CN1749415A - Pannonit treatment acute angina pectoris curative effect detection method and test kit - Google Patents
Pannonit treatment acute angina pectoris curative effect detection method and test kit Download PDFInfo
- Publication number
- CN1749415A CN1749415A CN 200410066374 CN200410066374A CN1749415A CN 1749415 A CN1749415 A CN 1749415A CN 200410066374 CN200410066374 CN 200410066374 CN 200410066374 A CN200410066374 A CN 200410066374A CN 1749415 A CN1749415 A CN 1749415A
- Authority
- CN
- China
- Prior art keywords
- gene
- pannonit
- aldh2
- angina pectoris
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention discloses a kind of method of predicting the validity validity of pannonit treatment acute angina pectoris, it comprises detects individual aldehyde dehydrogenase 2 gene A LDH2, transcript and/or albumen and normal phase than whether having variation, exists variation with regard to showing the validity with pannonit treatment acute angina pectoris with regard to this individuality to be lower than common acute angina pectoris crowd.The invention also discloses the reagent corresponding box.
Description
Technical field
The present invention relates to molecular biology and medical field.Relate more specifically to aldehyde dehydrogenase 2 gene (acetaldehyde dehydrogenase 2, ALDH2) single nucleotide polymorphism (singlenucleotide polymorphism, SNP) and and the curative effect of pannonit treatment acute angina pectoris between dependency.The invention still further relates to the method and the test kit that detect these SNP.
Background technology
From the clinical application first time in 1876, (Nitroglycerin NTG) just was used for treating acute angina pectoris to pannonit widely.The sublingual gland drug treatment of pannonit has become the standard treatments of acute angina pectoris.The sublingual gland drug treatment of general pannonit can make the symptom of acute angina pectoris be eased in 5 to 10 minutes.The physiology treatment principle of pannonit mainly is interpreted as, it has the ability that discharges the oxynitrides (NO or NO congener) with pharmacologically active, thereby activate and promotion downstream cyclic guanosine monophosphate (cGMP) approach, reach the effect of the vascular smooth muscle of releiving.
Acute angina pectoris is a kind of very dangerous disease, will be in peril of one's life if can not in time give treatment to.Though be extensive use of pannonit treatment acute angina pectoris at present, still found to have the DeGrain of some acute angina pectoris patients when sublingual gland gives the pannonit treatment clinically.This prompting, these people may treat insensitive to pannonit for various reasons.
People have attempted proposing causing the multiple reason of pannonit treatment inefficacy, comprise environmental difference, individual difference, food habits etc.
The aldehyde dehydrogenase 2 gene belongs to a member in the aldehyde dehydrogenase gene family that relies on NAD (P).This gene family significant feature is the oxidation aldehydes under physiological environment.Except the activity with desaturase, the aldehyde dehydrogenase 2 gene also has the activity of great esterase.It can impel pannonit to be hydrolyzed into 1, and the 2-dinitroglycerine (1,2-GDN) and nitrite ion (NO
2 -).
2002, people such as Chen.ZQ found to test no matter in vivo or experiment in vitro, rely on the dilating effect of the pannonit of cGMP to blood vessel, can be blocked by the proteic inhibitor of aldehyde dehydrogenase 2 gene (ALDH2).This prompting, aldehyde dehydrogenase 2 gene have participated in relying on the physiological action of the pannonit vasodilation of cGMP, and have played the part of important role.
Yet, up to now, may cause the true cause that the pannonit treatment was lost efficacy still not to be proved.
In sum, people also understand very few for the reason of the validity that influences pannonit treatment acute angina pectoris.In order to use pannonit, this area to press for the method and the test kit of the validity of exploitation prediction pannonit treatment acute angina pectoris pointedly.
Summary of the invention
Purpose of the present invention just provides a kind of method and test kit of prejudging the validity of pannonit treatment acute angina pectoris.
In a first aspect of the present invention, provide a kind of vitro detection sample whether to have the method for the single nucleotide polymorphism of aldehyde dehydrogenase 2 gene A LDH2, comprise step:
(a) with the ALDH2 gene of ALDH2 gene-specific primer amplification sample, obtain amplified production; With
(b) detect whether there is following single nucleotide polymorphism in the amplified production:
1951 G → A;
Wherein, the nucleotide position numbering is based on SEQ ID NO:1.
