleotide of the present invention also can be used as probe stationary on microarray (Microarray) or DNA chip, is used for analyzing the differential expression and the gene diagnosis of tissue gene.The mark of probe can be used radio isotope, fluorescein or enzyme (as alkaline phosphatase) etc.

Polypeptide of the present invention can be directly as the pharmacological agent disease, as musculature disease relevant with propagation or muscle differentiation and tumour etc.; Also can be used for screening and promote or antagonism has proteic antibody, polypeptide or other part that influence the active function of SRE, for example, screen the antibody that can be used for promoting or suppressing proteic function of the present invention.Albumen of the present invention with the reorganization of expressing screens peptide library, is used to seek the peptide molecule that can promote or suppress proteic function of the present invention of therapeutic value.

Polypeptide of the present invention can use separately or use with suitable pharmaceutical carrier combination back.Composition comprises the polypeptide or the antagonist of safe and effective amount and does not influence the carrier and the excipient of effect of drugs.These carriers can be water, glucose, ethanol, salt, damping fluid, glycerine and their combination.Pharmaceutical composition can be with mode administration easily, as by in part, intravenously, intraperitoneal, intramuscular, subcutaneous, the nose or the route of administration of intracutaneous.The consumption that delivers medicine to the patient depends on many factors, as administering mode, person's to be treated healthiness condition and diagnostician's judgement.

Polypeptide of the present invention also can use by express these polypeptide at live body.For example patient's cell can carry out the genetically engineered operation by the gene at external use code book invention polypeptide, then engineering cell is offered the patient, makes engineering cell this peptide species of high expression level in vivo, thereby reaches the purpose of treatment.

Have the proteic polynucleotide of the people who influences the SRE active function and also can be used for multiple therapeutic purpose.Can be used on to treat in the gene therapy technology and influence the people of the active function of SRE protein abnormal expression or the active disease that causes unusually owing to having.The gene therapy vector (as virus vector) of reorganization can be designed to express people's albumen that having of variation influences the active function of SRE, suppresses the endogenic proteic activity of the people who influences the SRE active function that has.The having of reorganization influences the people of SRE active function protein gene and also can be packaged in the liposome and be transferred in the cell.

Suppress the oligonucleotide (comprising sense-rna and DNA) of polypeptide mRNA of the present invention and nucleic acid also within the scope of the invention.Sense-rna and DNA and nucleic acid can be synthetic with this area existent method.In order to increase the stability of nucleic acid molecule, available several different methods is modified it, as increasing the sequence length of both sides, the connection between ribonucleoside phosphoric acid thioester bond or peptide bond.

Polypeptide of the present invention and fragment thereof, derivative, analogue or the cell of expressing them can be used as antigen and produce antibody.These antibody include but not limited to the antibody that monoclonal antibody, polyclonal antibody, chimeric antibody, single-chain antibody, Fab fragment and Fab expression library produce.The antibody of polypeptide of the present invention can be produced with preparation method for antibody well known in the art.Example has: monoclonal antibody can with hybridoma technology production (Kohler and Milstein.Nature, 1975,256:495-497).The available polypeptide immune animal of the present invention of the production of polyclonal antibody is as rabbit, mouse, rat etc.Multiple adjuvant can be used for the enhancing immunity reaction, includes but not limited to freund's adjuvant.The variable region bonded chimeric antibody in human constant region and inhuman source can be produced with existing technology (Morrison etal.PNAS, 1985,81:6851).The also available existing technology production of single-chain antibody (U.S.Pat No.4946778).

Antibody of the present invention can be used in the immunohistochemistry technology, detects the albumen with cell death inducing function in the living specimen.Can also be used for clinical diagnosis, treatment, therapeutic evaluation of the disease relevant etc. clinically with people's albumen with cell death inducing function.For example use labelled with radioisotope and polypeptide bonded monoclonal antibody of the present invention, inject then and follow the tracks of its position and distribution in the body, can be used as a kind of atraumatic diagnostic method and come the positioning tumor cell, or judge whether tumour cell shifts.Antibody among the present invention can also be used for the treatment of or prevent to influence the relevant disease of the people of SRE active function albumen with having.The antibody that gives suitable dosage can stimulate or block and has proteic generation of the people who influences the SRE active function or activity.

The invention still further relates to quantitatively and detection and localization has the diagnostic testing process of the protein level that influences the SRE active function.These tests are known in the art, and comprise that FISH measures and radioimmunoassay.That detects in the experiment has a protein level that influences the SRE active function, can have the importance of albumen in various diseases that influences the SRE active function with laying down a definition and be used to diagnose to have the disease that the albumen that influences the SRE active function works.

Have the proteic polynucleotide that influence the SRE active function and can be used for having the diagnosis and the treatment of the protein related diseases that influences the SRE active function.Aspect diagnosis, have the proteic polynucleotide that influence the SRE active function can be used for detecting have influence the SRE active function proteic expression whether, or under morbid state, have the abnormal exprssion that influences the SRE active function.As have the proteic dna sequence dna that influences the SRE active function and can be used for that the hybridization of biopsy specimen is had the proteic abnormal expression that influences the SRE active function with judgement.Hybridization technique is the disclosed mature technology in this area, comprises Southern blotting, Northern blotting, in situ hybridization etc., and relevant test kit can obtain from commercial channels.Part or all of polynucleotide of the present invention can be used as probe stationary on microarray (Microarray) or DNA chip, is used for analyzing the differential expression and the gene diagnosis of tissue gene.The special primer of the albumen of the influential SRE active function of apparatus carries out RNA-polymerase chain reaction (RT-PCR) amplification in vitro and also can detect and have the proteic transcription product that influences the SRE active function.

The sudden change that detection has a protein gene that influences the SRE active function also can be used for diagnosing and has the relevant disease of albumen that influences the SRE active function.Mutant form with the protein gene that influences the SRE active function comprises that to influence point mutation that the proteic dna sequence dna of SRE active function compares, transposition, disappearance, reorganization and other any unusual etc. with having of normal wild type.Existing technology in available this area such as Southern blotting, dna sequence analysis, PCR and in situ hybridization detect sudden change.In addition, sudden change might influence proteic expression, therefore can judge indirectly that with Northern blotting, Westen blotting gene has or not sudden change.

In gene SREIF1,2,3,4,5,6,7,8,9 healthy tissues that all are used in experiment, fetal tissue, the tumor tissues expression is arranged all, illustrate that it is the important SRE factor of influence of human body self; Expression amount just has difference in different tissues, and the degree difference of its performance function in different tissues is described.

Below embodiment of the present invention are further described.

The present invention carries out the retrieval of people's Unknown Function predicted gene by the refseq database to NCBI, obtain people's unknown function gene order, further utilizing the Human_est database to carry out sequence by the BLASTn method proofreaies and correct, according to the sequences Design gene specific primer that obtains after proofreading and correct, from mix people's tissue cDNA library, obtain the coding region cDNA fragment of goal gene by the amplification of two-step approach flux RT-PCR technology.This coding region cDNA fragment and pcDT recombination to construct carrier for expression of eukaryon.Adopt two luciferase reporter gene methods to detect the influence of SREIF1,2,3,4,5,6,7,8,9 gene pairs SRE then.What this method adopted is signal transduction pathway cis report system in the body, wherein used SRE-luc reporter plasmid is loaded with firefly luciferase gene, this expression of gene is regulated and control by the synthetic promotor, wherein comprise basic promoter element (TATA box), and the binding site of transcription factor SRE, the structure iron of SRE-luc reporter plasmid is as shown in Figure 2.When intracellular SRE is activated by certain signal transduction pathway, SRE just can be incorporated into the enhancer element of reporter plasmid SRE-luc, thereby start transcribing of reporter gene firefly luciferase gene, further translate into luciferase in the born of the same parents, cause luciferase quantity increase in the cell, increased activity; On the contrary, when intracellular SRE activation is suppressed, the expression amount of luciferase and active just low.So,, can reflect just whether the interior SRE of goal gene pair cell of different stimulated thing and cotransfection has the activation of promotion or suppress the activatory function by detecting the activity of luciferase.PRL-SV40 reporter plasmid carrier as shown in Figure 2, contain the jellyfish luciferases gene, this expression of gene is regulated and control by simian virus 40 (SV40) enhancers/promoters, can produce the expression of the jellyfish luciferases of stronger basic horizontal behind the transfection mammalian cell, and the adjusting whether activity of expressing is not activated by SRE is so be used as the internal reference reporter gene in experiment.Experiment shows that polypeptide of the present invention has remarkable, the stable active effect of SRE that influences.

Owing to adopted above technical scheme, the present invention has following advantage:

1, provide mass-producing to clone and screen the technology platform of new gene.

2, human new functional gene SREIF1,2,3,4,5,6,7,8,9 cDNA sequence and coded polypeptide thereof are provided;

3, find that first human new functional gene SREIF1,2,3,4,5,6,7,8,9 has the active effect of the SRE of influence, and efficient, stable;

4, SREIF1,2,3,4,5,6,7,8,9 expresses at the most normal cells of body, illustrates that it is self important SRE regulatory molecule.

5, based on 4 above-mentioned advantages, the present invention be further research SREIF1,2,3,4,5,6,7,8,9 and SRE between regulation relationship, and the novel drugs of exploitation treatment and propagation and muscle differentiation phase related disorders or tumour, establish necessary base for starting new clinical diagnosis, therapeutic evaluation and prognostic indicator.

Description of drawings

The structure synoptic diagram of Fig. 1, carrier for expression of eukaryon pcDT-SREIFx (SREIFx is selected from SREIF1,2,3,4,5,6,7,8,9)

Structure iron of Fig. 2, pSRE-luc luciferase gene reporter plasmid (last figure) and pRL-SV40 reporter plasmid structure iron (figure below)

Fig. 3, SREIF1,2,3,4,5 heterogenous expressions suppress the activation of PMA to SRE

Fig. 4, SREIF6,7,8,9 heterogenous expressions promote the SRE activation

Embodiment

Below in conjunction with specific embodiments and the drawings, further set forth the present invention.These embodiment and accompanying drawing only are used to the present invention is described and are not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, condition described in " molecular cloning experiment guide " (chopsticks such as the third edition [U.S.] Sa nurse Brooker in 2002, Science Press), or the condition of advising according to manufacturer.

Embodiment 1, two-step approach flux RT-PCR technology amplifying target genes

(1) the refseq database to NCBI carries out the retrieval of people's Unknown Function predicted gene, obtain people's unknown function gene order, and utilize the Human_est database to carry out sequence by the BLASTn method and proofread and correct, the sequence that finally obtains is set at down the group sequence: SEQID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17.According to this type of sequences Design gene SREIF1,2,3,4,5,6,7,8,9 special primer:

The gene title	Upstream primer (5 '-3 ')	Downstream primer (5 '-3 ')
			SREIF1 SREIF2 SREIF3 SREIF4 SREIF5 SREIF6 SREIF7 SREIF8 SREIF9	ctgctcgcacaggactcgg cagacgccacggagtttgtg gtgcgatgagcttcttcggc gtgatatgagcaacaatggaccag caccatgatgcaaatctgcga aggacctgggtttcagtgatgag gctcctctggctgatggcat ggactttccttacctgtttttccag cgcttgccattcaacatcatg	gggctataactcagactgggatctg tggcaccagaaaaacccatctc tgcaagtaacgggtcaactgagc cactatattactcactcgtcaccactctg tgggtcgaagaaggtgctgg cctgatagccagtcgagttctcttatatc tcctgggacagagccactaagtc ggctatgtggctgttgtgtgc ggaaaataaactgagcctactgaggag

(2) use above-mentioned primer, in existing cDNA library and tumour library, select template, carry out just expanding by the express spectra of goal gene.Existing library comprises 12 kinds of human normal tissues (heart, pancreas, testis, ovary, prostate gland, colon, small intestine, skeletal muscle, thymus gland, lymphoglandula, tonsilla, white corpuscle); 6 kinds of people's tumor tissues (lung cancer, carcinoma of the pancreas, ovarian cancer, prostate cancer, colorectal carcinoma, mammary cancer); With the cDNA library of 8 kinds of fetuses group long-pending (tire lung, fetal rhythm, tire liver, tire spleen, tire kidney, tire brain, tire skeletal muscle, tire thymus gland) (Clonetch, K1420-1,1241-1).It is as follows just to expand reaction conditions:

50 μ l PCR reaction:

CDNA mixing storehouse 5 ', 3 ' primer, 10 * Pyrobest buffer 2.5mM dNTPs Pyrobest distilled water

Each 1.0 μ l final concentration is that 2pmol/ μ l 5 μ l 4 μ l 1 μ l complements to 50 μ l

PCR extends the long segment of time according to the expansion goal gene, increases by the principle of 50sec/Kb:

The thing of just expanding production is purified to 30 μ l, with primers a large amount of in the removal PCR reaction system and dNTPs etc., and concentrates whole system, obtains the secondary amplification bank of corresponding target gene sequences, as two templates that expand (the big expansion).

