CN1249082C - Apoptosis promoting gene BNIPL, coding albumen and uses thereof - Google Patents

Abstract

The present invention discloses a new gene BNIPL for promoting apoptosis and encoding protein thereof. The present invention also discloses a method for producing a BNIPL polypeptide by a recombination technique and a method for using the BNIPL polypeptide to treat various diseases, such as cancers, etc. The BNIPL has the functions of inhibiting growth and promoting apoptosis for hepatoma carcinoma cells.

Description

Short apoptogene BNIPL and proteins encoded and purposes

Technical field

The invention belongs to biological technical field, specifically, the present invention relates to new short apoptogene BNIPL and proteins encoded thereof.The invention still further relates to the Use and preparation method of these polynucleotide and polypeptide.BNIPL can suppress liver cancer cell growth and promote cancer cell-apoptosis.

Background technology

The full name of BNIP2 is Bcl-2/adenovirus E1B 19 kD interacting protein 2 (being called for short BNIP2), is an energy and cell inhibitor of apoptosis protein Bcl-2 and the interactional albumen of viral inhibitor of apoptosis protein E1B 19kD.BNIP is a family, total BNIP1, BNIP2 and three members of BNIP3 (Boyd JM, et al.Cell.1994 Oct 21; 79 (2): 341-51), this family is the important member in the apoptosis path.Combination and interaction can take place with cdc42, cdc42GAP, Bcl-2 and Flg in BNIP2, promote apoptosis (Low BC, et al.J Biol Chem.1999 Nov 12; 274 (46): 33123-30.J Biol Chem.2000 May 12; 275 (19): 14415-22.J Biol Chem.2000 Dec 1; 275 (48): 37742-51).

Cancer is one of principal disease of harm humans health.In order to treat effectively and prophylaxis of tumours, people more and more pay close attention to genetic treatment of tumor at present.Therefore, this area presses for albumen or the pro-apoptotic albumen that development research has cancer suppressing action.

Summary of the invention

The purpose of this invention is to provide protein B NIPL that new the having of a class press down cancer and pro-apoptotic effect with and fragment, analogue and derivative.

Another object of the present invention provides the polynucleotide of these polypeptide of coding.

Another object of the present invention provides the method for these polypeptide of production and the purposes of this polypeptide and encoding sequence.

In a first aspect of the present invention, a kind of isolating BNIPL polypeptide is provided, it comprises the polypeptide of the aminoacid sequence with SEQ IDNO:2, or it has conservative property variation polypeptide or its active fragments or its reactive derivative of BCH structural domain, and condition is that described peptide sequence is not SEQ ID NO:4.

Preferably, described polypeptide is selected from down group: the polypeptide that (a) has SEQ ID NO:2 aminoacid sequence; (b) SEQ ID NO:2 aminoacid sequence is formed through replacement, disappearance or the interpolation of one or more amino-acid residues, and have promote human liver cancer cell transfer the function of dying by (a) polypeptides derived.

In another preference, described pro-apoptotic albumen contains the aminoacid sequence of 215-357 position among the SEQ ID NO:2, and condition is that described peptide sequence is not SEQ ID NO:4.

In a second aspect of the present invention, a kind of isolating polynucleotide are provided, it comprises a nucleotide sequence, and this nucleotide sequence is shown at least 85% homogeny with a kind of nucleotides sequence that is selected from down group: the polynucleotide of the above-mentioned BNIPL polypeptide of (a) encoding; (b) with polynucleotide (a) complementary polynucleotide.Preferably, the polypeptide of this polynucleotide encoding has the aminoacid sequence of SEQ ID NO:2.More preferably, the sequence of these polynucleotide is selected from down group: (a) sequence of 1-2146 position among the SEQ ID NO:1; (b) sequence of 158-1228 position among the SEQ ID NO:1.

In a third aspect of the present invention, the carrier that contains above-mentioned polynucleotide is provided, and has been transformed or host cell of transduceing or the host cell that is directly transformed or transduce by above-mentioned polynucleotide by this carrier.

In a fourth aspect of the present invention, provide preparation to have the preparation method of the active polypeptide of people BNIPL, this method comprises: (a) under conditions suitable for the expression, cultivate the above-mentioned host cell that is transformed or transduce; (b) from culture, isolate and have the active polypeptide of people BNIPL.

In a fifth aspect of the present invention, provide and above-mentioned BNIPL polypeptid specificity bonded antibody.The nucleic acid molecule that can be used for detecting also is provided, and it contains a successive 20-1000 Nucleotide in the above-mentioned polynucleotide.

In a sixth aspect of the present invention, a kind of pharmaceutical composition is provided, it contains the BNIPL polypeptide of the present invention and the pharmaceutically acceptable carrier of safe and effective amount.These pharmaceutical compositions can be treated illnesss such as cancer and cellular abnormality propagation.

In a seventh aspect of the present invention, a kind of pro-apoptotic albumen is provided, it contains the aminoacid sequence of 215-357 position among the SEQ ID NO:2, and condition is that described peptide sequence is not SEQ ID NO:4.

Others of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.

Description of drawings

Fig. 1 is the sequence alignment figure of BNIPL and cdc42GAP and BNIP2.They have common BCH functional domain.

Fig. 2 is presented in the BCH functional domain, " arginine " module that BNIPL and cdc42GAP and BNIP2 have jointly.

Fig. 3 is the express spectra of BNIPL.

Fig. 4 is the in vitro translated electrophoresis photo of BNIPL.Swimming lane 1 is no template contrast; Swimming lane 2 is PinPointTM Control DNA (CAT fusion rotein, the about 39kDa of molecular weight); Swimming lane 3 is pT7X-BNIPL (the about 41kDa of molecular weight).

Fig. 5 has shown that with the anti-BNIPL antiserum(antisera) of rabbit the result that Western blot analyzes is carried out in the expression in human cell line to BNIPL.Wherein, L02 is people's liver cell line; NCIH446 is the strain of people's small cell lung cancer cell; SMMC7721 is a human hepatoma cell strain; BEL7402 is a human hepatoma cell strain.

Fig. 6 has shown the yeast two-hybrid result of BNIPL, and (Fig. 6 a) and Pull-down experimental result (Fig. 6 b-d).

Fig. 7 has shown that the albumen (comprising BNIPL) that contains the BCH structural domain has the pro-apoptotic function.

Fig. 8 is the electrophorogram of escherichia coli expression BNIPL.

Embodiment

The present invention adopts large-scale cDNA clone transfection cancer cells, has on the basis of cancer suppressing action in acquisition, separates the full length cDNA clone that obtains BNIPL first.Evidence, people BNIPL of the present invention has the effect that suppresses clone's formation to cancer cells (liver cancer cell), and the effect that promotes that the cancer cell accent is died is arranged.Finished the present invention on this basis.

In brief, the inventor from placenta cdna library, isolate one with BNIP2 at aminoacid sequence the new gene of higher homologous is arranged, called after BNIPL (Bcl-2/adenovirus E1B 19kDinteracting protein 2 like, BNIP2 like, BNIPL).Sequential analysis shows that BNIPL contains 2146bp, and open reading frame is 1074bp, 357 amino acid of encoding, and estimated molecular weight is 39kD.Through the comparative analysis of information biology homology, find that BNIPL and BNIP2 have higher homology (Identity 45%, and Positive 69%) on the whole protein level.BNIPL comprises a BCH functional domain (BNIP2-cdc42GAP homology who exists in BNIP2 and cdc42GAP, BCH), in addition, BNIPL also comprises an arginine spot module (arginine-patch motif) very conservative in the Rho protein family.Experiment confirm BNIPL can suppress liver cancer cell growth and promote cancer cell-apoptosis.Therefore, BNIPL is a new gene with function, and has using value in oncotherapy.

As used herein, " isolating " is meant that material separates (if natural substance, primal environment promptly is a natural surroundings) from its primal environment.Do not have separation and purification as polynucleotide under the native state in the active somatic cell and polypeptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then for separation and purification.

As used herein, " isolating BNIPL or polypeptide " is meant that the BNIPL polypeptide is substantially free of natural relative other albumen, lipid, carbohydrate or other material.Those skilled in the art can use the purified technology of protein purifying BNIPL of standard.Basically pure polypeptide can produce single master tape on non-reduced polyacrylamide gel.

Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic polypeptide, preferred recombinant polypeptide.Polypeptide of the present invention can be the product of natural purifying, or the product of chemosynthesis, or uses recombinant technology to produce from protokaryon or eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell).The host used according to the recombinant production scheme, polypeptide of the present invention can be glycosylated, maybe can be nonglycosylated.Polypeptide of the present invention also can comprise or not comprise initial methionine residues.