In another preference, described gene-specific primer has the sequence of SEQ ID NO:3 and 4.
In another preference, the length of described amplified production is 50-3000bp, and contains among the SEQ ID NO:1 the 1951st.
In a second aspect of the present invention, a kind of test kit of predicting the validity of pannonit treatment acute angina pectoris is provided, it comprises the primer of specific amplification ALDH2 gene or transcript, it is 50-3000bp that described primer amplification goes out length, and contains among the SEQ ID NO:1 the 1951st amplified production.
In another preference, described test kit also contains the reagent that is selected from down group:
(a) with SEQ ID NO:1 in the 1951st sudden change bonded probe;
(b) the 1951st sudden change restriction enzyme among the identification SEQ ID NO:1.
In another preference, described sudden change is following single nucleotide polymorphism:
1951 G → A;
Wherein, the nucleotide position numbering is based on SEQ ID NO:1.
In another preference, described primer has the sequence of SEQ ID NO:3 and 4.
In a third aspect of the present invention, provide a kind of validity to carry out forecast method to pannonit treatment acute angina pectoris, it comprises step:
Detect ALDH2 gene, transcript and/or the albumen of individuality to be checked, and compare with normal ALDH2 gene, transcript and/or albumen,
There are differences and just show that the validity to pannonit treatment acute angina pectoris with regard to this individuality is lower than common acute angina pectoris crowd.
In another preference, detection be gene or the transcript of ALDH2, and with normal ALDH2 nucleotide sequence comparing difference.
In another preference, described difference is following single nucleotide polymorphism:
1951 G → A;
Wherein, the nucleotide position numbering is based on SEQ ID NO:1.
In a fourth aspect of the present invention, a kind of pharmaceutical composition is provided, it contains 1 of 0.01-99wt%, the 2-dinitroglycerine (1,2-GDN) and nitrite ion (NO
2 -) and pharmaceutically acceptable carrier.Perhaps, said composition contains the pannonit of (a) safe and effective amount (0.01-99wt%), the pannonit that makes of (b) significant quantity is hydrolyzed into 1, and the 2-dinitroglycerine (1,2-GDN) and nitrite ion (NO
2 -) wild-type aldehyde dehydrogenase 2 (usually, the mol ratio of aldehyde dehydrogenase 2 and pannonit is 1: 10,000 to 1: 1,000,000), and pharmaceutically acceptable carrier.
Embodiment
The inventor is through deeply and extensive studies, and the SNP of a large amount of candidate genes is measured and analyzes.Find first and proved that the part SNP of ALDH2 gene and the curative effect that pannonit is treated acute angina pectoris are closely related, the change of ALDH2 will cause the curative effect of pannonit treatment acute angina pectoris to descend, wherein the association study result shows, (1951 G → A) there is significant difference (P＜0.01) in the distribution in case and control group, therefore can be used as the specificity SNP of the validity of prediction pannonit treatment acute angina pectoris at the SNP of the 1951st of ALDH2.Finished the present invention on this basis.
The ALDH2 gene
Aldehyde dehydrogenase 2 gene (acetaldehyde dehydrogenase 2, ALDH2) detailed sequence can be the nucleotide sequence (can referring to network address http://www.ncbi.nlm.nih.gov/) of NT_009775 referring to accession number, shown in SEQ ID NO:1.Its amino acid sequence coded is shown in SEQ ID NO:2.
The aldehyde dehydrogenase 2 gene belongs to a member in the aldehyde dehydrogenase gene family that relies on NAD (P).This gene family significant feature is the oxidation aldehydes under physiological environment.Except the activity with desaturase, the aldehyde dehydrogenase 2 gene also has the activity of great esterase.It can impel pannonit to be hydrolyzed into 1, and the 2-dinitroglycerine (1,2-GDN) and nitrite ion (NO
2 -).
Of the present invention studies show that undergone mutation when causing active decline when aldehyde dehydrogenase 2, the dilating effect that makes pannonit to blood vessel is affected, even is blocked, thereby cause the pannonit curative effect to descend.