(3) with the purified product in (2) as template, respectively each goal gene is carried out two expansions, reaction conditions is as follows:

50 μ l PCR (each gene) reaction:

One expands purified product 5 ', 3 ' primer 10 * Ex-Taq buffer 2.5mM dNTP Ex-Taq distilled water

1.6 being 2pmol/ μ l 5 μ l 4 μ l 0.5 μ l, μ l final concentration complements to 50 μ l

PCR extends the long segment of time according to the expansion goal gene, increases by the principle of 50sec/Kb:

The PCR product that obtains is got sample electrophoresis on the 10 μ l, selects the PCR product of amplified band, carries out equal-volume purifying (40 μ l).The gene that amplifies non-single band by the two-step pcr reaction reclaims test kit with Qiagen glue and cuts glue recovery purpose fragment.The result of amplification shows, all there are gene SREIF1,2,3,4,5,6,7,8,9 cDNA in the cell of these tissues, illustrate that SREIF1,2,3,4,5,6,7,8,9 has produced gene SREIF1,2,3,4,5,6,7,8,9 transcription product in the cell of these tissues, wider expression map is arranged, in multiple tissue, participate in the adjusting of transcription factor.

Embodiment 2, goal gene Construction of eukaryotic

With two expansion purified product and carrier for expression of eukaryon pcDNA3.1/V5-His-TOPO (Invitrogen is abbreviated as pcDT), carry out ligation according to the condition of test kit manufacturer suggestion.Connect product electric shocking method transformed into escherichia coli DH5 α, conversion product is grown containing on the solid LB plate culture medium of penbritin, select the monospecific polyclonal bacterium colony of growth, extract plasmid, cut with the EcoRI enzyme, enzyme is cut product and is identified with agarose gel electrophoresis, has selected and has inserted segmental positive colony, select correct forward by order-checking (ABI PRISM 3700 DNA analysis instrument) and insert clone, called after SREIF1,2,3,4,5,6,7,8,9 separately.

Collect nutrient solution simultaneously, analyze protein precipitation, obtain SREIF1,2,3,4,5,6,7,8,9 polypeptide with SDS-PAGE.

SREIF1,2,3,4,5,6,7,8,9 analysis of protein results show: SREIF1,2,3,4,5,6,7,8, following group of sequence of 9 protein sequences: shown in SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, the SEQ ID NO:18.

Embodiment 3, two luciferase reporter gene method are measured goal gene PMA are induced SRE activatory restraining effect.

With goal gene and reporter gene pSRE-luc, pRL-TK cotransfection human embryo kidney 293T cell is measured the activity of SRE by detecting two kinds of uciferase activities respectively.The method of cotransfection is the non-fat infection protocol of positively charged ion, adopts prestige lattice Lars biotechnologys (Beijing) company limited, is undertaken by product description is described.

The transfection operation steps is as follows:

(1) cell cultures: 293T cell (ATCC Number:CRL-11268) (2.0 * 104) is used DMEM (Dulbecco ' s modified Eagle ' s medium) substratum (Hyclone that contains 10% foetal calf serum, SH0022.02) be layered on 96 porocyte culture plate (Costar, 3599) on, inoculum density 1.2 ten thousand/hole, culture volume 100ul/ hole, at 5%CO2, cultivated 18-24 hour in 37 ℃ the incubator.

(2) preparation transfection composite:

Get 2.5 μ l physiological saline dilution 40ng reporter gene pSRE-luc, 4ng pRL-TK and 50ng purpose plasmid slowly mix; With the vigofect (being generally 0.04 μ l/ hole) of 2.5 μ l physiological saline dilution appropriate amount, slowly mix equally, at room temperature placed 5 minutes, slowly mix with the DNA of dilution, room temperature was placed 15 minutes, to form transfection composite.

(3) transfection: transfection composite is slowly splashed into Tissue Culture Plate (5 μ l/ hole), slightly shake up.5%CO ₂, cultivated 18-24 hour in 37 ℃ the incubator.

With PMA (TETRADECONIC ACID Buddhist ripple ester, Calbiochem, 524400, final concentration 50ng/ml) irritation cell, 37 ℃ of incubators are cultivated after transfection 18-24 hour.Discard nutrient solution after 6-8 hour, (Promega E1960), puts into-80 ℃ of refrigerators to add Passive Lysis Buffer.During detection, take out cell plate, thaw naturally under the room temperature, make the complete cracking of cell, 10 μ l cell pyrolysis liquids move to the white fluorescent plate, add the two reporting systems of Dual-luciferase and detect substrate, (Genios Pro Tecan) detects uciferase activity with the microwell plate microplate reader.

Intracellular uciferase activity ratio (Photinus pyralis LUC fluorescence intensity/jellyfish luciferases fluorescence intensity is represented) is 1 when setting transfection pcDT empty carrier, PMA stimulation, intracellular uciferase activity ratio is represented with relative value as standard under other conditions.The result is with reference to Fig. 3, use plasmid to be checked and pSRE-luc cotransfection 293T cell respectively, the activity of luciferase is reduced significantly in the 293T cell that stimulates with PMA, shows that the expression product of SREIF1,2,3,4,5 in the 293T cell induce the SRE activation that strong restraining effect is arranged to PMA.

Can determine that according to above experimental result when the rise of SRE expression level caused increase corresponding with the transcriptional expression of some disease related gene, SREIF1,2,3,4,5 pairs of SRE activatory restraining effect can stop the generation and the development of this disease.Therefore, the present invention can be used to prepare prevention and treatment because SRE crosses the musculature disease that expression causes or the medicine of tumour.

Embodiment 4, two luciferase reporter gene method are measured goal gene to SRE activatory promoter action.

Except that stimulating without stimulator, all the other experimentations and step are with embodiment 3.

The result is with reference to Fig. 4, use plasmid to be checked and pSRE-luc cotransfection 293T cell respectively, uciferase activity ratio is standard 100% during with transfection empty carrier pcDT, plasmid to be checked can obviously promote the activation of SRE, the pSRE-luc uciferase activity obviously raises, and shows that activation has strong promoter action to the expression product of SREIF1,2,3,4,5 in the 293T cell to SRE.

Can determine that according to above experimental result when the downward modulation of SRE expression level caused minimizing corresponding with the transcriptional expression of some disease related gene, SREIF6,7,8,9 pairs of SRE activatory promoter actions can stop the generation and the development of this disease.Therefore, the present invention can be used to prepare prevention and treat because SRE expresses the less musculature disease that causes or the medicine of tumour.

Embodiment 5, Antibody Preparation

Antigen is selected SREIF1,2,3,4,5,6,7,8,9 albumen total lengths or the partial peptide section of prokaryotic cell prokaryocyte or eukaryotic cell expression for use, also can synthesize polypeptide as antigen.

Polyclonal Antibody Preparation: immune animal is selected bull new zealand rabbit or BALb/c mouse for use, after initial immunity uses 200ug (new zealand rabbit) or 20ug (BALb/c mouse) antigen and equal-volume Freund's complete adjuvant (FCA) fully emulsified, the subcutaneous multi-point injection in the back.Behind the initial immunity 21,42,63 days, with Freund's incomplete adjuvant (FIA) emulsive antigen protein fully, each booster immunization 1 time, consumption was the same.Each immunity back 7 ~ 10 days, the ELISA method detects serum titer, reaches 1 * 10 ^-4The time, the bloodletting separation of serum.Western blot identifies antibodies specific.

Monoclonal Antibody: immune BALb/c mouse is the same, gets spleen and makes the B cell suspension, with the myeloma cell SP2/0 fusion of logarithmic phase, by HAT (H: xanthoglobulin; A: aminopterin-induced syndrome; T: thymidine) selectivity is cultivated, and obtains hybrid cell line, detects antibody titer by the ELISA method again, filters out specific hybridoma cell line, and obtains monoclonal antibody.

Sequence table

＜110〉Sinogenomax Co., Ltd.

＜120〉influence the active polynucleotide of SRE and coded polypeptide and purposes

<130>

<160>18

<170>PatentIn version 3.3

<210>1

<211>1280

<212>DNA

＜213〉people

<220>

<221>CDS

<222>(105)..(794)