The present invention also comprises fragment, derivative and the analogue of people BNIPL.As used herein, term " fragment ", " derivative " are meant with " analogue " and keep identical biological function of natural human BNIPL of the present invention or active polypeptide basically.Polypeptide fragment of the present invention, derivative or analogue can be that (i) has one or more conservative or substituted polypeptide of non-conservation amino-acid residue (preferred conservative amino acid residue), and the amino-acid residue of such replacement can be also can not encoded by genetic code, or (ii) in one or more amino-acid residues, has a polypeptide of substituted radical, or (iii) mature polypeptide and another compound (such as the compound that prolongs the polypeptide transformation period, polyoxyethylene glycol for example) merges formed polypeptide, or (iv) additional aminoacid sequence is fused to this peptide sequence and the polypeptide that forms (as leader sequence or secretion sequence or be used for the sequence or the proteinogen sequence of this polypeptide of purifying, or with the fusion rotein of the segmental formation of antigen I gG).According to the instruction of this paper, these fragments, derivative and analogue belong to the known scope of those skilled in the art.The particularly preferred fragment of one class is the fragment that contains the BCH structural domain of 215-357 position among the SEQ ID NO:2.

In the present invention, term " people BNIPL polypeptide " or " people BNIPL protein polypeptide " are used interchangeably, and all refer to have the active SEQ ID of people BNIPL NO.2 polypeptide of sequence.This term also comprises having and variant form people BNIPL identical function, SEQ ID NO.2 sequence.These variant forms comprise (but being not limited to): several (are generally 1-50, preferably 1-30, more preferably 1-20,1-10 best) amino acid whose disappearance, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally in 20, preferably being in 10, more preferably is in 5) amino acid.For example, in the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic function usually.This term also comprises active fragments and the reactive derivative of people BNIPL.

The variant form of this polypeptide comprises: homologous sequence, conservative property varient, allelic variant, natural mutation, induced mutation body, under high or low tight degree condition can with the coded albumen of the DNA of people BNIPL DNA hybridization and the polypeptide or the albumen that utilize the antiserum(antisera) of anti-people BNIPL polypeptide to obtain.The present invention also provides other polypeptide, as comprises people BNIPL polypeptide or its segmental fusion rotein (as comprising the fusion rotein of sequence shown in the SEQ IDNO:2).Except the polypeptide of total length almost, the present invention has also comprised the soluble fragments of people BNIPL polypeptide.Usually, this fragment have people BNIPL peptide sequence at least about 20 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, best at least about 100 continuous amino acids.

Invention also provides the analogue of people BNIPL or polypeptide.The difference of these analogues and natural human BNIPL polypeptide can be the difference on the aminoacid sequence, also can be the difference that does not influence on the modified forms of sequence, perhaps haves both at the same time.These polypeptide comprise natural or the inductive genetic variant.The induce variation body can obtain by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also can pass through site-directed mutagenesis method or the biological technology of other known moleculars.Analogue also comprises having the analogue that is different from the amino acid whose residue of natural L-(as D-amino acid), and has non-natural analogue that exist or synthetic amino acid (as β, gamma-amino acid).Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.

(the not changing primary structure usually) form of modification comprises: the chemically derived form such as the acetylize or carboxylated of the polypeptide that body is interior or external.Modification also comprises glycosylation, carries out glycosylation modified and polypeptide that produce in the procedure of processing as those in the synthetic and processing of polypeptide or further.This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) and finishes by polypeptide is exposed to.Modified forms also comprises have the phosphorylated amino acid residue sequence of (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the polypeptide that has been improved its anti-proteolysis performance or optimized solubility property by modifying.

In the present invention, " people BNIPL conservative property variation polypeptide " refers to compare with the aminoacid sequence of SEQ ID NO:2, has 10 at the most, preferably at the most 8, more preferably at the most 5,3 amino acid is replaced by similar performance or close amino acid and is formed polypeptide at the most best.These conservative property variation polypeptide preferably carry out the amino acid replacement according to Table A and produce.

Table A

Initial residue	Representational replacement	The preferred replacement
			Ala(A)	Val；Leu；Ile	Val
Arg(R)	Lys；Gln；Asn	Lys
			Asn(N)	Gln；His；Lys；Arg	Gln
Asp(D)	Glu	Glu
			Cys(C)	Ser	Ser
Gln(Q)	Asn	Asn
			Glu(E)	Asp	Asp
Gly(G)	Pro；Ala	Ala
			His(H)	Asn；Gln；Lys；Arg	Arg
Ile(I)	Leu；Val；Met；Ala；Phe	Leu
			Leu(L)	Ile；Val；Met；Ala；Phe	Ile
Lys(K)	Arg；Gln；Asn	Arg
			Met(M)	Leu；Phe；Ile	Leu
Phe(F)	Leu；Val；Ile；Ala；Tyr	Leu
			Pro(P)	Ala	Ala
Ser(S)	Thr	Thr
			Thr(T)	Ser	Ser
Trp(W)	Tyr；Phe	Tyr
			Tyr(Y)	Trp；Phe；Thr；Ser	Phe
Val(V)	Ile；Leu；Met；Phe；Ala	Leu

Polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence (158-1228 position) shown in the SEQ ID NO:3 or the varient of degeneracy.As used herein, " varient of degeneracy " is meant that in the present invention coding has the protein of SEQ ID NO:2, but with the differentiated nucleotide sequence of coding region sequence of SEQ ID NO:1.

The polynucleotide of the mature polypeptide of coding SEQ ID NO:2 comprise: the encoding sequence of an encoding mature polypeptide; The encoding sequence of mature polypeptide and various additional code sequence; Encoding sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence.

Term " polynucleotide of coded polypeptide " can be the polynucleotide that comprise this polypeptide of encoding, and also can be the polynucleotide that also comprise additional code and/or non-coding sequence.

The invention still further relates to the varient of above-mentioned polynucleotide, its coding has the polypeptide of identical aminoacid sequence or fragment, analogue and the derivative of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing the function of its encoded polypeptides in fact.

The invention still further relates to and above-mentioned nucleic acid array hybridizing and two sequences between have at least 60%, preferably at least 80%, more preferably at least 85%, the polynucleotide of at least 90% homogeny best.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide of the present invention.In the present invention, " stringent condition " is meant: (1) than hybridization under low ionic strength and the comparatively high temps and wash-out, as 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time is added with denaturing agent, as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 95%, be more preferably 97% and just hybridize when above.And the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in the SEQ ID NO:2.

The invention still further relates to nucleic acid fragment with above-mentioned sequence hybridization.As used herein, the length of " nucleic acid fragment " contains 15 Nucleotide at least, better is at least 30 Nucleotide, is more preferably at least 50 Nucleotide, preferably more than at least 100 Nucleotide.Nucleic acid fragment can be used for the amplification technique (as PCR) of nucleic acid to determine and/or to separate the polynucleotide of coding people BNIPL.

Polypeptide among the present invention and polynucleotide preferably provide with isolating form, more preferably are purified to homogeneous.

Dna sequence dna of the present invention can obtain with several method.For example, with hybridization technique DNA isolation well known in the art.These technology including, but not limited to: 1) with probe and genome or the hybridization of cDNA library to detect homology nucleotide sequence and 2) antibody screening of expression library to be to detect the dna fragmentation of the clone with common structure feature.

The specific DNA fragment sequence of coding people BNIPL produces also and can obtain with following method: 1) separate double chain DNA sequence from genomic dna; 2) the chemical synthesising DNA sequence is to obtain the double-stranded DNA of required polypeptide.

The standard method that separates interested cDNA is from the donorcells separating mRNA of this gene of high expression level and carries out reverse transcription, forms plasmid or phage cDNA library.Extract the existing multiple proven technique of method of mRNA, test kit also can obtain (Qiagene) from commercial channels.And the construction cDNA library also is usual method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold SpringHarbor Laboratory.New York, 1989).Also can obtain the cDNA library of commercial offers, as the different cDNA library of Clontech company.When being used in combination the polymeric enzyme reaction technology, even few expression product also can be cloned.

Available ordinary method is screened gene of the present invention from these cDNA libraries.These methods include, but is not limited to: (1) DNA-DNA or DNA-RNA hybridization; (2) function of marker gene occurs or forfeiture; (3) level of the transcript of mensuration people BNIPL; (4), detect the protein product of genetic expression by immunological technique or mensuration biologic activity.Aforesaid method can singly be used, but also several different methods combined utilization.

In (1) kind method, hybridizing used probe is and any a part of homology of polynucleotide of the present invention that at least 15 Nucleotide of its length better are at least 30 Nucleotide, are more preferably at least 50 Nucleotide, preferably at least 100 Nucleotide.In addition, the length of probe within 2kb, preferably is within the 1kb usually.Probe used herein is the dna sequence dna of chemosynthesis on the basis of gene DNA sequence information of the present invention normally.Gene of the present invention itself or fragment are certainly as probe.The mark of dna probe can be used radio isotope, fluorescein or enzyme (as alkaline phosphatase) etc.