As used herein, " ALDH2 gene " refer to encode polynucleotide molecule of aldehyde dehydrogenase 2 comprises DNA and RNA.
As used herein, " ALDH2 albumen " refers to aldehyde dehydrogenase 2 albumen.
As used herein, the aldehyde dehydrogenase 2 gene is divided into two types allelotrope, promptly pleomorphism site is aldehyde dehydrogenase 2 gene 1 type (ALDH2*1) of G and aldehyde dehydrogenase 2 gene 2 types (ALDH2*2) that pleomorphism site is A.
The inventor measures and analyzes the SNP of a large amount of candidate genes, wherein checked order in the almost whole zone in the ALDH2 gene, many SNP have been found, the validity of wherein most of SNP and pannonit treatment acute angina pectoris is also uncorrelated, yet association study shows that 1951 G → A but are the very high SNP of validity cognation that treats acute angina pectoris with pannonit.This SNP makes reading frame become AAA from GAA, thereby caused the change of 504 amino acids from Glu to Lys, and then cause influencing the activity of ALDH2, and finally cause the curative effect of carrier's pannonit treatment acute angina pectoris to be starkly lower than common acute angina pectoris crowd.
Based on new discovery of the present invention, ALDH2 albumen or polypeptide have many-sided new purposes.These purposes include, but is not limited to: the assisting therapy acute angina pectoris for example is used from the combination therapy acute angina pectoris with pannonit one.
On the other hand, the present invention also comprises people ALDH2 DNA or the polypeptide of its fragment coding has specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody.Here, " specificity " is meant that antibody capable is incorporated into people ALDH2 gene product or fragment.Preferably, refer to that those can combine with people ALDH2 gene product or fragment but nonrecognition and be incorporated into the antibody of other irrelevant antigen molecule.Among the present invention antibody comprise those can in conjunction with and suppress the proteic molecule of people ALDH2, comprise that also those do not influence the antibody of people ALDH2 protein function.
The present invention not only comprises complete mono-clonal or polyclonal antibody, but also comprises having immunocompetent antibody fragment, as Fab ' or (Fab)
2Fragment; Heavy chain of antibody; Light chain of antibody; Genetically engineered strand Fv molecule; Or chimeric antibody.
Antibody of the present invention can be prepared by the known various technology of those skilled in that art.For example, the people ALDH2 gene product of purifying or its have antigenic fragment, can be applied to animal to induce the generation of polyclonal antibody.Similarly, expressing human ALDH2 albumen or its have antigenic segmental cell and can be used to immune animal and produce antibody.Multiple adjuvant can be used for the enhancing immunity reaction, includes but not limited to freund's adjuvant etc.
Antibody of the present invention also can be monoclonal antibody.This type of monoclonal antibody can utilize hybridoma technology to prepare.Antibody of the present invention comprises the antibody that can block people ALDH2 protein function and the antibody that does not influence people ALDH2 protein function.Each antibody-like of the present invention can utilize the fragment or the functional zone of people AIDH2 gene product, obtains by the routine immunization technology.These fragments or functional zone can utilize recombinant methods or utilize Peptide synthesizer synthetic.Can come immune animal and produce with the gene product of producing in the prokaryotic cell prokaryocyte (for example E.Coli) with the unmodified form bonded antibody of people ALDH2 gene product; With posttranslational modification form bonded antibody (as the albumen or the polypeptide of glycosylation or phosphorylation), can come immune animal and obtain with the gene product that produces in the eukaryotic cell (for example yeast or insect cell).
The proteic antibody of anti-people ALDH2 can be used in the immunohistochemistry technology, detect people ALDH2 in the biopsy specimen proteic what and/or whether suddenly change.A kind of preferred anti-ALDH2 antibody is the antibody of the normal ALDH2 of nonrecognition ALDH2 but identification suddenlys change, perhaps discerns normal ALDH2 (being wild-type) but the antibody of nonrecognition mutant ALDH2.Utilize these antibody, can carry out the prediction of the validity of pannonit treatment acute angina pectoris easily at protein level.