<400>1

agttgctttg ctgttagcct gttggacctt cgagcctagc tgctcgcaca ggactcggcc 60

acctgccctt cctgcaccga ctggccagct caagaggttt ggat atg gac ctt ctt 116

Met Asp Leu Leu

1

caa ttc ctg gcc ttc ctc ttt gtc ctg ctt ttg tct ggg atg gga gcc 164

Gln Phe Leu Ala Phe Leu Phe Val Leu Leu Leu Ser Gly Met Gly Ala

5 10 15 20

aca ggc acc ttg agg acc tcc ctg gac cca agc ctg gag atc tac aag 212

Thr Gly Thr Leu Arg Thr Ser Leu Asp Pro Ser Leu Glu Ile Tyr Lys

25 30 35

aag atg ttt gag gtg aag cgg cgg gag cag ctg ttg gca ctg aag aac 260

Lys Met Phe Glu Val Lys Arg Arg Glu Gln Leu Leu Ala Leu Lys Asn

40 45 50

ctg gca cag ctg aac gac atc cac cag cag tac aag atc ctt gat gtc 308

Leu Ala Gln Leu Asn Asp Ile His Gln Gln Tyr Lys Ile Leu Asp Val

55 60 65

atg ctc aag ggg ctc ttt aag gtg ctg gag gac tcc cgg aca gtg ctc 356

Met Leu Lys Gly Leu Phe Lys Val Leu Glu Asp Ser Arg Thr Val Leu

70 75 80

acc gct gct gat gtg ctc cca gat ggg ccc ttc ccc cag gac gag aag 404

Thr Ala Ala Asp Val Leu Pro Asp Gly Pro Phe Pro Gln Asp Glu Lys

85 90 95 100

ctg aag gat gct ttc tcc cac gtg gtg gag aac acg gcc ttc ttc ggc 452

Leu Lys Asp Ala Phe Ser His Val Val Glu Asn Thr Ala Phe Phe Gly

105 110 115

gat gtg gtg ctg cgc ttc ccg agg att gtg cac tat tac ttt gac cac 500

Asp Val Val Leu Arg Phe Pro Arg Ile Val His Tyr Tyr Phe Asp His

120 125 130

aac tcc aac tgg aac ctc ctc atc cgc tgg ggt atc agt ttc tgc aac 548

Asn Ser Asn Trp Asn Leu Leu Ile Arg Trp Gly Ile Ser Phe Cys Asn

135 140 145

cag aca ggc gtc ttc aac cag ggg ccc cac tcg ccc atc ctc agc ctg 596

Gln Thr Gly Val Phe Asn Gln Gly Pro His Ser Pro Ile Leu Ser Leu

150 155 160

atg gcc cag gag ctg ggg atc agt gag aaa gac tcc aac ttc cag aac 644

Met Ala Gln Glu Leu Gly Ile Ser Glu Lys Asp Ser Asn Phe Gln Asn

165 170 175 180

cca ttt aaa atc gac cgc aca gag ttc att ccc agc act gac cct ttc 692

Pro Phe Lys Ile Asp Arg Thr Glu Phe Ile Pro Ser Thr Asp Pro Phe

185 190 195

cag aag gcc ctg aga gaa gaa gag aaa cgc cga aag aaa gag gag aag 740

Gln Lys Ala Leu Arg Glu Glu Glu Lys Arg Arg Lys Lys Glu Glu Lys

200 205 210

cgg aag gag atc cga aaa ggc cca agg atc tcc aga tcc cag tct gag 788

Arg Lys Glu Ile Arg Lys Gly Pro Arg Ile Ser Arg Ser Gln Ser Glu

215 220 225

tta tag ccctggagca gctcagggct cagggggcca caaggaggca ggtcgggagg 844

Leu

aagaagaggt ggaggtgtgg ttgtggtgga gagcaccagc tagccccttc cagaagggga 904

ggccacattt gcccggcccc ctggagctgg gtctgagccc cagctgaagg gactgagcct 964

cagatggctg gattttctct caggggcctc ctgctgaagg ggccttcaga ggattttatg 1024

ctggaaatat gaccctgtgc agactgctgg gggaggcagg aggatgcctg cctggaccct 1084

gttggtggct gaagacctct ggccagctgg cttccgccct tggtggggaa gcagcagaac 1144

taggttctga gccacgggtc agggtgccac cctgctgctg gccccactgt gtcacagagc 1204

tgcctggcac aggtcccagc ccctctgcag agacacaata aaagccagca gaccctttga 1264

aaaaaaaaaa aaaaaa 1280

<210>2

<211>229

<212>PRT

＜213〉people

<400>2

Met Asp Leu Leu Gln Phe Leu Ala Phe Leu Phe Val Leu Leu Leu Ser

1 5 10 15

Gly Met Gly Ala Thr Gly Thr Leu Arg Thr Ser Leu Asp Pro Ser Leu

20 25 30

Glu Ile Tyr Lys Lys Met Phe Glu Val Lys Arg Arg Glu Gln Leu Leu

35 40 45

Ala Leu Lys Asn Leu Ala Gln Leu Asn Asp Ile His Gln Gln Tyr Lys

50 55 60

Ile Leu Asp Val Met Leu Lys Gly Leu Phe Lys Val Leu Glu Asp Ser

65 70 75 80

Arg Thr Val Leu Thr Ala Ala Asp Val Leu Pro Asp Gly Pro Phe Pro

85 90 95

Gln Asp Glu Lys Leu Lys Asp Ala Phe Ser His Val Val Glu Asn Thr

100 105 110

Ala Phe Phe Gly Asp Val Val Leu Arg Phe Pro Arg Ile Val His Tyr

115 120 125

Tyr Phe Asp His Asn Ser Asn Trp Asn Leu Leu Ile Arg Trp Gly Ile

130 135 140

Ser Phe Cys Asn Gln Thr Gly Val Phe Asn Gln Gly Pro His Ser Pro

145 150 155 160

Ile Leu Ser Leu Met Ala Gln Glu Leu Gly Ile Ser Glu Lys Asp Ser

165 170 175

Asn Phe Gln Asn Pro Phe Lys Ile Asp Arg Thr Glu Phe Ile Pro Ser

180 185 190

Thr Asp Pro Phe Gln Lys Ala Leu Arg Glu Glu Glu Lys Arg Arg Lys

195 200 205

Lys Glu Glu Lys Arg Lys Glu Ile Arg Lys Gly Pro Arg Ile Ser Arg

210 215 220

Ser Gln Ser Glu Leu

225

<210>3

<211>755

<212>DNA

＜213〉people

<220>

<221>CDS

<222>(76)..(630)

<400>3

aactagctcc accctctaac ccccactcca gctgcagacg ccacggagtt tgtgcagggg 60

cgcagcgctc cagcc atg gcg cgt tcg ctc gtc cac gac acc gtg ttc tac 111

Met Ala Arg Ser Leu Val His Asp Thr Val Phe Tyr

1 5 10

tgc ctg agt gta tac cag gta aaa ata agc ccc aca cct cag ctg ggg 159

Cys Leu Ser Val Tyr Gln Val Lys Ile Ser Pro Thr Pro Gln Leu Gly

15 20 25

gca gca tca agc gca gaa ggc cat gtt ggc caa gga gct cca ggc ctc 207

Ala Ala Ser Ser Ala Glu Gly His Val Gly Gln Gly Ala Pro Gly Leu

30 35 40

atg ggt aat atg aac cct gag ggc ggt gtg aac cac gag aac ggc atg 255

Met Gly Asn Met Asn Pro Glu Gly Gly Val Asn His Glu Asn Gly Met

45 50 55 60

aac cgc gat ggc ggc atg atc ccc gag ggc ggc ggt gga aac cag gag 303

Asn Arg Asp Gly Gly Met Ile Pro Glu Gly Gly Gly Gly Asn Gln Glu

65 70 75

cct cgg cag cag ccg cag ccc ccg ccg gag gag ccg gcc cag gcg gcc 351

Pro Arg Gln Gln Pro Gln Pro Pro Pro Glu Glu Pro Ala Gln Ala Ala

80 85 90

atg gag ggt ccg cag ccc gag aac atg cag cca cga act cgg cgc acg 399

Met Glu Gly Pro Gln Pro Glu Asn Met Gln Pro Arg Thr Arg Arg Thr

95 100 105

aag ttc acg ctg ttg cag gtg gag gag ctg gaa agt gtt ttc cga cac 447

Lvs Phe Thr Leu Leu Gln Val Glu Glu Leu Glu Ser Val Phe Arg His

110 115 120

act caa tac cct gat gtg ccc aca aga agg gaa ctt gcc gaa aac tta 495

Thr Gln Tyr Pro Asp Val Pro Thr Arg Arg Glu Leu Ala Glu Asn Leu

125 130 135 140

ggt gtg act gaa gac aaa gtg cgg gtt tgg ttt aag aat aaa agg gcc 543

Gly Val Thr Glu Asp Lys Val Arg Val Trp Phe Lys Asn Lys Arg Ala

145 150 155

aga tgt agg cga cat cag aga gaa tta atg ctc gcc aat gaa cta cgt 591

Arg Cys Arg Arg His Gln Arg Glu Leu Met Leu Ala Asn Glu Leu Arg

160 165 170

gct gac cca gac gac tgt gtc tac atc gtc gtg gac tag ccctagaatg 640

Ala Asp Pro Asp Asp Cys Val Tyr Ile Val Val Asp

175 180

ccatccttct tcaggagcta gtttggagat gggtttttct ggtgccactg acacctgggc 700

tgcccatgcc gctcaggcta cccttatctc ctctgcactt atgttatcaa taaag 755

<210>4

<211>184

<212>PRT

＜213〉people

<400>4

Met Ala Arg Ser Leu Val His Asp Thr Val Phe Tyr Cys Leu Ser Val

1 5 10 15

Tyr Gln Val Lys Ile Ser Pro Thr Pro Gln Leu Gly Ala Ala Ser Ser

20 25 30

Ala Glu Gly His Val Gly Gln Gly Ala Pro Gly Leu Met Gly Asn Met

35 40 45

Asn Pro Glu Gly Gly Val Asn His Glu Asn Gly Met Asn Arg Asp Gly

50 55 60

Gly Met Ile Pro Glu Gly Gly Gly Gly Asn Gln Glu Pro Arg Gln Gln

65 70 75 80

Pro Gln Pro Pro Pro Glu Glu Pro Ala Gln Ala Ala Met Glu Gly Pro

85 90 95

Gln Pro Glu Asn Met Gln Pro Arg Thr Arg Arg Thr Lys Phe Thr Leu

100 105 110

Leu Gln Val Glu Glu Leu Glu Ser Val Phe Arg His Thr Gln Tyr Pro

115 120 125

Asp Val Pro Thr Arg Arg Glu Leu Ala Glu Asn Leu Gly Val Thr Glu

130 135 140

Asp Lys Val Arg Val Trp Phe Lys Asn Lys Arg Ala Arg Cys Arg Arg

145 150 155 160

His Gln Arg Glu Leu Met Leu Ala Asn Glu Leu Arg Ala Asp Pro Asp

165 170 175

Asp Cys Val Tyr Ile Val Val Asp

180

<210>5

<211>1626

<212>DNA

＜213〉people

<220>

<221>CDS

<222>(453)..(1463)