In (4) kind method, detect the protein product of people BNIPL genetic expression and can use immunological technique such as Western blotting, radioimmunoprecipitation, enzyme-linked immunosorbent assay (ELISA) etc.

Use method (Saiki, the et al.Science 1985 of round pcr DNA amplification/RNA; 230:1350-1354) be optimized for acquisition gene of the present invention.When particularly being difficult to obtain the cDNA of total length from the library, can preferably use RACE method (the terminal rapid amplifying method of RACE-cDNA), the primer that is used for PCR can suitably be selected according to sequence information of the present invention disclosed herein, and available ordinary method is synthetic.Available ordinary method is as the DNA/RNA fragment by gel electrophoresis separation and purifying amplification.

The gene of the present invention that obtains as mentioned above, perhaps the available ordinary method of mensuration of the nucleotide sequence of various dna fragmentations etc. such as dideoxy chain termination (Sanger et al.PNAS, 1977,74:5463-5467).This class nucleotide sequencing is available commercial sequencing kit etc. also.In order to obtain the cDNA sequence of total length, order-checking need be carried out repeatedly.Sometimes need to measure a plurality of clones' cDNA sequence, just can be spliced into the cDNA sequence of total length.

The present invention also relates to comprise the carrier of polynucleotide of the present invention, and the host cell that produces through genetically engineered with carrier of the present invention or people BNIPL encoding sequence, and the method that produces polypeptide of the present invention through recombinant technology.

Recombinant DNA technology (Science, 1984 by routine; 224:1431), can utilize polymerized nucleoside acid sequence of the present invention to can be used to express or produce the people BNIPL polypeptide of reorganization.In general following steps are arranged:

(1). with the polynucleotide (or varient) of coding of the present invention people BNIPL, or with the recombinant expression vector that contains these polynucleotide proper host cell that transforms or transduce;

(2). the host cell of in suitable medium, cultivating;

(3). separation, protein purification from substratum or cell.

Among the present invention, people BNIPL polynucleotide sequence can be inserted in the recombinant expression vector.Term " recombinant expression vector " refers to that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carriers.The carrier of Shi Yonging includes but not limited in the present invention: and the expression vector based on T7 of in bacterium, expressing (Rosenberg, et al.Gene, 1987,56:125); The pMSXND expression vector of in mammalian cell, expressing (Lee and Nathans, J BioChem.263:3521,1988) and at the carrier that derives from baculovirus of expressed in insect cells.In a word, as long as can duplicate in host and stablize, any plasmid and carrier can be used.A key character of expression vector is to contain replication orgin, promotor, marker gene and translation controlling elements usually.

Method well-known to those having ordinary skill in the art can be used to make up and contains people BNIPL DNA sequences encoding and suitable transcribing/the translate expression vector of control signal.These methods comprise (Sambroook, et al.Molecular Cloning, a LaboratoryManual, cold Spring Harbor Laboratory.New York, 1989) such as extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technologys of body.Described dna sequence dna can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; Lambda particles phage PL promotor; Eukaryotic promoter comprises LTRs and some other known may command gene expression promoter in protokaryon or eukaryotic cell or its virus of CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retrovirus.Expression vector also comprises ribosome bind site and the transcription terminator that translation initiation is used.

In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance.

Comprise the carrier of above-mentioned suitable dna sequence dna and suitable promotor or control sequence, can be used to transform appropriate host cell, so that it can marking protein.

Host cell can be a prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, streptomyces; The bacterial cell of Salmonella typhimurium; Fungal cell such as yeast; Vegetable cell; The insect cell of fruit bat S2 or Sf9; The zooblast of CHO, COS or Bowes melanoma cells etc.

When polynucleotide of the present invention are expressed in higher eucaryotic cells, be enhanced if will make to transcribe when in carrier, inserting enhancer sequence.Enhanser is the cis acting factor of DNA, and nearly 10 to 300 base pairs act on promotor transcribing with enhancing gene usually.Can for example be included in the SV40 enhanser of 100 to 270 base pairs of replication origin side in late period one, at the polyoma enhanser of replication origin side in late period one and adenovirus enhanser etc.

Persons skilled in the art all know how to select appropriate carriers, promotor, enhanser and host cell.

Can carry out with routine techniques well known to those skilled in the art with the recombinant DNA transformed host cell.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results ₂Method is handled, and used step is well-known in this area.Alternative is to use MgCl ₂If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, conventional mechanical method such as microinjection, electroporation, liposome packing etc.

The transformant that obtains can be cultivated with ordinary method, expresses the polypeptide of coded by said gene of the present invention.According to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.

Recombinant polypeptide in the above methods can wrap by in cell, extracellular or on cytolemma, express or be secreted into the extracellular.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.The example of these methods includes, but are not limited to: conventional renaturation handles, with protein precipitant handle (salt analysis method), centrifugal, the broken bacterium of infiltration, superly handle, the combination of super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.

The people BNIPL or the polypeptide of reorganization are of use in many ways.These purposes include, but is not limited to: directly as the disease due to pharmacological agent people BNIPL hypofunction or the forfeiture (in particular for suppressing tumor growth, in particular for treatment liver cancer) and be used to screen antibody, polypeptide or other part that promotes or resist people BNIPL function.For example, antibody can be used for activating or suppressing the function of people BNIPL.The peptide molecule that can suppress or stimulate people BNIPL function that can be used for seeking therapeutic value with the recombinant human B NIPL screening peptide library of expressing.

The present invention also provides screening of medicaments to identify the method that improves (agonist) or check the medicament of (antagonist) people BNIPL.Agonist improves people BNIPL biological function such as stimulate cellular proliferation, and antagonist prevention disorder such as the various cancer relevant with cell hyperproliferation with treatment.For example, can be in the presence of medicine, the people BNIPL with mark cultivates with the film preparation of mammalian cell or expressing human BNIPL.Measure the medicine raising then or check this interactional ability.

The antagonist of people BNIPL comprises antibody, compound, acceptor disappearance thing and the analogue etc. that filter out.The antagonist of people BNIPL can combine and eliminate its function with people BNIPL, or suppresses the generation of people BNIPL, or combines with the avtive spot of polypeptide and to make polypeptide can not bring into play biological function.

Polypeptide of the present invention can be directly used in disease treatment, for example, and various malignant tumours and cellular abnormality propagation etc.

Polypeptide of the present invention, and fragment, derivative, analogue or their cell can be used as antigen to produce antibody.These antibody can be polyclone or monoclonal antibody.Polyclonal antibody can obtain by the method with this polypeptide direct injection animal.The technology of preparation monoclonal antibody comprises hybridoma technology, three knurl technology, people B-quadroma technology, EBV-hybridoma technology etc.

Can be with polypeptide of the present invention and antagonist and suitable pharmaceutical carrier combination back use.These carriers can be water, glucose, ethanol, salt, damping fluid, glycerine and their combination.Composition comprises the polypeptide or the antagonist of safe and effective amount and carrier and the vehicle that does not influence effect of drugs.These compositions can be used as medicine and are used for disease treatment.

The present invention also provides medicine box or the test kit that contains one or more containers, and one or more medicinal compositions compositions of the present invention are housed in the container.With these containers, can have by the given indicative prompting of government authorities of making, using or selling medicine or biological products, the government authorities that this prompting reflects production, uses or sells permits it to use on human body.In addition, polypeptide of the present invention can be used in combination with other treatment compound.

Pharmaceutical composition can be with mode administration easily, as by in part, intravenously, intraperitoneal, intramuscular, subcutaneous, the nose or the route of administration of intracutaneous.People BNIPL comes administration with the amount that treats and/or prevents concrete indication effectively.The amount and the dosage range that are applied to patient's people BNIPL will depend on many factors, as administering mode, person's to be treated healthiness condition and diagnostician's judgement.

The polynucleotide of people BNIPL also can be used for multiple therapeutic purpose.Gene therapy technology can be used for treating cancer.The nucleotide sequence of BNIPL can be used as the therapeutic gene of malignant tumour gene therapy, comprises using liposome (Lipoplex) complex polypeptide type non-virus carrier (Polyplex), naked DNA, adenovirus and retrovirus recombinant chou.Deriving from viral expression vector such as retrovirus, adenovirus, adeno-associated virus (AAV), hsv, parvovirus etc. can be used for people BNIPL transgenosis to cell.The method that makes up the recombinant viral vector of carrier BNIPL gene is found in existing document (Sambrook, et al.).Recombinant human B NIPL gene can be packaged in the liposome and be transferred in the cell in addition.