Utilize ALDH2 albumen of the present invention,, can filter out with ALDH2 albumen interactional material takes place, as inhibitor, agonist or antagonist etc. by various conventional screening methods.
ALDH2 albumen of the present invention and agonist thereof etc. when using (administration) in treatment, can provide different effects.Usually, can these materials are formulated in nontoxic, inert and the pharmaceutically acceptable aqueous carrier medium, wherein pH is about 5-8 usually, and preferably pH is about 6-8, although the pH value can be with being changed to some extent by preparation Substance Properties and illness to be treated.The pharmaceutical composition for preparing can carry out administration by conventional route, comprising (but being not limited to): hypogloeeis, intramuscular, intravenously or subcutaneous administration.
Normal ALDH2 can be directly used in disease treatment, for example, is used for the curative effect treatment of pannonit treatment acute angina pectoris.When using ALDH2 protein inhibitor of the present invention, also can use the medicament of the curative effect of other treatment pannonit treatment acute angina pectoris simultaneously.
The present invention also provides a kind of pharmaceutical composition, and it contains ALDH2 albumen of the present invention and pannonit and the pharmaceutically acceptable carrier or the vehicle of safe and effective amount.This class carrier comprises (but being not limited to): salt solution, damping fluid, glucose, water, ethanol and combination thereof.Pharmaceutical preparation should be complementary with administering mode.Pharmaceutical composition of the present invention can be made into the injection form, for example is prepared by ordinary method with the physiological saline or the aqueous solution that contains glucose and other assistant agents.Pharmaceutical composition such as tablet and capsule can be prepared by ordinary method.Pharmaceutical composition such as solution, tablet and capsule should be made under aseptic condition.The dosage of activeconstituents is the treatment significant quantity, for example every day about 0.1 microgram/kg body weight-Yue 10 mg/kg body weight.
When making pharmaceutical composition, be that ALDH2 albumen or its agonist with safe and effective amount is applied to Mammals, wherein this safe and effective amount is usually at least about 0.1 microgram/kg body weight, and in most of the cases be no more than about 10 mg/kg body weight, preferably this dosage is about 0.1 microgram/kg body weight-Yue 100 micrograms/kg body weight.Certainly, concrete dosage also should be considered factors such as route of administration, patient health situation, and these all are within the skilled practitioners skill.
The invention still further relates to the test method of quantitative and detection and localization people ALDH2 protein level.These tests are known in the art, and comprise ELISA etc.
Whether having the proteic method of ALDH2 in a kind of test sample is to utilize the proteic specific antibody of ALDH2 to detect, and it comprises: sample is contacted with the ALDH2 protein specific antibody; Observe whether form antibody complex, formed antibody complex and just represented to exist in the sample ALDH2 albumen.
The proteic polynucleotide of ALDH2 can be used for prejudging the validity of pannonit treatment acute angina pectoris.Can be used for the hybridization of biopsy specimen to judge the proteic abnormal expression of ALDH2 as the ALDH2 dna sequence dna.Hybridization technique comprises the Southern blotting, Northern blotting, in situ hybridization etc.These technological methods all are disclosed mature technologies, and relevant test kit all can obtain from commercial channels.Part or all of polynucleotide of the present invention can be used as probe stationary on microarray (microarray) or DNA chip (being called " gene chip " again), is used for analyzing the differential expression analysis and the gene test of tissue gene.Carry out RNA-polymerase chain reaction (RT-PCR) amplification in vitro with the special primer of ALDH2 albumen and also can detect the proteic transcription product of ALDH2.
The sudden change that detects the ALDH2 gene also can be used for prejudging the curative effect of pannonit treatment acute angina pectoris.Detection can be at cDNA, also can be at genomic dna.The form of ALDH2 protein mutation comprises that the point mutation compared with normal wild type ALDH2 dna sequence dna, transposition, disappearance, reorganization and other are any unusual etc.Available existing technology such as Southern blotting, dna sequence analysis, PCR and in situ hybridization detect sudden change.In addition, sudden change might influence proteic expression, therefore can judge indirectly that with Northern blotting, Western blotting gene has or not sudden change.