<400>5

ggcacgaggg aagcgcctcg gtgcgttgca ccgccggagg ctgggcagct cgcagcgctg 60

ctcggcgctg gaccccaccc ggcaggcgca ggccacccac acccggctct gtgcggctgc 120

cccccgcagc attgcacggc cgaccctcgc ccgcccactg ccaccggccg cgggactggc 180

tgggactggc tcggccgagg gcactgctcc tcggtgcatt gctgctcggg cgccgcagcc 240

cgcagccgcc agcctccccc ggccgtgccc ctcccccgtg gagccggctg tccgtcggcg 300

cccactgccc ggcggcagcg gcggagccag gcagccccgc ggcggccgag cgcgctcgcg 360

catcgggccc tctggccttc tttacctagg gcagcccgcg ccccggtgcg agggagcggt 420

ccttaccgag acccgcccgg cccggcggtg cg atg agc ttc ttc ggc ttc ggg 473

Met Ser Phe Phe Gly Phe Gly

1 5

cag agc gtg gag gtg gaa atc ctt ctg aac gat gca gag agt agg aag 521

Gln Ser Val Glu Val Glu Ile Leu Leu Asn Asp Ala Glu Ser Arg Lys

10 15 20

cgg gcc gag cac aag acg gag gac ggg aag aag gag aaa tat ttc ctc 569

Arg Ala Glu His Lys Thr Glu Asp Gly Lys Lys Glu Lys Tyr Phe Leu

25 30 35

ttc tac gac ggg gag acg gtc tcc ggg aag gtg agc ctt gcc ctc aag 617

Phe Tyr Asp Gly Glu Thr Val Ser Gly Lys Val Ser Leu Ala Leu Lys

40 45 50 55

aac ccc aac aag cgg ctg gag cac cag ggc atc aag atc gag ttc atc 665

Asn Pro Asn Lys Arg Leu Glu His Gln Gly Ile Lys Ile Glu Phe Ile

60 65 70

ggg cag atc gaa ctc tac tac gat cgc ggg aac cac cat gag ttt gtg 713

Gly Gln Ile Glu Leu Tyr Tyr Asp Arg Gly Asn His His Glu Phe Val

75 80 85

tcc ctg gtg aag gac ctg gcc cgg cct gga gag atc acc cag tcg cag 761

Ser Leu Val Lys Asp Leu Ala Arg Pro Gly Glu Ile Thr Gln Ser Gln

90 95 100

gcc ttc gac ttt gag ttt acc cac gtg gag aag ccg tat gag tcc tac 809

Ala Phe Asp Phe Glu Phe Thr His Val Glu Lys Pro Tyr Glu Ser Tyr

105 110 115

aca ggg cag aat gtg aag cta cgc tat ttc ctt cgt gct acc atc agc 857

Thr Gly Gln Asn Val Lys Leu Arg Tyr Phe Leu Arg Ala Thr Ile Ser

120 125 130 135

cgc cgc ctc aat gat gtt gtc aaa gag atg gac att gta gtt cac aca 905

Arg Arg Leu Asn Asp Val Val Lys Glu Met Asp Ile Val Val His Thr

140 145 150

ctc agc aca tac cca gag ctg aac tct tcc atc aag atg gag gtt ggg 953

Leu Ser Thr Tyr Pro Glu Leu Asn Ser Ser Ile Lys Met Glu Val Gly

155 160 165

att gag gac tgt ctg cac att gaa ttt gag tac aat aaa tcc aaa tac 1001

Ile Glu Asp Cys Leu HisIle Glu Phe Glu Tyr Asn Lys Ser Lys Tyr

170 175 180

cac ttg aaa gat gtc att gta ggg aag ata tac ttc ctg ctg gtg aga 1049

His Leu Lys Asp Val Ile Val Gly Lys Ile Tyr Phe Leu Leu Val Arg

185 190 195

atc aaa atc aag cac atg gag ata gac atc atc aag cga gaa acg acg 1097

Ile Lys Ile Lys His Met Glu Ile Asp Ile Ile Lys Arg Glu Thr Thr

200 205 210 215

ggt aca ggc ccc aac gtg tac cat gag aat gac acg ata gcc aag tac 1145

Gly Thr Gly Pro Asn Val Tyr His Glu Asn Asp Thr Ile Ala Lys Tyr

220 225 230

gag atc atg gac ggg gca cca gtg cga gga gag tcc atc ccg atc cgg 1193

Glu Ile Met Asp Gly Ala Pro Val Arg Gly Glu Ser Ile Pro Ile Arg

235 240 245

ctc ttc ctg gcc ggg tat gag ctc acg ccc acc atg cgg gac atc aac 124l

Leu Phe Leu Ala Gly Tyr Glu Leu Thr Pro Thr Met Arg Asp Ile Asn

250 255 260

aag aag ttc tct gtg cgc tat tac ctc aac ctg gtg ctg ata gac gag 1289

Lys Lys Phe Ser Val Arg Tyr Tyr Leu Asn Leu Val Leu Ile Asp Glu

265 270 275

gag gag cgg cgc tac ttc aag cag cag gaa gtg gtg ttg tgg cgg aag 1337

Glu Glu Arg Arg Tyr Phe Lys Gln Gln Glu Val Val Leu Trp Arg Lys

280 285 290 295

ggt gac atc gta cgg aag agc atg tcc cac cag gcg gcc atc gcc tca 1385

Gly Asp Ile Val Arg Lys Ser Met Ser His Gln Ala Ala Ile Ala Ser

300 305 310

cag cgc ttt gag ggc acc acc tcc ctg ggt gag gtg cgg acc ccc agc 1433

Gln Arg Phe Glu Gly Thr Thr Ser Leu Gly Glu Val Arg Thr Pro Ser

315 320 325

cag ctg tct gac aac aac tgc agg cag tag gcccccaggg ccgagaagat 1483

Gln Leu Ser Asp Asn Asn Cys Arg Gln

330 335

gctgggcacc cacccagcac ecccatctac caacaccagc ggctgggggc gggggcggac 1543

cttgtgaggc tcagttgacc cgttacttgc aacctgaaaa caaatcatgt ttttgactta 1603

aaaaaaaaaa aaaaaaaaaa aaa 1626

<210>6

<211>336

<212>PRT

＜213〉people

<400>6

Met Ser Phe Phe Gly Phe Gly Gln Ser Val Glu Val Glu Ile Leu Leu

1 5 10 15

Asn Asp Ala Glu Ser Arg Lys Arg Ala Glu His Lys Thr Glu Asp Gly

20 25 30

Lys Lys Glu Lys Tyr Phe Leu Phe Tyr Asp Gly Glu Thr Val Ser Gly

35 40 45

Lys Val Ser Leu Ala Leu Lys Asn Pro Asn Lys Arg Leu Glu His Gln

50 55 60

Gly Ile Lys Ile Glu Phe Ile Gly Gln Ile Glu Leu Tyr Tyr Asp Arg

65 70 75 80

Gly Asn His His Glu Phe Val Ser Leu Val Lys Asp Leu Ala Arg Pro

85 90 95

Gly Glu Ile Thr Gln Ser Gln Ala Phe Asp Phe Glu Phe Thr His Val

100 105 110

Glu Lys Pro Tyr Glu Ser Tyr Thr Gly Gln Asn Val Lys Leu Arg Tyr

115 120 125

Phe Leu Arg Ala Thr Ile Ser Arg Arg Leu Asn Asp Val Val Lys Glu

130 135 140

Met Asp Ile Val Val His Thr Leu Ser Thr Tyr Pro Glu Leu Asn Ser

145 150 155 160

Ser Ile Lys Met Glu Val Gly Ile Glu Asp Cys Leu His Ile Glu Phe

165 170 175

Glu Tyr Asn Lys Ser Lys Tyr His Leu Lys Asp Val Ile Val Gly Lys

180 185 190

Ile Tyr Phe Leu Leu Val Arg Ile Lys Ile Lys His Met Glu Ile Asp

195 200 205

Ile Ile Lys Arg Glu Thr Thr Gly Thr Gly Pro Asn Val Tyr His Glu

210 215 220

Asn Asp Thr Ile Ala Lys Tyr Glu Ile Met Asp Gly Ala Pro Val Arg

225 230 235 240

Gly Glu Ser Ile Pro Ile Arg Leu Phe Leu Ala Gly Tyr Glu Leu Thr

245 250 255

Pro Thr Met Arg Asp Ile Asn Lys Lys Phe Ser Val Arg Tyr Tyr Leu

260 265 270

Asn Leu Val Leu Ile Asp Glu Glu Glu Arg Arg Tyr Phe Lys Gln Gln

275 280 285

Glu Val Val Leu Trp Arg Lys Gly Asp Ile Val Arg Lys Ser Met Ser

290 295 300

His Gln Ala Ala Ile Ala Ser Gln Arg Phe Glu Gly Thr Thr Ser Leu

305 310 315 320

Gly Glu Val Arg Thr Pro Ser Gln Leu Ser Asp Asn Asn Cys Arg Gln

325 330 335

<210>7

<211>946

<212>DNA

＜213〉people

<220>

<221>CDS

<222>(155)..(913)

<400>7

ggaagtttgt ggcggaggtg aggccgaggt gactgcagag cggctcgcga gggttttgga 60

ctgataaagc aatggaagcc actgaagagc tttaagatga ggatggcatg gagggaagat 120

aagtcacata atcagttctg tgatatgagc aaca atg gac cag aag att tta tct 175

Met Asp Gln Lys Ile Leu Ser

1 5

cta gca gca gaa aaa aca gca gac aaa ctg caa gaa ttt ctt caa acc 223

Leu Ala Ala Glu Lys Thr Ala Asp Lys Leu Gln Glu Phe Leu Gln Thr

10 15 20

ctg aga gaa ggt gat ttg act aat ctc ctt cag aat caa gca gtg aaa 271

Leu Arg Glu Gly Asp Leu Thr Asn Leu Leu Gln Asn Gln Ala Val Lys

25 30 35

gga aaa gtt gct gga gca ctc ctg aga gcc atc ttc aaa ggt tcc ccc 319

Gly Lys Val Ala Gly Ala Leu Leu Arg Ala Ile Phe Lys Gly Ser Pro

40 45 50 55

tgc tct gag gaa gct gga aca ctt agg aga cgt aag ata tac act tgt 367

Cys Ser Glu Glu Ala Gly Thr Leu Arg Arg Arg Lys Ile Tyr Thr Cys

60 65 70

tgt atc cag ttg gtg gaa tcg ggg gat ttg cag aaa gaa ata gcg tct 415

Cys Ile Gln Leu Val Glu Ser Gly Asp Leu Gln Lys Glu Ile Ala Ser

75 80 85

gag atc ata gga tta ctg atg ctg gag gct cac cat ttt cca gga cca 463

Glu Ile Ile Gly Leu Leu Met Leu Glu Ala His His Phe Pro Gly Pro

90 95 100

tta ttg gtt gaa tta gcc aat gag ttt att agt gct gtc aga gaa ggc 511

Leu Leu Val Glu Leu Ala Asn Glu Phe Ile Ser Ala Val Arg Glu Gly

105 110 115

agc cta gtg aat gga aaa tct ttg gag tta cta cct atc att ctc act 559

Ser Leu Val Asn Gly Lys Ser Leu Glu Leu Leu Pro Ile Ile Leu Thr

120 125 130 135

gcc ctg gct acg aaa aag gaa aat ctg gct tat gga aaa ggt gta ctg 607

Ala Leu Ala Thr Lys Lys Glu Asn Leu Ala Tyr Gly Lys Gly Val Leu

140 145 150

agt ggg gaa gaa tgt aag aaa cag ttg att aac acc ctg tgt tct ggc 655

Ser Gly Glu Glu Cys Lys Lys Gln Leu Ile Asn Thr Leu Cys Ser Gly

155 160 165

agg tgg gat cag caa tat gta atc caa ctc acc tcc atg ttc aag gat 703

Arg Trp Asp Gln Gln Tyr Val Ile Gln Leu Thr Ser Met Phe Lys Asp

170 175 180

gtc cct ctg act gca gaa gag gtg gaa ttt gtg gtg gaa aaa gca ttg 751

Val Pro Leu Thr Ala Glu Glu Val Glu Phe Val Val Glu Lys Ala Leu

185 190 195

agc atg ttc tcc aag atg aat ctt caa gaa ata cca cct ttg gtc tat 799

Ser Met Phe Ser Lys Met Asn Leu Gln Glu Ile Pro Pro Leu Val Tyr

200 205 210 215

cag ctt ctg gtt ctc tcc tcc aag gga agc aga aag agt gtt ttg gaa 847

Gln Leu Leu Val Leu Ser Ser Lys Gly Ser Arg Lys Ser Val Leu Glu

220 225 230

gga atc ata gcc ttc ttc agt gca cta gat aag cag cac aat gag gaa 895

Gly Ile Ile Ala Phe Phe Ser Ala Leu Asp Lys Gln His Asn Glu Glu

235 240 245

cag agt ggt gac gag tga gtaatatagt gtagaaataa agatcatttt tac 946

Gln Ser Gly Asp Glu

250

<210>8

<211>252

<212>PRT

＜213〉people

<400>8

Met Asp Gln Lys Ile Leu Ser Leu Ala Ala Glu Lys Thr Ala Asp Lys

1 5 10 15

Leu Gln Glu Phe Leu Gln Thr Leu Arg Glu Gly Asp Leu Thr Asn Leu

20 25 30

Leu Gln Asn Gln Ala Val Lys Gly Lys Val Ala Gly Ala Leu Leu Arg

35 40 45

Ala Ile Phe Lys Gly Ser Pro Cys Ser Glu Glu Ala Gly Thr Leu Arg

50 55 60

Arg Arg Lys Ile Tyr Thr Cys Cys Ile Gln Leu Val Glu Ser Gly Asp

65 70 75 80

Leu Gln Lys Glu Ile Ala Ser Glu Ile Ile Gly Leu Leu Met Leu Glu

85 90 95

Ala His His Phe Pro Gly Pro Leu Leu Val Glu Leu Ala Asn Glu Phe

100 105 110

Ile Ser Ala Val Arg Glu Gly Ser Leu Val Asn Gly Lys Ser Leu Glu

115 120 125

Leu Leu Pro Ile Ile Leu Thr Ala Leu Ala Thr Lys Lys Glu Asn Leu

130 135 140

Ala Tyr Gly Lys Gly Val Leu Ser Gly Glu Glu Cys Lys Lys Gln Leu

145 150 155 160

Ile Asn Thr Leu Cys Ser Gly Arg Trp Asp Gln Gln Tyr Val Ile Gln

165 170 175

Leu Thr Ser Met Phe Lys Asp Val Pro Leu Thr Ala Glu Glu Val Glu

180 185 190

Phe Val Val Glu Lys Ala Leu Ser Met Phe Ser Lys Met Asn Leu Gln

195 200 205

Glu Ile Pro Pro Leu Val Tyr Gln Leu Leu Val Leu Ser Ser Lys Gly

210 215 220

Ser Arg Lys Ser Val Leu Glu Gly Ile Ile Ala Phe Phe Ser Ala Leu

225 230 235 240

Asp Lys Gln His Asn Glu Glu Gln Ser Gly Asp Glu

245 250

<210>9

<211>2381

<212>DNA

＜213〉people

<220>

<221>CDS

<222>(868)..(1419)