Suppress the oligonucleotide (comprising sense-rna and DNA) of people BNIPL mRNA and ribozyme also within the scope of the invention.

Polynucleotide imports tissue or intracellular method comprises: directly be injected into polynucleotide in the in-vivo tissue; Or external by carrier (as virus, phage or plasmid etc.) earlier with the polynucleotide transfered cell in, again cell is transplanted in the body etc.

The present invention also provides the antibody at people BNIPL antigenic determinant.These antibody include, but is not limited to: the fragment that polyclonal antibody, monoclonal antibody, chimeric antibody, single-chain antibody, Fab fragment and Fab expression library produce.

The antibody of anti-people BNIPL can be used in the immunohistochemistry technology, detects the people BNIPL in the biopsy specimen.

With the also available labelled with radioisotope of people BNIPL bonded monoclonal antibody, inject in the body and can follow the tracks of its position and distribution.This radiolabeled antibody can be used as a kind of atraumatic diagnostic method and is used for the location of tumour cell and has judged whether transfer.

The disease that antibody among the present invention can be used for treating or prevention is relevant with people BNIPL.The antibody that gives suitable dosage can stimulate or block generation or the activity of people BNIPL.

Antibody also can be used for designing the immunotoxin at a certain privileged sites in the body.As the monoclonal antibody of people BNIPL high-affinity can with bacterium or plant poison (as diphtheria toxin, ricin, abrine etc.) covalent attachment.A kind of usual method is with sulfydryl linking agent such as SPDP, attacks the amino of antibody, by the exchange of disulfide linkage, toxin is incorporated on the antibody, and this hybrid antibody can be used for killing people BNIPL positive cells.

The production of polyclonal antibody can choose BNIPL or polypeptide immune animal, as rabbit, mouse, rat etc.Multiple adjuvant can be used for the enhancing immunity reaction, includes but not limited to freund's adjuvant etc.

People BNIPL monoclonal antibody can be produced with hybridoma technology.With the variable region bonded chimeric antibody in human constant region and inhuman source can with existing technology production (Morrison et al, PNAS, 1985,81:6851).And the technology of existing manufacture order chain antibody also can be used for producing the single-chain antibody of anti-people BNIPL.

Can be incorporated into the rondom polypeptide storehouse that solid formation forms by the various amino acid that may make up by screening with people BNIPL bonded peptide molecule obtains.During screening, must carry out mark to people BNIPL molecule.

The invention still further relates to the diagnostic testing process of quantitative and detection and localization people BNIPL level.These tests are known in the art, and comprise that FISH measures and radioimmunoassay.The people BNIPL level that is detected in the test can be with laying down a definition the importance of people BNIPL in various diseases and be used to the disease of diagnosing people BNIPL to work.

The polynucleotide of people BNIPL can be used for the diagnosis and the treatment of people BNIPL relative disease.Aspect diagnosis, the unconventionality expression of the expression that the polynucleotide of people BNIPL can be used for detecting people BNIPL people BNIPL whether or under morbid state.Can be used for the hybridization of biopsy specimen to judge the abnormal expression of people BNIPL as people BNIPLDNA sequence.Hybridization technique comprises the Southern blotting, Northern blotting, in situ hybridization etc.These technological methods all are disclosed mature technologies, and relevant test kit all can obtain from commercial channels.Part or all of polynucleotide of the present invention can be used as probe stationary on microarray (Microarray) or DNA chip (being called " gene chip " again), is used for analyzing the differential expression analysis and the gene diagnosis of tissue gene.The special primer of personnel selection BNIPL carries out the transcription product that RNA-polymerase chain reaction (RT-PCR) amplification in vitro also can detect people BNIPL.

The sudden change that detects people BNIPL gene also can be used for the disease of diagnosing people BNIPL relevant.The form of people BNIPL sudden change comprises that the point mutation compared with normal wild type people BNIPL dna sequence dna, transposition, disappearance, reorganization and other are any unusual etc.Available existing technology such as Southern blotting, dna sequence analysis, PCR and in situ hybridization detect sudden change.In addition, sudden change might influence proteic expression, therefore can judge indirectly that with Northern blotting, Western blotting gene has or not sudden change.

Sequence of the present invention identifies it also is valuable to karyomit(e).This sequence can be specifically at certain bar human chromosome particular location and and can with its hybridization.At present, need to identify the concrete site of each gene on the karyomit(e).Now, have only chromosomal marker thing seldom to can be used for the marker chromosomes position based on actual sequence data (repetition polymorphism).According to the present invention, for these sequences are associated with disease related gene, its important the first step is positioned these dna sequence dnas on the karyomit(e) exactly.

In brief, prepare PCR primer (preferred 15-35bp), sequence can be positioned on the karyomit(e) according to cDNA.Then, these primers are used for the somatocyte hybrid cell that the PCR screening contains each bar human chromosome.Have only those hybrid cells that contain corresponding to the people's gene of primer can produce the fragment of amplification.

The PCR localization method of somatocyte hybrid cell is that DNA is navigated to concrete chromosomal quick method.Use Oligonucleolide primers of the present invention,, can utilize one group to realize inferior location from specific chromosomal fragment or a large amount of genomic clone by similar approach.Other the similar strategy that can be used for chromosomal localization comprises in situ hybridization, uses the karyomit(e) prescreen and the hybridization preliminary election of the airflow classification of mark, thereby makes up the special cDNA storehouse of karyomit(e).

The cDNA clone is carried out fluorescence in situ hybridization (FISH) with Metaphase Chromosome, can in a step, accurately carry out chromosomal localization.The summary of this technology is referring to Verma etc., Human Chromosomes:aManual of Basic Techniques, Pergamon Press, New York (1988).

In case sequence is positioned to chromosome position accurately, the physical location of this sequence on karyomit(e) just can be associated with the gene map data.These data for example are found in, V.Mckusick, MendelianInheritance in Man (can by with the online acquisition of Johns Hopkins University Welch Medical Library).Can pass through linkage analysis then, determine gene and navigated to relation between the disease on the chromosomal region already.

Then, need to measure ill and not cDNA between diseased individuals or genome sequence difference.If observe certain sudden change in some or all of diseased individuals, and this sudden change is not observed in any normal individual, then this sudden change may be the cause of disease of disease.More ill and diseased individuals not is usually directed at first seek the variation of structure in the karyomit(e), as from the horizontal visible of karyomit(e) or use based on detectable disappearance of the PCR of cDNA sequence or transposition.Resolving power according to present physical mapping and assignment of genes gene mapping technology, being accurately positioned to the cDNA of the chromosomal region relevant with disease, can be a kind of (the supposing that 1 megabasse mapping resolving power and every 20kb are corresponding to a gene) between 50 to 500 potential Disease-causing genes.

People BNIPL Nucleotide full length sequence of the present invention or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence.When sequence is longer, usually needs to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplifies is stitched together by proper order.

In case obtained relevant sequence, just can obtain relevant sequence in large quantity with recombination method.This normally is cloned into carrier with it, changes cell again over to, separates obtaining relevant sequence then from the host cell after the propagation by ordinary method.

In addition, also the method for available synthetic is synthesized relevant sequence, especially fragment length more in short-term.Usually, by first synthetic a plurality of small segments, and then connect and to obtain the very long fragment of sequence.

At present, can be fully come the dna sequence dna of code book invention albumen (or its fragment, or derivatives thereof) by chemosynthesis.This dna sequence dna can be introduced then in the various dna moleculars (as carrier) and cell in this area.In addition, also can will suddenly change and introduce in the protein sequence of the present invention by chemosynthesis.

In view of BNIPL has the effect of anticancer growth, so it not only has the regulating cell division and promotes the effect of cancer cell-apoptosis, and has the using value to treating malignant tumor and diagnosis.In addition, because people BNIPL of the present invention has the natural acid sequence that is derived from the people, therefore compare with the albumen of the same clan that derives from other species, estimate to have higher active and/or lower side effect (for example in the intravital immunogenicity of people lower or do not have) being applied to man-hour.

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.