The method of the detection SNP of the present invention of most convenient is by the ALDH2 gene with ALDH2 gene-specific primer amplification sample, obtains amplified production; Detect then and whether have following single nucleotide polymorphism in the amplified production: 1951 G → A, wherein, nucleotide position is numbered based on SEQ ID NO:1.
Should understand, after the present invention has disclosed the dependency of the SNP of ALDH2 gene and the curative effect that pannonit is treated acute angina pectoris first, but those skilled in the art can design the amplified production that specific amplification goes out to contain this SNP position easily, determine whether to exist 1951 G → A by methods such as order-checkings then.Usually, the length of primer is 15-50bp, preferably is 20-30bp.Though the complete complementation of primer and template sequence is preferred, one skilled in the art will appreciate that at primer and template to have under the situation of certain not complementary (especially 5 of primer ' end) also can increase specifically (promptly only amplifying required fragment).The method that contains the test kit of these primers and use these primers is all within the scope of the invention, as long as the amplified production that this primer amplification goes out contains the correspondence position of SNP of the present invention.A kind of preferred primer is to having the sequence of SEQ ID NO:3 and 4.
Though the length of amplified production is not particularly limited, the length of amplified production is 50-3000bp usually, preferably is 150-2000bp, more preferably is 200-1000bp.These amplified productions all should contain among the SEQ ID NO:1 the 1951st.
Because the curative effect of SNP of the present invention and pannonit treatment acute angina pectoris has very high cognation, therefore not only can be used for prejudging more exactly in early days the validity of pannonit treatment acute angina pectoris, and can make the carrier when premorbid not or morbidity, just take reasonable precautions against a rainy day (as using other active drugs as 1, the 2-dinitroglycerine (1,2-GDN) and nitrite ion (NO
2 -), or when using pannonit, use aldehyde dehydrogenase 2), thereby significantly improve rescued effect to the acute angina pectoris patient, therefore have earth shaking using value and social benefit.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:ColdSpring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Embodiment 1
1.1 research object
Chosen 80 China Han, and the patient of the coronary heart disease of clarifying a diagnosis.They are all to contain the medication during as angina pectoris attacks of clothes pannonit.According to the effect of hypogloeeis pannonit administration, these patients can be divided in effective group and ten minutes of produce effects in ten minutes not invalid group of produce effects.Effectively group has 59 patients, the male sex 47 people wherein, women 12 people.Invalid group of totally 21 patients, the male sex 13 people wherein, women 8 people.These patients, from the gender relation, the effect of administration and patient's sex do not have significant correlation (p=0.107).
1.2 experimental technique and result
1.2.1DNA extract
Extract DNA with conventional phenol chloroform method from people's blood, concentration correction is used for conventional pcr amplification to 20ng/ul.
1.2.2PCR and the design of sequencing primer
According to the sequence of ALDH2 gene among the GenBank, design and synthetic following primer.Concrete primer is as shown in table 1 below.
Table 1 primer sequence table
| The primer title | Sequence (5 '-3 ') | SEQ ID NO： |
| Adopted primer is arranged | cctgggcaacagagaaagatt | 3 |
| Antisense primer | cccaacagaccccaatcc | 4 |
1.2.3ALDH2 the pcr amplification of gene
DNA with extraction is a template, uses the Taq enzyme, carries out pcr amplification with the Touchdown program on GeneAmp 9700 PCR instrument.Reaction conditions is: 94 ℃ of pre-sex change 2 minutes, and 94 ℃ of sex change 30 seconds, 63 ℃ of annealing 40 seconds, 72 ℃ were extended totally 10 circulations, 0.5 ℃ of each cycle annealing lapse of temperature 40 seconds; Later 94 ℃ of sex change 30 seconds were annealed 40 seconds for 58 ℃, and 72 ℃ were extended totally 30 circulations 40 seconds; Last 72 ℃ were extended 7 minutes.Pcr amplification product is verified through agarose gel electrophoresis.
As a result, obtain the amplified production of 358bp.