<400>9

ggcacgaggg gctcactctg caaccaaggc acgtgcattc tggtcatccc acgcggggag 60

cgcgcgcaag gcccgcccag cccccacatg ccagccccac cctccagtcg gtccggacgc 120

cgacgccttt ttgaccctcg ctgtgcccgg ccctcctcat ctggcctgcc cagggcttgg 180

tgctggcggg gtccagctgc tccaatccct cctcctctgc tctgccctgc cctgccctgg 240

cctgccccgg cgccctccct cagcccgggt atcaggcgag aggcggagct ggcccggcgc 300

gccccgcccc cgctgtagaa agggccgggc gagtgttact cgcggtcatc ccggcctggg 360

ccttttatct cggtgctgcc gggggaggcg ggaggaggag acaccagggg tggccctgag 420

cgccggcgac acctttcctg gactataaat tgagcacctg ggatgggtag ggggccaacg 480

cagtcaccgc cgtccgcagt cacagtccag ccactgaccg cagcagcgcc cttgcgtagc 540

agccgcttgc agcgagaaca ctgaattgcc aacgagcagg agagtctcaa ggcgcaagag 600

gaggccaggg ctcgacccac agagcaccct cagccatcgc gagtttccgg gcgccaaagc 660

caggagaagc cgcccatccc gcagggccgg tctgccagcg agacgagagt tggcgagggc 720

ggaggagtgc cgggaatccc gccacaccgg ctatagccag gcccccagcg cgggccttgg 780

agagcgcgtg aaggcgggca tccccttgac ccggccgacc atccccgtgc ccctgcgtcc 840

ctgcgctcca acgtccgcgc ggccacc atg atg caa atc tgc gac acc tac aac 894

Met Met Gln Ile Cys Asp Thr Tyr Asn

1 5

cag aag cac tcg ctc ttt aac gcc atg aat cgc ttc att ggc gcc gtg 942

Gln Lys His Ser Leu Phe Asn Ala Met Asn Arg Phe Ile Gly Ala Val

10 15 20 25

aac aac atg gac cag acg gtg atg gtg ccc agc ttg ctg cgc gac gtg 990

Asn Asn Met Asp Gln Thr Val Met Val Pro Ser Leu Leu Arg Asp Val

30 35 40

ccc ctg gct gac ccc ggg tta gac aac gat gtt ggc gtg gag gta ggc 1038

Pro Leu Ala Asp Pro Gly Leu Asp Asn Asp Val Gly Val Glu Val Gly

45 50 55

ggc agt ggc ggc tgc ctg gag gag cgc acg ccc cca gtc ccc gac tcg 1086

Gly Ser Gly Gly Cys Leu Glu Glu Arg Thr Pro Pro Val Pro Asp Ser

60 65 70

gga agc gcc aat ggc agc ttt ttc gcg ccc tct cgg gac atg tac agc 1134

Gly Ser Ala Asn Gly Ser Phe Phe Ala Pro Ser Arg Asp Met Tyr Ser

75 80 85

cac tac gtg ctt ctc aag tcc atc cgc aac gac atc gag tgg ggg gtc 1182

His Tyr Val Leu Leu Lys Ser Ile Arg Asn Asp Ile Glu Trp Gly Val

90 95 100 105

ctg cac cag ccg cct cca ccg gct ggg agc gag gag ggc agt gcc tgg 1230

Leu His Gln Pro Pro Pro Pro Ala Gly Ser Glu Glu Gly Ser Ala Trp

110 115 120

aag tcc aag gac atc ctg gtg gac ctg ggc cac ttg gag ggt gcg gac 1278

Lys Ser Lys Asp Ile Leu Val Asp Leu Gly His Leu Glu Gly Ala Asp

125 130 135

gcc ggc gaa gaa gac ctg gaa cag cag ttc cac tac cac ctg cgc ggg 1326

Ala Gly Glu Glu Asp Leu Glu Gln Gln Phe His Tyr His Leu Arg Gly

140 145 150

ctg cac act gtg ctc tcg aaa ctc acg cgc aaa gcc aac atc ctc act 1374

Leu His Thr Val Leu Ser Lys Leu Thr Arg Lys Ala Asn Ile Leu Thr

155 160 165

aac aga tac aag cag gag atc ggc ttc ggc aat tgg ggc cac tga 1419

Asn Arg Tyr Lys Gln Glu Ile Gly Phe Gly Asn Trp Gly His

170 175 180

ggcgtggcgc ccgtggctgc ccagcacctt cttcgaccca tctcaccctc tctcattcct 1479

caaagctttt ttttttttcc tggctggggg gcgggaaggg cagactgcaa actggggggc 1539

tgcgtacgtg caggaggcgc ggtggggctg cgtggaggag ggggccacgt gtgagagaga 1599

agaaaatggt ggccggagat gggagggccc aaggaacctc ctgggagggg gcctgcattc 1659

tatgttggtg ggaatgggac tgggctgacg ccctgcattc agcctgtgcc tttcctgggg 1719

tttcttttct gttcttttcg gaggagaggg cccgagaagg ggccatacca gggcgcggcg 1779

ctgggttgcc acacttggga aagcagcccg gagctgggtg ctggggaagg cggggcgcgt 1839

agcctcccgc cgccctgcgg ttgggccggt ggaggcccag gcgttgctag gattgcatca 1899

gttttcctgt ttgcactatt tctttttgta acattggccc tgtgtgaagt atttcgaatc 1959

tcctccttgc tctgaaactt cagcgattcc attgtgataa gcgcacaaac agcactgtct 2019

gtcggtaatc ggtactactt tattaatgat tttctgttac actgtatagt agtcctatgg 2079

cacccccacc ccatcccttt cgtgccactc ccgtccccac ccccacccca gtgtgtataa 2139

gctggcattt cgccagcttg tacgtagctt gccactcagt gaaaataata acattattat 2199

gagaaagtgg acttaaccga aatggaacca actgacattc tatcgtgttg tacatagaat 2259

gatgaagggt tccactgttg ttgtatgtct taaatttatt taaaactttt tttaatccag 2319

atgtagacta tattctaaaa aataaaaaag caaatgtgtc aactaaaaaa aaaaaaaaaa 2379

aa 2381

<210>10

<211>183

<212>PRT

＜213〉people

<400>10

Met Met Gln Ile Cys Asp Thr Tyr Asn Gln Lys His Ser Leu Phe Asn

1 5 10 15

Ala Met Asn Arg Phe Ile Gly Ala Val Asn Asn Met Asp Gln Thr Val

20 25 30

Met Val Pro Ser Leu Leu Arg Asp Val Pro Leu Ala Asp Pro Gly Leu

35 40 45

Asp Asn Asp Val Gly Val Glu Val Gly Gly Ser Gly Gly Cys Leu Glu

50 55 60

Glu Arg Thr Pro Pro Val Pro Asp Ser Gly Ser Ala Asn Gly Ser Phe

65 70 75 80

Phe Ala Pro Ser Arg Asp Met Tyr Ser His Tyr Val Leu Leu Lys Ser

85 90 95

Ile Arg Asn Asp Ile Glu Trp Gly Val Leu His Gln Pro Pro Pro Pro

100 105 110

Ala Gly Ser Glu Glu Gly Ser Ala Trp Lys Ser Lys Asp Ile Leu Val

115 120 125

Asp Leu Gly His Leu Glu Gly Ala Asp Ala Gly Glu Glu Asp Leu Glu

130 135 140

Gln Gln Phe His Tyr His Leu Arg Gly Leu His Thr Val Leu Ser Lys

145 150 155 160

Leu Thr Arg Lys Ala Asn Ile Leu Thr Asn Arg Tyr Lys Gln Glu Ile

165 170 175

Gly Phe Gly Asn Trp Gly His

180

<210>11

<211>3129

<212>DNA

＜213〉people

<220>

<221>CDS

<222>(214)..(1167)