Embodiment 1:BNIPL cDNA clone's separation reaches the growth-inhibiting to human liver cancer cell

Get the placenta tissue at 3,6,10 monthly ages, (GIBCO BRL company) extracts total RNA by manufacturer's specification sheets with Trizol reagent, extracts mRNA with the mRNA test kit (pharmacia company) of purifying.Make up the cDNA library of above-mentioned mRNA with pCMV-script TMXR cDNA library construction test kit (Stratagene company).Wherein ThermoScript II is used MMLV-RT-Superscript II (GIBCO BRL) instead, and reverse transcription reaction carries out at 42 ℃.Transform XL 10-Gold competent cell, obtained 1 * 10 ⁶The cDNA library of cfu/ μ g cDNA titre.The first round is picking cDNA clone at random, is probe with high abundance cDNA clone with the cDNA clone who has proved cancer inhibitor cell growth function thereafter, screening by hybridization cDNA library, weak positive and negative clone of picking.With Qiagen 96 orifice plate plasmid extraction test kits, carry out the extraction of plasmid DNA by shop instruction.Plasmid DNA and empty carrier transfection simultaneously hepatoma cell line 7721.After the 100ng DNA alcohol precipitation drying, add 6 μ l H ₂Transfection is treated in the O dissolving.Add 0.74 μ l liposome and 9.3 μ l serum-free mediums in every part of DNA sample, behind the mixing, room temperature was placed 10 minutes.Add 150 μ l serum-free mediums in every pipe, divide equally and add 3 holes and grow in 7721 cells of 96 orifice plates, placed 2 hours for 37 ℃, every hole adds 50 μ l serum-free mediums again, 37 ℃ 24 hours.Every hole is changed 100 μ l and is trained liquid entirely, 37 ℃ 24 hours, change the full training liquid 100 μ l that contain G418,37 ℃ 24-48 hour, the limit is observed, the training liquid that G418 concentration does not wait is changed on the limit.After about 2-3 time, there is the clone to form up to the microscopy cell, counting.Found that a cDNA clone has the function (it is 50,26,31 that the empty carrier clone forms number, and the cDNA clone is 0,0,0) that suppresses the clone and form.

To finding after the analysis of cDNA cloned sequence that gene is still imperfect, adopt the Clontech SMART RACEcDNA of company amplification kit (Cat.No.K1811-1), design and synthesize following gene specific primer:

5’ATTCAGCCTTCCGTCCCAGCAACTG 3’(SEQ ID NO：5)

5’CCCAGCAGATCAGTTTCCCAGCCTC 3’(SEQ ID NO：6)

By specification carries out SMART RACE reaction, obtains full-length clone, called after BNIPL.Its full length sequence shown in SEQ ID NO:1, totally 2146 Nucleotide.Contain an ORF in the 157-1228 position, the total length of encoding is 357 amino acid whose albumen (SEQ ID NO:2), and predicted molecular weight is 39710.55Da.

MGTIQEAGKK TDVGVREIAE APELGAALRH GELELKEEWQ DEEFPRLLPE EAGTSEDPED 60

PKGDSQAAAG TPSTLALCGQ RPMRKRLSAP ELRLSLTKGP GNDGASPTQS APSSPDGSSD 120

LEIDELETPS DSEQLDSGHE FEWEDELPRA EGLGTSETAE RLGRGCMWDV TGEDGHHWRV 180

FRMGPREQRV DMTVIEPYKK VLSHGGYHGD GLNAVILFAS CYLPRSSIPN YTYVMEHLFR 240

YMVGTLELLV AENYLLVHLS GGTSRAQVPP LSWIRQCYRT LDRRLRKNLR ALVVVHATWY 300

VKAFLALLRP FISSKFTRKI RFLDSLGELA QLISLDQVHI PEAVRQLDRD LHGSGGT 357

(SEQ ID NO：2)

BNIPL before had been referred to as PP753B.Submit to HUGO (Human GenomeOrgnization, in the time of HUGO), formally with this gene (PP753B) called after BNIPL ( BCl-2/adenovirus E1B 19 KD iNteracting pRotein 2 lIke, BNIP2 like, BNIPL).

The sequential analysis of embodiment 2:BNIPL cDNA

(A) homology analysis

On Nucleotide and amino acid levels, the NIP2 associated protein (being called " BNIPL_v2 " in the application) among BNIPL (being also referred to as " BNIPL_v1 ") and the Chinese patent application 00125281.X has higher homology.The full length sequence of BNIPL_v2 is listed in SEQ ID NO:3, and full length amino acid sequence is listed in SEQ ID NO:4.

Compare with the BNIPL_v1 sequence, contain the insertion of 252bp sequence in BNIPL_v2, insert the site corresponding among the SEQ ID NO:1 the 198th, insertion sequence is corresponding to 154-405 position among the SEQ ID NO:3.In the sequence of BNIPL_v2, cause the albumen premature termination behind the insertion 252bp.

Therefore, compare the aminoacid sequence of BNIPL_v1 is many 82 amino acid shown in the 1-82 position among the SEQ ID NO:2 with BNIPL_v2.

(B) motif of aminoacid sequence analyzes

The motif analytical results as shown in Figure 1.BNIPL and cdc42GAP (a kind of known cytoskeletal protein and accent die associated protein) and BNIP2 (a kind of known accent die associated protein) are the same, all have the BCH structural domain.

In addition, in the BCH functional domain, " arginine " module (Fig. 2) that BNIPL and cdc42GAP and BNIP2 have jointly.

Embodiment 3:BNIPL is the mRNA express spectra in people's tissue

With the BNIPL gene is probe, and (Clontech company) hybridizes with multiple tissue mRNA diaphragm.

The result as shown in Figure 3.BNIPL has expression in the heart, brain, placenta, lung, liver, muscle, pancreas, do not have to express in the kidney or a little less than.

Embodiment 4:BNIPL is in the expression of external translating system

The full length sequence of the BNIPL with complete coding region that embodiment 1 usefulness SMART RACE is obtained is loaded in the pT-Adv carrier (Clontech company), obtains containing the pT-Adv/BNIPL plasmid of BNIPL complete encoding sequence.With BamH I and Not I double digestion pT-Adv/BNIPL plasmid, recovery contains the endonuclease bamhi of BNIPL complete encoding sequence, and be subcloned on the expression vector that contains the T7 promotor, adopt E.coli T7S30 Extract System for Circular DNA (Promega, and utilize Transcend Cat#L1130), ^TMColorimetric Translation Detection System (Promema, Cat.#L5070), vivoexpression BNIPL.

1. set up external translation reaction system:

Plasmid DNA: 1-4 μ g

Complete amino acid tRNA mixed solution: 5 μ l

There is not amino acid whose S30 premix: 20 μ l

TranscendTMtRNA*： 1μl

T7S30 cell pyrolysis liquid: 15 μ l

The nuclease free sterilized water adds to final concentration: 50 μ l

* TranscendTM tRNA is ε-NH ₂By biotin labeled Lys-tRNA.

37 ℃ were reacted 1-2 hour.

2. the analysis of external translation product:

The SDS-PAGE electrophoretic analysis: 15% separation gel, 4% concentrates glue.

Electrotransfer is to PVDF:100V, 60 minutes.

Utilize Streptavidin-Alkaline Phosphatase (streptavidin-alkaline phosphatase lipase) in conjunction with the translation albumen that contains vitamin H, and by Western Blue Stablized Substrate forAlkaline Phosphatase (alkaline phosphatase lipase immobilization staining agent) colour developing.

The result as shown in Figure 4.Positive control sample CA7 fusion protein expression plasmid has protein band (swimming lane 2) at the 39KD place, BNIPL expression plasmid pT7X-BNIPL has protein band (swimming lane 3) at the 41KD place.This shows that BNIPL has obtained expression in the vivoexpression system.

The prokaryotic expression of embodiment 5.BNIPL

Make up the protokaryon recombinant expression vector: pET32a (+)/BNIPL_v1 and pET32a (+)/BNIPL_v2.Method is as follows:

Synthetic forward primer TT AAATGGGAACTATACAAGA (containing BamH I site) (SEQ IDNO:7) and reverse primer AGA

TTTATCCAGTCCTGTG (containing Xho I site) (SEQ ID NO:8), obtaining people's placenta cDNA with ordinary method extracting and reverse transcription is template, through pcr amplification, behind BamH I and Xho I double digestion, be connected into pET32a (+) prokaryotic expression carrier (NOVAGEN company) that same enzyme is cut, obtain pET32a (+)/BNIPL_v1.The sequence verification reading frame is correct.

With same procedure and following primer: forward primer GGAATTCATGCGCAAGCGTCTTTCT (containing EcoR I site) (SEQ ID NO:9), reverse primer is SEQ ID NO:8, obtaining people's placenta cDNA with ordinary method extracting and reverse transcription is template, behind the pcr amplification, behind EcoR I and Xho I double digestion, be connected into pET32a (+) prokaryotic expression carrier (NOVAGEN company) that same enzyme is cut, obtain pET32a (+)/BNIPL_v2.The sequence verification reading frame is correct.

Induce the escherichia coli expression bacterial strain BL21trxB (Δ DE3) that has transformed pET32a (+)/BNIPL_v1 and pET32a (+)/BNIPL_v2 with 1mM IPTG respectively, amplification.Do contrast with the expression strain BL21trxB (Δ DE3) that does not add IPTG.Cracking is handled, and walks the 10%SDS-PAGE electrophoresis, Coomassie brilliant blue dyeing.The result as shown in Figure 8.There are a large amount of inducible protein BNIPL to express.