1.2.4SNP discovery and detection
The PCR product is used ABI-PRISM behind the Resin resin purification
TM377 dna sequencing instrument (appliedbiosystems of u.s.a. applied biosystem company (ABI)) carry out the two-way order-checking of the terminal cessation method of fluorescent mark, and the interpretation and the SNP that carry out sequence with Polyphred software (the http://droog.mbt.washington.edu/Polyphred.html of Washington, DC university) confirm.
As a result, find to exist following SNP:1951 position G → A.
1.2.5SNP gene type and analysis
With these 80 patients, at the 1951G/A site in the aldehyde dehydrogenase 2 gene, utilize as above PCR and the result of order-checking, carried out gene type.
Found that: in effectively organizing, aldehyde dehydrogenase 2 gene 1 type (ALDH2*1) homozygote individuality (promptly 1951 are G/G) number is 40; And in invalid group, aldehyde dehydrogenase 2 gene 1 type (ALDH2*1) homozygote number of individuals is 7.The homozygous number of aldehyde dehydrogenase 2 gene 1 type (ALDH2*1), in two different groups, have significant difference (x2=7.59, p=0.006).Presentation of results, the effect of hypogloeeis pannonit drug treatment acute angina pectoris, to the homozygous individuality of aldehyde dehydrogenase 2 gene 1 type (ALDH2*1), obviously compare aldehyde dehydrogenase 2 gene 2 types (ALDH2*2) homozygotes (promptly 1951 is A/A), or the individuality (promptly 1951 is G/A) of the heterozygote of aldehyde dehydrogenase 2 gene 1 type, 2 types is more effective, and both have significant difference.
Embodiment 2
The determination of activity of wild-type and mutant aldehyde dehydrogenase 2
From the individuality of aldehyde dehydrogenase 2 genotype heterozygosis, utilize the method for reverse transcription to obtain the reverse transcription DNA (cDNA) of two kinds of different genotype of wild-type and 1951 G → A mutants, and institute's calling sequence is verified by order-checking.Subsequently, use the method for nested PCR (nest-PCR) that target sequence is increased, and introduced restriction enzyme site.Then, the sequence after the amplification is recombinated into (recombinantplasmid) in the plasmid, and plasmid transfection has been advanced among the insect cell sf9 (available from Invitrogen company).Reorganization is advanced the sequence of plasmid and is also verified by order-checking, is respectively SEQ ID NO:5 (wild-type, the 1510th is G) and SEQ ID NO:6 (mutant, the 1510th is A).Use routine immunization to inhale the method for dying (immunoblotting), verified the aldehyde dehydrogenase 2 expression of gene that infects the plasmid in the cell.
Recombinant expressed aldehyde dehydrogenase 2 gene protein is purified through affinity chromatography, can utilize thomas's light blue (Coomassie blue) dyeing by 12% acrylamide gel electrophoresis, sees the albumen of about 54kDa.
Aldehyde dehydrogenase 2 gene protein with two kinds of recombinant expressed different genotype, and the aldehyde dehydrogenase 2 gene protein behind the purifying of directly obtaining from aldehyde dehydrogenase 2 gene 1 type homozygous individual and aldehyde dehydrogenase 2 gene 1 type, 2 type heterozygous individuals, by radiochemical method, detect the ability that these four kinds of samples transform pannonit.
The results are shown in following table:
Two kinds of proteic dynamicss of allelotype:
| The enzyme genotype | Dehydrogenase activity | Conversion pannonit activity | |
| (U/mg) | Km (μM) | Vmax (nmol/mg·min) | |
| G/G | 0.586 | 8.20 | 5.14 |
| G/A | 0.075 | 20.24 | 1.12 |
| G (transfection) | 0.544 | 11 32 | 4.18 |
| A (1951G/A of transfection) | 0.012 | 25.45 | 1.08 |
Found that the albumen of aldehyde dehydrogenase 2 gene 1 type (being wild-type), obviously, aspect the conversion pannonit, have lower Km than the albumen of aldehyde dehydrogenase 2 gene 2 types, and higher Vmax.And the homozygous albumen of albumen of aldehyde dehydrogenase 2 gene 1 type also has lower Km than 1 type, 2 type heterozygote albumen, higher Vmax.