<400>11

gggcgagtac tcctgattgt gacatcacat tcatcccctg ggcgatggag cttgtcactg 60

ggaaggaata ctcagtcgga gaatagccaa caagatgggt tactgggaga atctcttcag 120

tggcactgag tggaggcatc agggggttgg agccttgtga acagggaacc tgccccccaa 180

cacttggaag gacctgggtt tcagtgatga gac atg ggg tat gat gta acc cgt 234

Met Gly Tyr Asp Val Thr Arg

1 5

ttc cag ggg gat gtt gac gaa gat ctt atc tgc cct att tgc agt gga 282

Phe Gln Gly Asp Val Asp Glu Asp Leu Ile Cys Pro Ile Cys Ser Gly

10 15 20

gtc ttg gag gag cca gta cag gca cct cat tgt gaa cat gct ttc tgc 330

Val Leu Glu Glu Pro Val Gln Ala Pro His Cys Glu His Ala Phe Cys

25 30 35

aac gcc tgc atc acc cag tgg ttc tct cag caa cag aca tgt cca gtg 378

Asn Ala Cys Ile Thr Gln Trp Phe Ser Gln Gln Gln Thr Cys Pro Val

40 45 50 55

gac cgt agt gtt gtg acg gtc gcc cat ctg cgc cca gta cct cgg atc 426

Asp Arg Ser Val Val Thr Val Ala His Leu Arg Pro Val Pro Arg Ile

60 65 70

atg cgg aac atg ttg tca aag ctg cag att gcc tgt gac aac gct gtg 474

Met Arg Asn Met Leu Ser Lys Leu Gln Ile Ala Cys Asp Asn Ala Val

75 80 85

ttc ggc tgt agt gcc gtt gtc cgg ctt gac aac ctc atg tct cac ctc 522

Phe Gly Cys Ser Ala Val Val Arg Leu Asp Asn Leu Met Ser His Leu

90 95 100

agc gac tgt gag cac aac ccg aag cgg cct gtg acc tgt gaa cag ggc 570

Ser Asp Cys Glu His Asn Pro Lys Arg Pro Val Thr Cys Glu Gln Gly

105 110 115

tgt ggc ctg gag atg ccc aaa gat gag ctg ccc aac cat aac tgc att 618

Cys Gly Leu Glu Met Pro Lys Asp Glu Leu Pro Asn His Asn Cys Ile

120 125 130 135

aag cac ctg cgc tca gtg gta cag cag cag cag aca cgc atc gca gag 666

Lys His Leu Arg Ser Val Val Gln Gln Gln Gln Thr Arg Ile Ala Glu

140 145 150

ctg gag aag acg tca gct gaa cac aaa cac cag ctg gcg gag cag aag 714

Leu Glu Lys Thr Ser Ala Glu His Lys His Gln Leu Ala Glu Gln Lys

155 160 165

cga gac atc cag ctg cta aag gca tac atg cgt gca atc cgc agt gtc 762

Arg Asp Ile Gln Leu Leu Lys Ala Tyr Met Arg Ala Ile Arg Ser Val

170 175 180

aac ccc aac ctt cag aac ctg gag gag aca att gaa tac aac gag atc 810

Asn Pro Asn Leu Gln Asn Leu Glu Glu Thr Ile Glu Tyr Asn Glu Ile

185 190 195

cta gag tgg gtg aac tcc ctt cag cca gca aga gtg acc cgc tgg gga 858

Leu Glu Trp Val Asn Ser Leu Gln Pro Ala Arg Val Thr Arg Trp Gly

200 205 210 215

ggg atg atc tca act cct gat gct gtg ctc cag gct gta atc aag cgc 906

Gly Met Ile Ser Thr Pro Asp Ala Val Leu Gln Ala Val Ile Lys Arg

220 225 230

tcc ctg gtg gag agt ggc tgt cct gct tct att gtc aac gag ctg att 954

Ser Leu Val Glu Ser Gly Cys Pro Ala Ser Ile Val Asn Glu Leu Ile

235 240 245

gaa aat gcc cac gag cgt agc tgg ccc cag ggt ctg gcc aca cta gag 1002

Glu Asn Ala His Glu Arg Ser Trp Pro Gln Gly Leu Ala Thr Leu Glu

250 255 260

act aga cag atg aac cga cgc tac tat gag aac tac gtg gcc aag cgc 1050

Thr Arg Gln Met Asn Arg Arg Tyr Tyr Glu Asn Tyr Val Ala Lys Arg

265 270 275

atc cct ggc aag cag gct gtt gtc gtg atg gcc tgt gag aac cag cac 1098

Ile Pro Gly Lys Gln Ala Val Val Val Met Ala Cys Glu Asn Gln His

280 285 290 295

atg ggg gat gac atg gtg caa gag cca ggc ctt gtc atg ata ttt gcg 1146

Met Gly Asp Asp Met Val Gln Glu Pro Gly Leu Val Met Ile Phe Ala

300 305 310

cat ggc gtg gaa gag ata taa gagaactcga ctggctatca ggaagagatg 1197

His Gly Val Glu Glu Ile

315

gaaatcagaa aatcccatca ctccagcagc tgggacctga gtcctaccea ccattcttaa 1257

tactgtggct tatacctgag ccacacatct ccctgccctt ctggcactga agggccttgg 1317

ggtagtttgc tcagcctttc aggtgggaaa cccagatttc ctccctttgc catattcccc 1377

taaaatgtct ataaattatc agtctgggtg ggaaagcccc cacctccatc cattttcctg 1437

cttagggtcc ctggttccag ttattttcag aaagcacaaa gagattcaat ttccctggag 1497

gatcaggaca gaggaaggaa tctctaatcg tccctctcct ccaaaaccag ggaatcagag 1557

cagtcaggcc tgttgactct aagcagcaga catcctgaag aaatggtaag ggtggagcca 1617

aatctctaga aataagtagt gaggccgtta attggccatc actgatggcc cttagggaaa 1677

gactggacct ctgtgccaag cagtatccct gttcagccca ccttaaaggt gtaggcaccc 1737

actgggtcta ccagtatgca ggttgggata ctgaaaattt ccagatgagc tcttctttcc 1797

tacaagtttt cataattagg gaatgccagg gtttagggta ggggttaatc tgttgggggt 1857

tgatgtgttt agcaagaagc tactcctagc ttttgctaaa atatggttgg cactgcctct 1917

tgtggcacag gccataattg ttccatagac ccctctctag ccctgtgact gtagttagtt 1977

actttgatga ttttctttgg ccattgtttg tttatatttc acaaactcca cctactgccc 2037

ccccccctct tttttttaag aatggcctga tcatggctat ctcagccaca ttgttggcaa 2097

tttaatttat ttacttcctt tttttttttt aagaaaggaa aaaagaaaaa aaaatcaaac 2157

ttgaaacttt tcttttgatg ttcctattgt gggggttctg gatagggtgg gacagggatg 2217

ggggtgtgtt ttatattttt tccttttcag cacaaccttt ggctttaata taggaagagc 2277

caagggagtc ctcggctgaa cttacgatat ctgccccaaa cctctgtaac cccgactgaa 2337

atgaggagct tcctctcttc ctgtgaagga tatgacagtc cagcatcgat gcctgtgccc 2397

tctggaaaaa tttcctccta gcccttccag ggccttatca taaaactctg gatttagagt 2457

attcattttg aaggcaactc ccccttcccc aagtttcctt ggagctgtat agctgggttc 2517

taagcttcac catgcaaatc agaaatttta tctctaagta caggctgtgc cgtgtctcac 2577

ccacaccccc ctggggactt cagttccatt tcaggttacc tggggtatac cttgatccct 2637

agagtgactg gcagagtaag agaaggggag agataatagg tgtgattatt ttaatatgaa 2697

ggtgggagtg tggttggaga tagaaaggct cctccccacc atgtaatggc ttcctctcag 2757

aattttattc caggctagct tgctgcaggt ctgggtagtt ggatcatggc tccactggga 2817

ttggggtgga aagcttgagg ggagtagggt tccagctctg ggacattgtg ctcaggaatt 2877

tgaaaacgct gctatactta ctctggttac tacatttctt ccactcccct ttcccctacc 2937

tgccttaacc aaggctcata ctgtcctgtc cttaccctca gatggagcca ggaagctcag 2997

tgaaaggctt ccctaccctt tgcactagtg tctctgcagg ttgctggttg tgttgtatgt 3057

gctgttccat ggtgttgact gcactaataa taaacctttt actcaactct ctaaaaaaaa 3117

aaaaaaaaaa aa 3129

<210>12

<211>317

<212>PRT

＜213〉people

<400>12

Met Gly Tyr Asp Val Thr Arg Phe Gln Gly Asp Val Asp Glu Asp Leu

1 5 10 15

Ile Cys Pro Ile Cys Ser Gly Val Leu Glu Glu Pro Val Gln Ala Pro

20 25 30

His Cys Glu His Ala Phe Cys Asn Ala Cys Ile Thr Gln Trp Phe Ser

35 40 45

Gln Gln Gln Thr Cys Pro Val Asp Arg Ser Val Val Thr Val Ala His

50 55 60

Leu Arg Pro Val Pro Arg Ile Met Arg Asn Met Leu Ser Lys Leu Gln

65 70 75 80

Ile Ala Cys Asp Asn Ala Val Phe Gly Cys Ser Ala Val Val Arg Leu

85 90 95

Asp Asn Leu Met Ser His Leu Ser Asp Cys Glu His Asn Pro Lys Arg

100 105 110

Pro Val Thr Cys Glu Gln Gly Cys Gly Leu Glu Met Pro Lys Asp Glu

115 120 125

Leu Pro Asn His Asn Cys Ile Lys His Leu Arg Ser Val Val Gln Gln

130 135 140

Gln Gln Thr Arg Ile Ala Glu Leu Glu Lys Thr Ser Ala Glu His Lys

145 150 155 160

His Gln Leu Ala Glu Gln Lys Arg Asp Ile Gln Leu Leu Lys Ala Tyr

165 170 175

Met Arg Ala Ile Arg Ser Val Asn Pro Asn Leu Gln Asn Leu Glu Glu

180 185 190

Thr Ile Glu Tyr Asn Glu Ile Leu Glu Trp Val Asn Ser Leu Gln Pro

195 200 205

Ala Arg Val Thr Arg Trp Gly Gly Met Ile Ser Thr Pro Asp Ala Val

210 215 220

Leu Gln Ala Val Ile Lys Arg Ser Leu Val Glu Ser Gly Cys Pro Ala

225 230 235 240

Ser Ile Val Asn Glu Leu Ile Glu Asn Ala His Glu Arg Ser Trp Pro

245 250 255

Gln Gly Leu Ala Thr Leu Glu Thr Arg Gln Met Asn Arg Arg Tyr Tyr

260 265 270

Glu Asn Tyr Val Ala Lys Arg Ile Pro Gly Lys Gln Ala Val Val Val

275 280 285

Met Ala Cys Glu Asn Gln His Met Gly Asp Asp Met Val Gln Glu Pro

290 295 300

Gly Leu Val Met Ile Phe Ala His Gly Val Glu Glu Ile

305 310 315

<210>13

<21l>3005

<212>DNA

＜213〉people

<220>

<22l>CDS

<222>(241)..(1155)

<400>13

cagtggtgga agaagaggcg gcggcggcgg gggtagggag cctggaaacg cgagcgggga 60

tggtaggtgg tttggacccg ccgggccgcc gtcgtttcca gaaagggttt gactggagga 120

acctctggag cagctgttgg ctggctcctc tggctgatgg catgttgagg tacatgggcc 180

agcggcagcg agggcatcca atccagaggg gtccactcta gaggccaggc caccagcacc 240

atg ggc cag tgt gtc acc aag tgt aag aat ccc tca tcg acc ctg ggc 288

Met Gly Gln Cys Val Thr Lys Cys Lys Asn Pro Ser Ser Thr Leu Gly

1 5 10 15

agc aaa aat gga gac cgt gag ccc agc aac aag tca cat agc agg agg 336

Ser Lys Asn Gly Asp Arg Glu Pro Ser Asn Lys Ser His Ser Arg Arg

20 25 30

ggt gca ggc cac cgt gag gag cag gta cca ccc tgt ggc aag cca ggt 384

Gly Ala Gly His Arg Glu Glu Gln Val Pro Pro Cys Gly Lys Pro Gly

35 40 45

gga gat atc ctc gtc aac ggg acc aag aag gcc gag gct gcc act gag 432

Gly Asp Ile Leu Val Asn Gly Thr Lys Lys Ala Glu Ala Ala Thr Glu

50 55 60

gcc tgc cag ctg cca acg tcc tcg gga gat gct ggg agg gag tcc aag 480

Ala Cys Gln Leu Pro Thr Ser Ser Gly Asp Ala Gly Arg Glu Ser Lys

65 70 75 80

tcc aat gcc gag gag tct tcc ttg caa aga ttg gaa gaa ctg ttc agg 528

Ser Asn Ala Glu Glu Ser Ser Leu Gln Arg Leu Glu Glu Leu Phe Arg

85 90 95

cgc tac aag gat gag cgg gaa gat gca att ttg gag gaa ggc atg gag 576

Arg Tyr Lys Asp Glu Arg Glu Asp Ala Ile Leu Glu Glu Gly Met Glu

100 105 110

cgc ttt tgc aat gac ctg tgt gtt gac ccc aca gaa ttt cga gtg ctg 624

Arg Phe Cys Asn Asp Leu Cys Val Asp Pro Thr Glu Phe Arg Val Leu

115 120 125

ctc ttg gct tgg aag ttc cag gct gca acc atg tgc aaa ttc acc agg 672

Leu Leu Ala Trp Lys Phe Gln Ala Ala Thr Met Cys Lys Phe Thr Arg

130 135 140

aag gag ttt ttt gat ggc tgc aaa gca ata agt gca gac agc att gac 720

Lys Glu Phe Phe Asp Gly Cys Lys Ala Ile Ser Ala Asp Ser Ile Asp

145 150 155 160

gga atc tgt gca cgg ttc cct agc ctc tta aca gaa gcc aaa caa gag 768

Gly Ile Cys Ala Arg Phe Pro Ser Leu Leu Thr Glu Ala Lys Gln Glu

165 170 175

gat aaa ttc aag gat ctc tac cgg ttt aca ttt cag ttt ggc ctg gac 816

Asp Lys Phe Lys Asp Leu Tyr Arg Phe Thr Phe Gln Phe Gly Leu Asp

180 185 190

tct gaa gaa ggg cag cgg tca ctg cat cgg gaa ata gcc att gcc ctg 864

Ser Glu Glu Gly Gln Arg Ser Leu His Arg Glu Ile Ala Ile Ala Leu

195 200 205

tgg aaa cta gtc ttt acc cag aac aat cct ccg gta ttg gac caa tgg 912

Trp Lys Leu Val Phe Thr Gln Asn Asn Pro Pro Val Leu Asp Gln Trp

210 215 220

cta aac ttc cta aca gag aac ccc tcg ggg atc aag ggc atc tcc cgg 960

Leu Asn Phe Leu Thr Glu Asn Pro Ser Gly Ile Lys Gly Ile Ser Arg

225 230 235 240

gac act tgg aac atg ttc ctt aac ttc act cag gtg att ggc cct gac 1008

Asp Thr Trp Asn Met Phe Leu Asn Phe Thr Gln Val Ile Gly Pro Asp

245 250 255

ctc agc aac tac agt gaa gat gag gcc tgg cca agt ctc ttt gac acc 1056

Leu Ser Asn Tyr Ser Glu Asp Glu Ala Trp Pro Ser Leu Phe Asp Thr

260 265 270

ttt gtg gag tgg gaa atg gag cga agg aaa aga gaa ggg gaa ggg aga 1104

Phe Val Glu Trp Glu Met Glu Arg Arg Lys Arg Glu Gly Glu Gly Arg

275 280 285

ggt gca ctc agc tca ggg cct gag ggc ttg tgt ccc gag gag cag act 1152

Gly Ala Leu Ser Ser Gly Pro Glu Gly Leu Cys Pro Glu Glu Gln Thr

290 295 300

tag tggctctgtc ccaggagcag cagcaaggat ctgccagctg ccctgcagcc 1205

aactgaggaa ttggaccatt ttggaaatta ctgaagatcc ggatattttc tactttacac 1265

ctttctctgc cttgtatctg aaagggctct aaaatgctgt atcatgtttt aggcactttc 1325

ttcatttttt tggttatttt ggttatttcc tttttggggg gatctcccag aatatttgaa 1385

cctggttaca tgttgtgtat ctttttttga agccttcaga tagaataagc ctgccatttc 1445

ttgcacaaat ttaggttttt tttttgtttt tttttgtttt tttttttttt ttttggtagg 1505

ggagggcata gagcagggcg gggggatggg actgttaggt tgaattaaca ttacaaaatg 1565

atacagtgcc agatctcagt ttcgcatatt gtttttcagg gcaggtctgt actgtgtgta 1625

gtgctgttta catagatgaa tttaggttgt aataattatt tttaaagatt tacacagatt 1685

tgaatagcag tgttaactgt taaccacatt gcattaattc ccaggcgatt tagagctctt 1745

ggagagccaa ggccagccaa gagcatttgt agtctggtga caaccccctt ttaagctaat 1805

ttatccagaa ccctgatttc cctcacttct tgctcattcc ttctttgacc tattgcattt 1865

catgttgagt ttttccatca acatgctgca cctgtcagtc aagtgagcat tttttaagaa 1925

cacattgtac tgagaaccac ttaagcattg aatgcggaga aagcagtgct acctcagttt 1985

tgctggaagt agacttcttt gatagttttc tttctttgat gaagtttctg tattttcatg 2045

ttgtaagtgg aaatactttt ttttgtttgt ttgtttcatt tgccttggag ccaaagtttc 2105

tgttcctggt ggtcgggaaa ctgcctgccg gccaactgac ttgaaggaaa actgtggtat 2165

ggagctctgc ttgaattttt ttttttttaa tatttttatt tttttctttg aatatcatca 2225

gcttacttgt ctggcaaggg cagaagcctg gggttggcct gaactctgcc aaacaaatat 2285

caaagtgtat ttaatagtta aatttgtgcc ctttcccttc ttgctgcacc catgttgtca 2345

cttaaccccc aggagttatt tattatcttt ttgttaaagt caggctcatt tggggtaatg 2405

tgatgactgt ttaggtttac atgaccctcc tctcctttcc ctacccccaa atatgtatat 2465

atacatatat aaaatatgta tatattttac ctatataaaa tatatatata tacacatata 2525

tgtatctata ttcctttgtt tctttgcctg cttatactgg ccataaaaga gggagctgcc 2585

ttcaatgtat aaagtataag aagagtgcca gggaatgcca taatggaggc ttttggatct 2645

gaatttggac catttcacta aagagaacat gagtttgctc agccctttcc tcacaagagg 2705

gagggccccg gttccccaga cttctccacg cgctggctcc ataaaggcca gctttggcca 2765

ggctgccaca ggggcctgag gagctcactc tgggcctacc tggtttcagt tagagggtcc 2825

tcctgttatt tttccattta aaaagtatgt cctcagaaaa ctgtactgga aggatgggtg 2885

gcaggaactt gtatagttca gcttccaaca ctttggaaca gattaaaaag ggaatctttt 2945

aaataaaaac gtataaaaat aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 3005