The preparation of embodiment 6:BNIPL rabbit anti-serum and Western check and analysis

Utilize non-fusion expression carrier pT7450, prokaryotic expression BNIPL albumen adopts (NH ₄) ₂SO ₄Precipitation and DEAE-Sepharose ion exchange chromatography purifying expressing protein.The protein immunization new zealand white rabbit of purifying prepares corresponding rabbit anti-serum, and ELISA measures sero-fast tiring.

The extracting total protein of cell carries out protein quantification with BCH protein quantification test kit.(L02 is people's liver cell line to extractive each cell strain; NCIH446 is the strain of people's small cell lung cancer cell; SMMC7721 is a human hepatoma cell strain; BEL7402 is a human hepatoma cell strain) each 10 μ g of total protein, carry out electrophoresis with 10%SDS-PAGE, and transfer on the nitrocellulose membrane, the sealing of 50g/L skim-milk, the anti-BNIPL polyvalent antibody of rabbit (1: 2000) is one anti-, goat anti-rabbit igg-HRP (1: 5000) was two anti-hybridization, carried out the color development tracing with chemoluminescence method.

The result as shown in Figure 5.Proof BNIPL has expression in 4 kinds of tumour cells.

The interaction of embodiment 7:BNIPL and Bcl-2 and cdc42GAP

(A) yeast two-hybrid experiment

Adopt the yeast two-hybrid system (Matchmaker LexA two-hybridsystem) of Clontech company to detect between BNIPL and Bcl-2, cdc42GAP, cdc42, BNIP2, Bax, Bcl-xL, Flg and the BNIPL self whether have interaction.

Found that BNIPL can interact with Bcl-2, cdc42GAP and BNIPL self, and and do not interact between cdc42, BNIP2, Bax, Bcl-xL and the Flg that (Fig. 6 a).

(B) Pull-down experiment

Further verified that with Pull-down method is as follows:

B.1 make up following recombinant prokaryotic expression vector: pET32a (+)/Bcl-2, pET32a (+)/BNIPL_v2 and pET32a (+)/cdc42GAP, be used to express His-Bcl-2, His-BNIPL_v2 and His-cdc42GAP recombinant protein (band His albumen label).PET32a (+) prokaryotic expression carrier is a NOVAGEN company product.The reading frame of above-mentioned 3 recombinant prokaryotic expression vectors of sequence verification is correct.IPTG induces, and can obtain His-Bcl-2, His-BNIPL_v2 and the His-cdc42GAP recombinant protein of the band His label of prokaryotic expression, is used for the Pull-down experiment.

B.2 make up following recombinant vectors: pcDNA3.1-HA2/BNIPL_v2 and pcDNA3.1-HA2/BNIPL_v2 Δ BCH, be used for external translation HA-BNIPL_v2 and HA-BNIPL_v2 Δ BCH recombinant protein (band HA albumen label), the pcDNA3.1-HA2 carrier is an Invitrogen company product.The reading frame of above-mentioned 2 recombinant expression vectors of sequence verification is correct.Get about 4 microlitres (about 1 microgram) plasmid, 0.5 microlitre methionine(Met) (Promega) and 20.5 microlitre TNT-T7-transcription/trahslationMaster Mix (Promega), mix, place 30-60min for 30 ℃, external translation obtains the HA-BNIPL_v2 and the HA-BNIPL_v2 Δ BCH recombinant protein of band HA label, is used for the Pull-down experiment.

B.3 get each 2 microlitre of Ni-NTA-resin (Qiagen) that are combined with His-Bcl-2, His-BNIPL_v2 and His-cdc42GAP recombinant protein and carry out protein electrophoresis, dyeing with the band of protein standard molecular weight estimated concentration relatively, is adjusted protein concentration consistent.Equally, the HA-BNIPL_v2 that external translation is obtained adjusts to consistent with the concentration of HA-BNIPL_v2 Δ BCH recombinant protein.

B.4Pull-down testing reaction system is:

1×PBS

5％NP-40

1mg/ml BSA

Proteinase inhibitor (1mM PMSF, 10 μ g/ml leupeptin, 5 μ g/ml aprotinin)

5 μ l are combined with the resin bead (Ni-NTA-resin) of prokaryotic expression protein

B.5Pull-down experimental implementation step:

1) the screw socket pipe that will contain the suitable reactions system is put upside down mixing in Cool Room 4, in advance in conjunction with 45 minutes.

2) add the external translation product of 2 μ l, note making HA-BNIPL_v2 consistent with the proteic amount of HA-BNIPL_v2 Δ BCH.

3) 4, centrifugal 2 minutes of 000rpm removes supernatant with careful suction of disposable syringe.

4) add 500 μ l Washing Buffer (Washing buffer:1 * PBS, 0.5% NP-40), at the bottom of the light finger bomb tube, resin bead is hanged.

5) 4, centrifugal 2 minutes of 000rpm, the careful suction removed supernatant.

6) repeating step 4), 5) twice.

7) add 10 μ l, 1 * protein electrophoresis sample solution, 98 ℃ act on 3 minutes, all go up sample and carry out protein electrophoresis.

8) Western detects.

B.6 result

As Fig. 6 b, shown in 6c and the 6d, reconfirmed this interaction between BNIPL and Bcl-2, cdc42GAP and the BNIPL self.

The apoptosis-promoting effect of embodiment 8:BNIPL gene pairs liver cancer cell BEL7402

Respectively with the full-length gene of BNIPL, disappearance and the independent BCH functional domain of BNIPL gene of disappearance BNIPL gene C-end BCH functional domain, transfection human liver cancer cell BEL7402, adopt the early apoptosis detection kit (ApoAlert Annexin V-EGFP Apoptosis kit) of Clontech company, after analyzing the independent BCH functional domain difference transfection BEL7402 of BNIPL full-length gene, disappearance that lacks BNIPL gene C-end BCH functional domain and BNIPL gene, to the influence of human liver cancer cell BEL7402 apoptosis.

Found that BNIPL full-length gene and independent BCH functional domain (corresponding to 215-357 position among the SEQ ID NO:2) have promoter action to the apoptosis of human liver cancer cell BEL7402, and disappearance of disappearance BNIPL gene C-end BCH functional domain there is not promoter action (Fig. 7 a and 7b) to the apoptosis of human liver cancer cell BEL7402.

All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

Sequence table

＜110〉Shanghai Xinshijie Gene Techn Development Co., Ltd.

＜120〉short apoptogene BNIPL and proteins encoded and purposes

<130>024920

<160>9

<170>PatentIn version 3.1

<210>1

<211>2146

<212>DNA

＜213〉homo sapiens (Homo sapiens)

<220>

<221>CDS

<222>(158)..(1228)