This shows that the albumen of aldehyde dehydrogenase 2 gene 1 type has the physiologically active of higher conversion pannonit.And the albumen of aldehyde dehydrogenase 2 gene 2 types because the sudden change of 1951G → A has changed proteic aminoacid sequence, has influenced proteic function and activity.The albumen of aldehyde dehydrogenase 2 gene 2 types can't effectively transform pannonit, has also just influenced the effect of pannonit to downstream cGMP approach, can't reach the effect of effective vasodilator unstriated muscle, thereby has reduced the curative effect of pannonit to acute angina pectoris.
Embodiment 3
The validity validity prediction test kit of pannonit treatment acute angina pectoris
As described in embodiment 1, the curative effect of the sudden change of 1951 G → A and pannonit treatment acute angina pectoris is closely related among the SEQ ID NO:1.Therefore, can be that template increases and predicts with DNA of individual to be measured based on this sudden change design ALDH2 gene-specific primer.
Prepare a test kit (100 person-times), it contains:
| Title | Sequence | Concentration |
| Adopted primer is arranged | SEQ ID NO：3 | 100pmol |
| Antisense primer | SEQ ID NO：4 | 100pmol |
| The PCR reaction solution | Contain Taq enzyme dNTP magnesium ion PCR reaction buffer | |
Extract male sex's patients'blood 3ml to be measured, use ordinary method (or using specific test kit) from blood, to extract DNA.The PCR primer of pannonit being treated in the curative effect predication reagent kit of acute angina pectoris is diluted to 1 ì mol/ ì l, is that template is carried out the PCR reaction with the primer that is provided with the DNA that is extracted.Behind the PCR product purification, use ABI-PRISM
TM377 dna sequencing instrument carry out the two-way order-checking of the terminal cessation method of fluorescent mark, and the interpretation and the SNP that carry out sequence with Polyphred software confirm.
Perhaps, amplified production and normal control are carried out stratographic analysis with sex change high performance liquid chromatograph (DHPLC), also can detect 1951 G → A.
The result shows, the validity (was standard with ten minutes produce effects) of pannonit treatment acute angina pectoris that contains the tested object of 1951 G → A is lower than common acute angina pectoris crowd.
Embodiment 4
The dependency of the validity of the SNP of other aldehyde dehydrogenase 2s and pannonit treatment acute angina pectoris
Except 1951 G → A, also detected following 9 SNP in the ALDH2 gene with the method described in the embodiment 1:
| Position (based on SEQ ID NO:1) | The SNP type |
| 72 | A/G |
| 480 | C/G |
| 692 | G/A |
| 696 | C/T |
| 1009 | C/T |
| 1044 | A/G |
| 1409 | C/G |
| 1451 | A/T |
| 1776 | C/T |
With same procedure among the embodiment 1, these SNP SNP gene type and analysis have been carried out.The result shows that the validity of these SNP and pannonit treatment acute angina pectoris does not have dependency statistically.
Discuss
The aldehyde dehydrogenase 2 gene belongs to a member in the aldehyde dehydrogenase gene family that relies on NAD (P).This gene family significant feature is the oxidation aldehydes under physiological environment.Except the activity with desaturase, the aldehyde dehydrogenase 2 gene also has the activity of great esterase.It can impel pannonit to be hydrolyzed into 1, and the 2-dinitroglycerine (1,2-GDN) and nitrite ion (NO
2 -).
In the ten No. two exon of aldehyde dehydrogenase 2 gene (ALDH2), a mononucleotide polymorphism site (SNP) is arranged, i.e. the 1951st guanylic acid and adenylic acid (AMP) (G/A) polymorphic among the SEQ ID NO:1.This SNP site has changed over Methionin (Lys) (seeing SEQ ID NO:2) to proteic No. 504 amino acid of aldehyde dehydrogenase 2 from L-glutamic acid (Glu).By this SNP, the aldehyde dehydrogenase 2 gene is divided into two types allelotrope, promptly pleomorphism site is aldehyde dehydrogenase 2 gene 1 type (ALDH2*1) of G and aldehyde dehydrogenase 2 gene 2 types (ALDH2*2) that pleomorphism site is A.