<210>14

<211>304

<212>PRT

＜213〉people

<400>14

Met Gly Gln Cys Val Thr Lys Cys Lys Asn Pro Ser Ser Thr Leu Gly

1 5 10 15

Ser Lys Asn Gly Asp Arg Glu Pro Ser Asn Lys Ser His Ser Arg Arg

20 25 30

Gly Ala Gly His Arg Glu Glu Gln Val Pro Pro Cys Gly Lys Pro Gly

35 40 45

Gly Asp Ile Leu Val Asn Gly Thr Lys Lys Ala Glu Ala Ala Thr Glu

50 55 60

Ala Cys Gln Leu Pro Thr Ser Ser Gly Asp Ala Gly Arg Glu Ser Lys

65 70 75 80

Ser Asn Ala Glu Glu Ser Ser Leu Gln Arg Leu Glu Glu Leu Phe Arg

85 90 95

Arg Tyr Lys Asp Glu Arg Glu Asp Ala Ile Leu Glu Glu Gly Met Glu

100 105 110

Arg Phe Cys Asn Asp Leu Cys Val Asp Pro Thr Glu Phe Arg Val Leu

115 120 125

Leu Leu Ala Trp Lys Phe Gln Ala Ala Thr Met Cys Lys Phe Thr Arg

130 135 140

Lys Glu Phe Phe Asp Gly Cys Lys Ala Ile Ser Ala Asp Ser Ile Asp

145 150 155 160

Gly Ile Cys Ala Arg Phe Pro Ser Leu Leu Thr Glu Ala Lys Gln Glu

165 170 175

Asp Lys Phe Lys Asp Leu Tyr Arg Phe Thr Phe Gln Phe Gly Leu Asp

180 185 190

Ser Glu Glu Gly Gln Arg Ser Leu His Arg Glu Ile Ala Ile Ala Leu

195 200 205

Trp Lys Leu Val Phe Thr Gln Asn Asn Pro Pro Val Leu Asp Gln Trp

210 215 220

Leu Asn Phe Leu Thr Glu Asn Pro Ser Gly Ile Lys Gly Ile Ser Arg

225 230 235 240

Asp Thr Trp Asn Met Phe Leu Asn Phe Thr Gln Val Ile Gly Pro Asp

245 250 255

Leu Ser Asn Tyr Ser Glu Asp Glu Ala Trp Pro Ser Leu Phe Asp Thr

260 265 270

Phe Val Glu Trp Glu Met Glu Arg Arg Lys Arg Glu Gly Glu Gly Arg

275 280 285

Gly Ala Leu Ser Ser Gly Pro Glu Gly Leu Cys Pro Glu Glu Gln Thr

290 295 300

<210>15

<211>1832

<212>DNA

＜213〉people

<220>

<22l>CDS

<222>(281)..(1057)

<400>15

agcagagtcc ggctgcctgg ggcgggcggc gcgtgtctgc agctgctccg ggtagcccgc 60

taggcgcgcc gtccccagcc ccgccgccgg ccctcggtgc gcccggccgc ctgcaccccc 120

aggagcagct gctgtgaata aacacagaag tggagctggg ggactgatta gaagcctcat 180

tcagtgcacc tgggccccag caggcccagc caggcgtgga ggaagaggca ttgaggactt 240

tccttacctg tttttccagc tcacccactg ccagcagaga atg ctg tcc agt ttc 295

Met Leu Ser Ser Phe

1 5

aac gag tgg ttt tgg cag gac agg ttc tgg tta cca ccc aat gtc acg 343

Asn Glu Trp Phe Trp Gln Asp Arg Phe Trp Leu Pro Pro Asn Val Thr

10 15 20

tgg aca gag cta gaa gac cgg gat ggc cgt gtc tac ccc cac ccc cag 391

Trp Thr Glu Leu Glu Asp Arg Asp Gly Arg Val Tyr Pro His Pro Gln

25 30 35

gac ttg ttg gca gcc ctg ccc ctg gcg ctg gtc ctc ctg gcc atg cgc 439

Asp Leu Leu Ala Ala Leu Pro Leu Ala Leu Val Leu Leu Ala Met Arg

40 45 50

ctt gcc ttt gag aga ttc att ggc ctg ccc ctg agc cgg tgg ctg ggt 487

Leu Ala Phe Glu Arg Phe Ile Gly Leu Pro Leu Ser Arg Trp Leu Gly

55 60 65

gtg agg gat cag acc agg agg caa gtg aag ccc aac gcc acg ctg gag 535

Val Arg Asp Gln Thr Arg Arg Gln Val Lys Pro Asn Ala Thr Leu Glu

70 75 80 85

aaa cac ttc ctc acg gaa ggg cac agg ccc aag gag ccc cag ctg tct 583

Lys Hls Phe Leu Thr Glu Gly His Arg Pro Lys Glu Pro Gln Leu Ser

90 95 100

ctc ctg gcc gcc cag tgt ggc ctc acg ctg cag cag acc cag cga tgg 631

Leu Leu Ala Ala Gln Cys Gly Leu Thr Leu Gln Gln Thr Gln Arg Trp

105 110 115

ttc cgg aga cgc cgg aac cag gat cga ccc cag ctg acc aag aag ttc 679

Phe Arg Arg Arg Arg Asn Gln Asp Arg Pro Gln Leu Thr Lys Lys Phe

120 125 130

tgt gag gcc agc tgg agg ttt ctc ttc tac ctg tcc tcc ttc gtg ggc 727

Cys Glu Ala Ser Trp Arg Phe Leu Phe Tyr Leu Ser Ser Phe Val Gly

135 140 145

ggc ctc tcg gtc ctg tac cac gag tca tgg ctg tgg gca cca gta atg 775

Gly Leu Ser Val Leu Tyr His Glu Ser Trp Leu Trp Ala Pro Val Met

150 155 160 165

tgc tgg gac agg tac cca aac cag act ctg aag cca tcc ctg tac tgg 823

Cys Trp Asp Arg Tyr Pro Asn Gln Thr Leu Lys Pro Ser Leu Tyr Trp

170 175 180

tgg tac ctc ttg gag ctg ggt ttc tac ctc tca ctg cta atc agg ctg 871

Trp Tyr Leu Leu Glu Leu Gly Phe Tyr Leu Ser Leu Leu Ile Arg Leu

185 190 195

ccc ttt gat gtc aag cgc aag ggt ggg gga cct tcc agc atc aag cct 919

Pro Phe Asp Val Lys Arg Lys Gly Gly Gly Pro Ser Ser Ile Lys Pro

200 205 210

cgt ccc cac tat gac cca ccg tct act gca gga ttt caa gga gca ggt 967

Arg Pro His Tyr Asp Pro Pro Ser Thr Ala Gly Phe Gln Gly Ala Gly

215 220 225

gat aca cca ctt cgt ggc ggt cat cct gat gac ctt ctc cta cag tgc 1015

Asp Thr Pro Leu Arg Gly Gly His Pro Asp Asp Leu Leu Leu Gln Cys

230 235 240 245

caa cct gct gcg cat tgg ctc tct ggt gct gct gtt aca tga 1057

Gln Pro Ala Ala His Trp Leu Ser Gly Ala Ala Val Thr

250 255

ttcctctgac tacctgctgg aggcctgtaa gatggtcaac tacatgcagt atcagcaagt 1117

gtgcgacgct ctcttcctca tcttctcctt tgtcttcttc tacacccgac tggtcctctt 1177

tcccacccag atcctctaca ccacatacta cgagtccatc agcaacaggg gccccttctt 1237

cggctactac ttcttcaacg ggcttctgat gttgctgcag ctgccgcacg tgttctggtc 1297

ttgcctcatt ctgcgcatgc tctatagctt catgaagaag ggccagatgg agaaggacat 1357

tcgtagtgat gtagaagaat cagactccag tgaggaggtg gcggcggccc aggaacctct 1417

gcagctaaag aacggggcag ctggagggcc caggccagcc cccactgatg gccctcagag 1477

ccgggtggcc gggcgtctga ccaacaggca cacaacagcc acatagccgg gcggggctgg 1537

ctgtaagggg ttgccccccc gccagtgcct tggatatttc tggggtgact ggactggcgc 1597

ccctgggcca cctttctgga gacagggagg gccccacccg gggtgggtgg gaaggctgat 1657

gatctgtctc cagccccttc cttctgccca cccacccttc ttccctctgg gcaactggac 1717

agatctggga gccagcagct ggatgctgtg gctggccaga gacacctcca ggctgtggcc 1777

tgggggctgg ggggagcccc aggctgaaaa gggtccaatt aaaacaaatg gagcc 1832

<210>16

<21l>258

<212>PRT

＜213〉people

<400>16

Met Leu Ser Ser Phe Asn Glu Trp Phe Trp Gln Asp Arg Phe Trp Leu

1 5 10 15

Pro Pro Asn Val Thr Trp Thr Glu Leu Glu Asp Arg Asp Gly Arg Val

20 25 30

Tyr Pro His Pro Gln Asp Leu Leu Ala Ala Leu Pro Leu Ala Leu Val

35 40 45

Leu Leu Ala Met Arg Leu Ala Phe Glu Arg Phe Ile Gly Leu Pro Leu

50 55 60

Ser Arg Trp Leu Gly Val Arg Asp Gln Thr Arg Arg Gln Val Lys Pro

65 70 75 80

Asn Ala Thr Leu Glu Lys His Phe Leu Thr Glu Gly His Arg Pro Lys

85 90 95

Glu Pro Gln Leu Ser Leu Leu Ala Ala Gln Cys Gly Leu Thr Leu Gln

100 105 110

Gln Thr Gln Arg Trp Phe Arg Arg Arg Arg Asn Gln Asp Arg Pro Gln

115 120 125

Leu Thr Lys Lys Phe Cys Glu Ala Ser Trp Arg Phe Leu Phe Tyr Leu

130 135 140

Ser Ser Phe Val Gly Gly Leu Ser Val Leu Tyr His Glu Ser Trp Leu

145 150 155 160

Trp Ala Pro Val Met Cys Trp Asp Arg Tyr Pro Asn Gln Thr Leu Lys

165 170 175

Pro Ser Leu Tyr Trp Trp Tyr Leu Leu Glu Leu Gly Phe Tyr Leu Ser

180 185 190

Leu Leu Ile Arg Leu Pro Phe Asp Val Lys Arg Lys Gly Gly Gly Pro

195 200 205

Ser Ser Ile Lys Pro Arg Pro His Tyr Asp Pro Pro Ser Thr Ala Gly

210 215 220

Phe Gln Gly Ala Gly Asp Thr Pro Leu Arg Gly Gly His Pro Asp Asp

225 230 235 240

Leu Leu Leu Gln Cys Gln Pro Ala Ala His Trp Leu Ser Gly Ala Ala

245 250 255

Val Thr

<210>17

<211>1689

<212>DNA

＜213〉people

<220>

<221>CDS

<222>(35)..(901)