<223>

<400>1

ggaagatgag gttacctccc ttccacacct ccctccttgg aggcaagagc tacaacagct 60

gagacagaaa agaggtaagg aagtgttggg ggctgggaca accagctccc caacaactcc 120

taggtgttta aagaaggagg caggaagact tgtgaag atg gga act ata caa gag 175

Met Gly Thr Ile Gln Glu

1 5

gca gga aaa aag aca gat gtt ggg gtc agg gag att gca gaa gca cca 223

Ala Gly Lys Lys Thr Asp Val Gly Val Arg Glu Ile Ala Glu Ala Pro

10 15 20

gaa cta gga gca gcc ctg aga cat ggg gag ttg gag ctg aag gag gaa 271

Glu Leu Gly Ala Ala Leu Arg His Gly Glu Leu Glu Leu Lys Glu Glu

25 30 35

tgg cag gat gaa gaa ttc cct aga ttg ctt cct gag gag gct ggc act 319

Trp Gln Asp Glu Glu Phe Pro Arg Leu Leu Pro Glu Glu Ala Gly Thr

40 45 50

tct gaa gat cct gaa gac cct aaa gga gat tca cag gca gct gca ggt 367

Ser Glu Asp Pro Glu Asp Pro Lys Gly Asp Ser Gln Ala Ala Ala Gly

55 60 65 70

acc ccc agc act tta gcc ctg tgt ggc cag cgc ccc atg cgc aag cgt 415

Thr Pro Ser Thr Leu Ala Leu Cys Gly Gln Arg Pro Met Arg Lys Arg

75 80 85

ctt tct gcc cca gag ttg cgg ctg agt ctg act aag ggg cct gga aat 463

Leu Ser Ala Pro Glu Leu Arg Leu Ser Leu Thr Lys Gly Pro Gly Asn

90 95 100

gat gga gct tca ccc acc cag tct gca cct tcc tct cct gat ggc agt 511

Asp Gly Ala Ser Pro Thr Gln Ser Ala Pro Ser Ser Pro Asp Gly Ser

105 110 115

tct gac ctg gag ata gac gaa ttg gag aca cct tca gac tcg gag cag 559

Ser Asp Leu Glu Ile Asp Glu Leu Glu Thr Pro Ser Asp Ser Glu Gln

120 125 130

ctg gac agt gga cat gaa ttt gaa tgg gaa gat gaa cta ccc cgg gca 607

Leu Asp Ser Gly His Glu Phe Glu Trp Glu Asp Glu Leu Pro Arg Ala

135 140 145 150

gag ggt ctg ggc acc agt gag aca gct gaa agg ctg ggc cga ggt tgt 655

Glu Gly Leu Gly Thr Ser Glu Thr Ala Glu Arg Leu Gly Arg Gly Cys

155 160 165

atg tgg gat gtg act gga gaa gat gga cat cac tgg agg gtg ttc cga 703

Met Trp Asp Val Thr Gly Glu Asp Gly His His Trp Arg Val Phe Arg

170 175 180

atg gga cca cgg gag cag cgc gta gac atg act gtc att gag ccc tat 751

Met Gly Pro Arg Glu Gln Arg Val Asp Met Thr Val Ile Glu Pro Tyr

185 190 195

aag aaa gtc ctg tct cat gga ggt tac cac ggt gat ggc ctc aat gct 799

Lys Lys Val Leu Ser His Gly Gly Tyr His Gly Asp Gly Leu Asn Ala

200 205 210

gtc atc ctt ttt gct tcc tgt tat cta ccc aga agc agc atc ccc aac 847

Val Ile Leu Phe Ala Ser Cys Tyr Leu Pro Arg Ser Ser Ile Pro Asn

215 220 225 230

tac acc tat gtc atg gaa cac ttg ttt agg tat atg gtg gga act ctg 895

Tyr Thr Tyr Val Met Glu His Leu Phe Arg Tyr Met Val Gly Thr Leu

235 240 245

gag ctg cta gta gct gaa aat tac ctg ctt gtt cat ttg agt gga ggc 943

Glu Leu Leu Val Ala Glu Asn Tyr Leu Leu Val His Leu Ser Gly Gly

250 255 260

aca agc agg gcc caa gtt cca cct cta agc tgg ata cgt cag tgt tac 991

Thr Ser Arg Ala Gln Val Pro Pro Leu Ser Trp Ile Arg Gln Cys Tyr

265 270 275

cgt acc ctg gat cgg cgg cta cgg aaa aac ctg cga gcc ctg gtg gtt 1039

Arg Thr Leu Asp Arg Arg Leu Arg Lys Asn Leu Arg Ala Leu Val Val

280 285 290

gtc cat gct aca tgg tat gtg aaa gca ttt ctg gca ctg ctt cgg ccc 1087

Val His Ala Thr Trp Tyr Val Lys Ala Phe Leu Ala Leu Leu Arg Pro

295 300 305 310

ttc atc agt tcc aaa ttc aca cga aaa atc cgt ttt ctg gac agc ctg 1135

Phe Ile Ser Ser Lys Phe Thr Arg Lys Ile Arg Phe Leu Asp Ser Leu

315 320 325

ggg gag ctg gcc caa ctc ata tcc ctg gat caa gtc cac atc cct gaa 1183

Gly Glu Leu Ala Gln Leu Ile Ser Leu Asp Gln Val His Ile Pro Glu

330 335 340

gct gtc aga cag ctg gac cgg gat ctc cat ggc tca gga ggg aca 1228

Ala Val Arg Gln Leu Asp Arg Asp Leu His Gly Ser Gly Gly Thr

345 350 355

tagcacagga ctggataaag ggccttagaa ccagttagtg atctgcctac acctgaatcc 1288

ctgaaacatc tgaactgttt tgtaaatcat cttatcccca acctcagtac caccggatct 1348

tcacttctca gtgggatttt gtcctttgca tgaccctact ttcagcaggg ctttgaggct 1408

gggaaactga tctgctgggt gactttcatt ccagttgctg ggacggaagg ctgaatgtag 1468

ggtcattttg tatgggatat gcagagctct gggttttttt gttttttgtt ttttgagacg 1528

gagtctcgct ctgtcgccag gctggagtgc agtggtgcga tctcggctca ctgcaacctc 1588

cgcctcccgg ttcaagccat tcttctgcct cagcctcagc gagtagctga gactaccggc 1648

gcacgccacc acgcccagct aattgttttg tatttttagt agagacgggg tttcaccatg 1708

ttggccagga tggtctcgat ctcttgacct cgtgatctgc ccgcctcggc ctcccaaagt 1768

gccgagatta caggtgtgag ccaccgcgct cggccagagc tctgggtttt aatcctactt 1828

tagctgtaga accttgggca aataacttca tctttttggg tcctaatttt cctcctgtct 1888

aactggaggg actgtgatcc ttccaccttg gatggaagag gcttacctga cagccagcct 1948

gcctgctggg agccaggaga gtcagctcat taaatcttga agaaccgctg tatgcccttt 2008

ttccttctaa gtcatgtctg ctgcctgtga gcctgggaag gagtgctttc aaaacctgta 2068

tttttgccct ctttagtaaa tttagaactg tagaggctaa taaactgcga tgagacattt 2128

aaaaaaaaaa aaaaaaaa 2146

<210>2

<211>357

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>2

Met Gly Thr Ile Gln Glu Ala Gly Lys Lys Thr Asp Val Gly Val Arg

1 5 10 15

Glu Ile Ala Glu Ala Pro Glu Leu Gly Ala Ala Leu Arg His Gly Glu

20 25 30

Leu Glu Leu Lys Glu Glu Trp Gln Asp Glu Glu Phe Pro Arg Leu Leu

35 40 45

Pro Glu Glu Ala Gly Thr Ser Glu Asp Pro Glu Asp Pro Lys Gly Asp

50 55 60

Ser Gln Ala Ala Ala Gly Thr Pro Ser Thr Leu Ala Leu Cys Gly Gln

65 70 75 80

Arg Pro Met Arg Lys Arg Leu Ser Ala Pro Glu Leu Arg Leu Ser Leu

85 90 95

Thr Lys Gly Pro Gly Ash Asp Gly Ala Ser Pro Thr Gln Ser Ala Pro

100 105 110

Ser Ser Pro Asp Gly Ser Ser Asp Leu Glu Ile Asp Glu Leu Glu Thr

115 120 125

Pro Ser Asp Ser Glu Gln Leu Asp Ser Gly His Glu Phe Glu Trp Glu

130 135 140

Asp Glu Leu Pro Arg Ala Glu Gly Leu Gly Thr Ser Glu Thr Ala Glu

145 150 155 160

Arg Leu Gly Arg Gly Cys Met Trp Asp Val Thr Gly Glu Asp Gly His

165 170 175

His Trp Arg Val Phe Arg Met Gly Pro Arg Glu Gln Arg Val Asp Met

180 185 190

Thr Val Ile Glu Pro Tyr Lys Lys Val Leu Ser His Gly Gly Tyr His

195 200 205

Gly Asp Gly Leu Asn Ala Val Ile Leu Phe Ala Ser Cys Tyr Leu Pro

210 215 220

Arg Ser Ser Ile Pro Asn Tyr Thr Tyr Val Met Glu His Leu Phe Arg

225 230 235 240

Tyr Met Val Gly Thr Leu Glu Leu Leu Val Ala Glu Asn Tyr Leu Leu

245 250 255

Val His Leu Ser Gly Gly Thr Ser Arg Ala Gln Val Pro Pro Leu Ser

260 265 270

Trp Ile Arg Gln Cys Tyr Arg Thr Leu Asp Arg Arg Leu Arg Lys Asn

275 280 285

Leu Arg Ala Leu Val Val Val His Ala Thr Trp Tyr Val Lys Ala Phe

290 295 300

Leu Ala Leu Leu Arg Pro Phe Ile Ser Ser Lys Phe Thr Arg Lys Ile

305 310 315 320

Arg Phe Leu Asp Ser Leu Gly Glu Leu Ala Gln Leu Ile Ser Leu Asp

325 330 335

Gln Val His Ile Pro Glu Ala Val Arg Gln Leu Asp Arg Asp Leu His

340 345 350

Gly Ser Gly Gly Thr

355

<210>3

<211>2353

<212>DNA

＜213〉homo sapiens (Homo sapiens)