<400>17

agcaaatttc aactcccgct tgccattcaa catc atg gat gat ccg aag agt gaa 55

Met Asp Asp Pro Lys Ser Glu

1 5

cag cag cgc ata ctg cgc cgc cac caa cgc gag agg cag gag ctg cag 103

Gln Gln Arg Ile Leu Arg Arg His Gln Arg Glu Arg Gln Glu Leu Gln

10 15 20

gcc cag atc egg agc tta aaa aac tcg gtc ccc aag acc gac aag acg 151

Ala Gln Ile Arg Ser Leu Lys Asn Ser Val Pro Lys Thr Asp Lys Thr

25 30 35

aaa aga aag cag ttg ctc caa gac gtg gcc cgc atg gag gcc gag atg 199

Lys Arg Lys Gln Leu Leu Gln Asp Val Ala Arg Met Glu Ala Glu Met

40 45 50 55

gct cag aag cac cgg cag gag ctg gag aag ttc caa gac gac agt agc 247

Ala Gln Lys His Arg Gln Glu Leu Glu Lys Phe Gln Asp Asp Ser Ser

60 65 70

att gaa tct gtc gtc gaa gac ctg gcc aag atg aat ctg gaa aac cgg 295

Ile Glu Ser Val Val Glu Asp Leu Ala Lys Met Asn Leu Glu Asn Arg

75 80 85

cct ccc cgc tcc tcc aaa gcc cac aga aag aga gaa aga atg gag tcc 343

Pro Pro Arg Ser Ser Lys Ala His Arg Lys Arg Glu Arg Met Glu Ser

90 95 100

gag gag agg gag cgc cag gag agc atc ttc cag gct gag atg tcg gag 391

Glu Glu Arg Glu Arg Gln Glu Ser Ile Phe Gln Ala Glu Met Ser Glu

105 110 115

cac ctg gcc ggc ttc aag cgc gag gag gag gag aag ctc gcc gcc atc 439

His Leu Ala Gly Phe Lys Arg Glu Glu Glu Glu Lys Leu Ala Ala Ile

120 125 130 135

ctg gga gcc agg ggt ctg gag atg aaa gcg atc ccg gcc gac ggc cac 487

Leu Gly Ala Arg Gly Leu Glu Met Lys Ala Ile Pro Ala Asp Gly His

140 145 150

tgc atg tac cgc gcc atc caa gac cag ctg gtg ttc agc gtg tct gtg 535

Cys Met Tyr Arg Ala Ile Gln Asp Gln Leu Val Phe Ser Val Ser Val

155 160 165

gag atg ctg cgc tgc cgc acc gcc agc tac atg aag aag cac gtc gac 583

Glu Met Leu Arg Cys Arg Thr Ala Ser Tyr Met Lys Lys His Val Asp

170 175 180

gag ttc ctg ccc ttc ttc agc aac ccc gag acc agc gac tcc ttc ggc 631

Glu Phe Leu Pro Phe Phe Ser Asn Pro Glu Thr Ser Asp Ser Phe Gly

185 190 195

tac gac gac ttc atg atc tac tgc gac aac atc gtg cgc acc acg gca 679

Tyr Asp Asp Phe Met Ile Tyr Cys Asp Asn Ile Val Arg Thr Thr Ala

200 205 210 215

tgg gga ggc cag ctg gag ctg agg gcc ctg tcg cac gtc ctg aag acc 727

Trp Gly Gly Gln Leu Glu Leu Arg Ala Leu Ser His Val Leu Lys Thr

220 225 230

ccc atc gag gtg atc cag gcc gac tcg ccc acc ttg atc atc ggg gag 775

Pro Ile Glu Val Ile Gln Ala Asp Ser Pro Thr Leu Ile Ile Gly Glu

235 240 245

gag tac gtc aag aag ccg atc atc ctg gtc tac ctg cgc tat gcc tac 823

Glu Tyr Val Lys Lys Pro Ile Ile Leu Val Tyr Leu Arg Tyr Ala Tyr

250 255 260

agc ctc ggc gag cac tac aac tcc gtg aca ccg ctc gag gcc ggc gcc 871

Ser Leu Gly Glu His Tyr Asn Ser Val Thr Pro Leu Glu Ala Gly Ala

265 270 275

gcc ggg ggc gtg ctc ccg cgt ctc ctg tag gccccaaggc gctgagcagc 921

Ala Gly Gly Val Leu Pro Arg Leu Leu

280 285

cccgggaaac tgtcgccgtc gccgcatctc ctcagtaggc tcagtttatt ttcccctttt 981

gcttttctct gtttttcttt tccttccttt taatcaaaac tacccgcccc cgccccgccc 1041

ccgctttcct aaccttgctg ctttcacagg gtgggaaacg aaattcgagg gaaattcccc 1101

ggaaatatga gggaaatctc tgcattgcac caccagaggg gcataaattt gaaagttcta 1161

acctcttctt gcccttaagg gtcttttacc tccctcacca actaagattt ggtcatgttg 1221

cgtataactt caccacaaaa atggaaatat tggccgggcg cggtggctca cgcctgtaat 1281

cccagcactt tgggaggccg aggcgggcgg atcacgaggt caggagttcg agaccagcct 1341

ggccaacatg gtgaaacccc acctctacaa aaaatacaaa aattagccgg gcgtggtggc 1401

aggcacctgt agtcccagat actcgggagg ctaaggcagg agaatcgctt gacgggaagc 1461

ggaggttgca gtgagccgag atcgtgcctt tgcactccag cgtggaagac agtgagactc 1521

cgtctcaaaa aaatgaaaaa ttagccaggc aggttggcgg gggcctgtaa tcctagctac 1581

ttggggtgct gaggcaggag aatcaactga acccgggagg cggaggctgc agtgggccgg 1641

gatcgtacta ctgcactcca gcatggaaga cagcgagact ccgtctcc 1689

<210>18

<211>288

<212>PRT

＜213〉people

<400>18

Met Asp Asp Pro Lys Ser Glu Gln Gln Arg Ile Leu Arg Arg His Gln

1 5 10 15

Arg Glu Arg Gln Glu Leu Gln Ala Gln Ile Arg Ser Leu Lys Asn Ser

20 25 30

Val Pro Lys Thr Asp Lys Thr Lys Arg Lys Gln Leu Leu Gln Asp Val

35 40 45

Ala Arg Met Glu Ala Glu Met Ala Gln Lys His Arg Gln Glu Leu Glu

50 55 60

Lys Phe Gln Asp Asp Ser Ser Ile Glu Ser Val Val Glu Asp Leu Ala

65 70 75 80

Lys Met Asn Leu Glu Asn Arg Pro Pro Arg Ser Ser Lys Ala His Arg

85 90 95

Lys Arg Glu Arg Met Glu Ser Glu Glu Arg Glu Arg Gln Glu Ser Ile

100 105 110

Phe Gln Ala Glu Met Ser Glu His Leu Ala Gly Phe Lys Arg Glu Glu

115 120 125

Glu Glu Lys Leu Ala Ala Ile Leu Gly Ala Arg Gly Leu Glu Met Lys

130 135 140

Ala Ile Pro Ala Asp Gly His Cys Met Tyr Arg Ala Ile Gln Asp Gln

145 150 155 160

Leu Val Phe Ser Val Ser Val Glu Met Leu Arg Cys Arg Thr Ala Ser

165 170 175

Tyr Met Lys Lys His Val Asp Glu Phe Leu Pro Phe Phe Ser Asn Pro

180 185 190

Glu Thr Ser Asp Ser Phe Gly Tyr Asp Asp Phe Met Ile Tyr Cys Asp

195 200 205

Asn Ile Val Arg Thr Thr Ala Trp Gly Gly Gln Leu Glu Leu Arg Ala

210 215 220

Leu Ser His Val Leu Lys Thr Pro Ile Glu Val Ile Gln Ala Asp Ser

225 230 235 240

Pro Thr Leu Ile Ile Gly Glu Glu Tyr Val Lys Lys Pro Ile Ile Leu

245 250 255

Val Tyr Leu Arg Tyr Ala Tyr Ser Leu Gly Glu His Tyr Asn Ser Val

260 265 270

Thr Pro Leu Glu Ala Gly Ala Ala Gly Gly Val Leu Pro Arg Leu Leu

275 280 285

Claims (18)

1. isolating polynucleotide is characterized in that, described polynucleotide contain the nucleotide sequence that coding has the polypeptide that influences the active function of SRE, and this nucleotide sequence is selected from:

(a) polynucleotide of polypeptide that contain the aminoacid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18 with coding have the polynucleotide of at least 70% similarity;

(b) coding contains the polynucleotide of polypeptide that aminoacid sequence with SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:1O, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18 has the aminoacid sequence of at least 70% similarity;

(c) with (a) or polynucleotide complementary polynucleotide (b).

2. polynucleotide as claimed in claim 1, it is characterized in that the polypeptide of described polynucleotide encoding has the aminoacid sequence of the group of being selected from down: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ IDNO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18.

3. polynucleotide as claimed in claim 1 is characterized in that, the sequence of described polynucleotide is shown at least 85% similarity with the nucleotides sequence that is selected from down group:

(a) coding region sequence or the full length sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ IDNO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17;

(b) at least one sequence of the sequence of in genetic code degeneracy scope, mentioning in corresponding to (a);

(c) with (a) or at least one sequence of the sequence complementary sequence hybridization of mentioning (b).

4. polynucleotide as claimed in claim 3, it is characterized in that the sequence of described polynucleotide is selected from coding region sequence or the full length sequence of SEQ ID NO:1, SEQ IDNO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ IDNO:15, SEQ ID NO:17.

5. the polypeptide of the described polynucleotide encoding of claim 1, it is characterized in that described polypeptide comprises the polypeptide that is selected from down the aminoacid sequence in the group: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:1O, SEQID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18; Or has the polypeptide of 9O% similarity at least with above arbitrary aminoacid sequence; Or its conservative property variation polypeptide or its active fragments or its reactive derivative.

6. the described polypeptide of claim 5, it is characterized in that described polypeptide has the aminoacid sequence of the group of being selected from down: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:1O, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18.

7. a carrier is characterized in that, described carrier contains the described polynucleotide of claim 1.

8. a genetically engineered host cell is characterized in that, described host cell is selected from:

(a) host cell that transforms or transduce with the described carrier of claim 7;

(b) host cell that transforms or transduce with the described polynucleotide of claim 1.

9. an antibody is characterized in that, described antibody be can with the described polypeptid specificity bonded of claim 5 antibody.

10. a nucleic acid fragment is characterized in that, described nucleic acid fragment contains 8-100 successive Nucleotide in the described arbitrary polynucleotide of claim 1.

11. the application of isolating polynucleotide in influencing the SRE activity is characterized in that described polynucleotide are selected from the described polynucleotide of claim 1, these polynucleotide heterogenous expression in host cell can influence the SRE activity.

12. the described application of claim 11, it is characterized in that the sequence of described polynucleotide is selected from coding region sequence or the full length sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, these polynucleotide heterogenous expression in host cell can suppress the activation of SRE.

13. the described application of claim 11 is characterized in that the sequence of described polynucleotide is selected from SEQ ID NO:11, SEQ ID NO:

13, coding region sequence or the full length sequence of SEQ ID NO:15, SEQ ID NO:17, these polynucleotide heterogenous expression in host cell can promote the activation of SRE.

14. described polynucleotide of claim 1 or the described polypeptide of claim 5 prevent and/or treat purposes in the medicine of musculature disease relevant with the differentiation of propagation or muscle or tumour in preparation.

Relative disease or tumours such as 15. the described purposes of claim 14, wherein said disease are selected from, and muscle hyperplasia, muscle are reinvented, aging.

16. contain the pharmaceutical composition of described polypeptide of claim 5 and pharmaceutically acceptable carrier.

17. the musculature disease relevant with the differentiation of propagation or muscle or the external detection method of tumour is characterized in that, utilize described antibody of claim 9 or claim 10 described nucleic acid fragments to detect the existence or the level of the polypeptide in host's sample.

Images