<400>3

ggagctacaa cagctgagac agaaaagagg taaggaagtg ttgggggctg ggacaaccag 60

ctccccgaca actcctaggt gtttaaagaa ggaggcagga agacttgtga agatgggaac 120

tatacaagag gcaggaaaaa agacagatgt tgggtggagc aactgctaca gaggtaaata 180

tgattaactt tacattccat ctttcgtctg ctcccaaact taacagcagg taatctgctt 240

ctagcaagtg gtgaaggtaa gagaagcatc tgtataggag gcaagagatc tgagtccttt 300

tgaaggccta tcctctgctc tgtatctcaa ttactgttct tcatttcaat tattcttacc 360

tactattcag ttcccttgat cttttcttct tgggggctgt cttagggtca gggagattgc 420

agaagcacca gaactaggag cagccctgag acatggggag ttggagctga aggaggaatg 480

gcaggatgaa gaattcccta gattgcttcc tgaggaggct ggcacttctg aagatcctga 540

agaccctaaa ggagattcac aggcagctgc aggtaccccc agcactttag ccctgtgtgg 600

ccagcgcccc atgcgcaagc gtctttctgc cccagagttg cggctgagtc tgactaaggg 660

gcctggaaat gatggagctt cacccaccca gtctgcacct tcctctcctg atggcagttc 720

tgacctggag atagacgaat tggagacacc ttcagactcg gagcagctgg acagtggaca 780

tgaatttgaa tgggaagatg aactaccccg ggcagagggt ctgggcacca gtgagacagc 840

tgaaaggctg ggccgaggtt gtatgtggga tgtgactgga gaagatggac atcactggag 900

ggtgttccga atgggaccac gggagcagcg cgtagacatg actgtcattg agccctataa 960

gaaagtcctg tctcatggag gttaccacgg tgatggcctc aatgctgtca tcctttttgc 1020

ttcctgttat ctacccagaa gcagcatccc caactacacc tatgtcatgg aacacttgtt 1080

taggtatatg gtgggaactc tggagctgct agtagctgaa aattacctgc ttgttcattt 1140

gagtggaggc acaagcaggg cccaagttcc acctctaagc tggatacgtc agtgttaccg 1200

taccctggat cggcggctac ggaaaaacct gcgagccctg gtggttgtcc atgctacatg 1260

gtatgtgaaa gcatttctgg cactgcttcg gcccttcatc agttccaaat tcacacgaaa 1320

aatccgtttt ctggacagcc tgggggagct ggcccaactc atatccctgg atcaagtcca 1380

catccctgaa gctgtcagac agctggaccg ggatctccat ggctcaggag ggacatagca 1440

caggactgga taaagggcct tagaaccagt tagtgatctg cctacacctg aatccctgaa 1500

acatctgaac tgttttgtaa atcatcttat ccccaacctc agtaccaccg gatcttcact 1560

tctcagtggg attttgtcct ttgcatgacc ctactttcag cagggctttg aggctgggaa 1620

actgatctgc tgggtgactt tcattccagt tgctgggacg gaaggctgaa tgtagggtca 1680

ttttgtatgg gatatgcaga gctctgggtt tttttgtttt ttgttttttg agacggagtc 1740

tcgctctgtc gccaggctgg agtgcagtgg tgcgatctcg gctcactgca acctccgcct 1800

cccggttcaa gccattcttc tgcctcagcc tcagcgagta gctgagacta ccggcgcacg 1860

ccaccacgcc cagctaattg ttttgtattt ttagtagaga cggggtttca ccatgttggc 1920

caggatggtc tcgatctctt gacctcgtga tctgcccgcc tcggcctccc aaagtgccga 1980

gattacaggt gtgagccacc gcgctcggcc agagctctgg gttttaatcc tactttagct 2040

gtagaacctt gggcaaataa cttcatcttt ttgggtccta attttcctcc tgtctaactg 2100

gagggactgt gatccttcca ccttggatgg aagaggctta cctgacagcc agcctgcctg 2160

ctgggagcca ggagagtcag ctcattaaat cttgaagaac cgctgtatgc cctttttcct 2220

tctaagtcat gtctgctgcc tgtgagcctg ggaaggagtg ctttcaaaac ctgtattttt 2280

gccctcttta gtaaatttag aactgtagag gctaataaac tgcgatgaga catttaaaaa 2340

aaaaaaaaaa aaa 2353

<210>4

<211>275

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>4

Met Arg Lys Arg Leu Ser Ala Pro Glu Leu Arg Leu Ser Leu Thr Lys

l 5 10 15

Gly Pro Gly Asn Asp Gly Ala Ser Pro Thr Gln Ser Ala Pro Ser Ser

20 25 30

Pro Asp Gly Ser Ser Asp Leu Glu Ile Asp Glu Leu Glu Thr Pro Ser

35 40 45

Asp Ser Glu Gln Leu Asp Ser Gly His Glu Phe Glu Trp Glu Asp Glu

50 55 60

Leu Pro Arg Ala Glu Gly Leu Gly Thr Ser Glu Thr Ala Glu Arg Leu

65 70 75 80

Gly Arg Gly Cys Met Trp Asp Val Thr Gly Glu Asp Gly His His Trp

85 90 95

Arg Val Phe Arg Met Gly Pro Arg Glu Gln Arg Val Asp Met Thr Val

100 105 110

Ile Glu Pro Tyr Lys Lys Val Leu Ser His Gly Gly Tyr His Gly Asp

115 120 125

Gly Leu Asn Ala Val Ile Leu Phe Ala Ser Cys Tyr Leu Pro Arg Ser

130 135 140

Ser Ile Pro Asn Tyr Thr Tyr Val Met Glu His Leu Phe Arg Tyr Met

145 150 155 160

Val Gly Thr Leu Glu Leu Leu Val Ala Glu Asn Tyr Leu Leu Val His

165 170 175

Leu Ser Gly Gly Thr Ser Arg Ala Gln Val Pro Pro Leu Ser Trp Ile

180 185 190

Arg Gln Cys Tyr Arg Thr Leu Asp Arg Arg Leu Arg Lys Asn Leu Arg

195 200 205

Ala Leu Val Val Val His Ala Thr Trp Tyr Val Lys Ala Phe Leu Ala

210 215 220

Leu Leu Arg Pro Phe Ile Ser Ser Lys Phe Thr Arg Lys Ile Arg Phe

225 230 235 240

Leu Asp Ser Leu Gly Glu Leu Ala Gln Leu Ile Ser Leu Asp Gln Val

245 250 255

His Ile Pro Glu Ala Val Arg Gln Leu Asp Arg Asp Leu His Gly Ser

260 265 270

Gly Gly Thr

275

<210>5

<211>25

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>5

attcagcctt ccgtcccagc aactg 25

<210>6

<211>25

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>6

cccagcagat cagtttccca gcctc 25

<210>7

<211>27

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>7

ttggatccaa atgggaacta tacaaga 27

<210>8

<211>25

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>8

agactcgagt ttatccagtc ctgtg 25

<210>9

<211>25

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>9

ggaattcatg cgcaagcgtc tttct 25

Claims (9)

1. isolating BNIPL polypeptide is characterized in that this polypeptide is selected from down group:

(a) has the polypeptide of SEQ ID NO:2 aminoacid sequence;

(b) SEQ ID NO:2 aminoacid sequence is formed through replacement, disappearance or the interpolation of 1-10 amino-acid residue, and have the human liver cancer cell of the promotion accent function and interactional by (a) polypeptides derived of dying with Bcl-2.

2. polypeptide as claimed in claim 1 is characterized in that, this polypeptide is the polypeptide with SEQ ID NO:2 aminoacid sequence.

3. isolating polynucleotide is characterized in that, it is selected from down group:

(a) polynucleotide of polypeptide according to claim 1 of encoding;

(b) with polynucleotide (a) complementary polynucleotide.

4. polynucleotide as claimed in claim 3 is characterized in that the polypeptide of this polynucleotide encoding has the aminoacid sequence of SEQ ID NO:2.

5. polynucleotide as claimed in claim 3 is characterized in that, the sequence of these polynucleotide is selected from down group:

(a) sequence of 1-2146 position among the SEQ ID NO:1;

(b) sequence of 158-1228 position among the SEQ ID NO:1.

6. a carrier is characterized in that, it contains the described polynucleotide of claim 3.

7. a genetically engineered host cell is characterized in that, it is a kind of host cell that is selected from down group:

(a) host cell that transforms or transduce with the described carrier of claim 6;

(b) host cell that transforms or transduce with the described polynucleotide of claim 3.

8. the preparation method of the described polypeptide of claim 1 is characterized in that, this method comprises:

(a) under conditions suitable for the expression, cultivate the described host cell of claim 7;

(b) from culture, isolate the described polypeptide of claim 1.

9. a pharmaceutical composition is characterized in that, it contains the described polypeptide of claim 1 and the pharmaceutically acceptable carrier of safe and effective amount.

Images