This SNP has than higher frequency in comprising Chinese's asian population, is about about 30%.Because it has changed the aminoacid sequence of aldehyde dehydrogenase 2 gene protein, caused this SNP to have effect on the function.Aldehyde dehydrogenase 2 gene 1 type has normal enzymic activity, and aldehyde dehydrogenase 2 gene 2 type outputs is the enzyme with active defective.The enzyme that normal activity is arranged that aldehyde dehydrogenase 2 gene 1 type (ALDH2*1) generates can inspire downstream reaction, makes pannonit bring into play vasodilatory effect.And the enzyme that does not have normal activity that aldehyde dehydrogenase 2 gene 2 types (ALDH2*2) are generated can't normally inspire downstream reaction, makes the vasodilator effect of pannonit weaken, even disappears.
The present invention prompting can perhaps for having the acute angina pectoris patient that 1951 G → A suddenlys change, can use 1 with aldehyde dehydrogenase 2 gene 1 type and pannonit Combined Preparation outside pannonit, and the 2-dinitroglycerine (1,2-GDN) and nitrite ion (NO
2 -) wait medicine.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table
＜110〉Research Center of Shanghai Human Genome
Fudan University
Ruijin Hospital Attached to Shanghai Medical Univ No.2
＜120〉pannonit treatment acute angina pectoris curative effect detection method and test kit
<130>045937
<160>6
<170>PatentIn version 3.1
<210>1
<211>2445
<212>DNA
＜213〉homo sapiens (Homo sapiens)
<400>1
acctcgttca tctccttcac ctccgaaatg atctcgcttt tgggtttacg gccggtctct 60
tcacctggag catcagccgg gaaggtcagg gtcgccctgg ctcgggcctg ttcacattgg 120
ggtcaaaggc acacattggg ggctcaacca aggcgagctg cgttcgcggg gccgggtctt 180
tccgcacagg cggagggcgg tggcgggcgc ggaggcgtcg cgcgagccag ggggcagcca 240
cgggccgggg gtacctagcg ccacccgctt cgcttgcatc agctgcgcgc cccatcccga 300
ggaatggtag aggcagcccc gcccccggcc cgcccccgcc tttccattgg ctgccgcgcg 360
gggcggggag cggggtcggc tcagtggccc tgagacccta gctctgctct cggtccgctc 420
gctgtccgct agcccgctgc gatgttgcgc gctgccgccc gcttcgggcc ccgcctgggc 480
cgccgcctct tgtcagccgc cgccacccag gccgtgcctg cccccaacca gcagcccgag 540
gtcttctgca accagatttt cataaacaat gaatggcacg atgccgtcag caggaaaaca 600
ttccccaccg tcaatccgtc cactggagag gtcatctgtc aggtagctga aggggacaag 660
gaagatgtgg acaaggcagt gaaggccgcc cgggccgcct tccagctggg ctcaccttgg 720
cgccgcatgg acgcatcaca caggggccgg ctgctgaacc gcctggccga tctgatcgag 780
cgggaccgga cctacctggc ggccttggag accctggaca atggcaagcc ctatgtcatc 840
tcctacctgg tggatttgga catggtcctc aaatgtctcc ggtattatgc cggctgggct 900
gataagtacc acgggaaaac catccccatt gacggagact tcttcagcta cacacgccat 960
gaacctgtgg gggtgtgcgg gcagatcatt ccgtggaatt tcccgctcct gatgcaagca 1020
tggaagctgg gcccagcctt ggcaactgga aacgtggttg tgatgaaggt agctgagcag 1080
acacccctca ccgccctcta tgtggccaac ctgatcaagg aggctggctt tccccctggt 1140
gtggtcaaca ttgtgcctgg atttggcccc acggctgggg ccgccattgc ctcccatgag 1200
gatgtggaca aagtggcatt cacaggctcc actgagattg gccgcgtaat ccaggttgct 1260
gctgggagca gcaacctcaa gagagtgacc ttggagctgg gggggaagag ccccaacatc 1320
atcatgtcag atgccgatat ggattgggcc gtggaacagg cccacttcgc cctgttcttc 1380
aaccagggcc agtgctgctg tgccggctcc cggaccttcg tgcaggagga catctatgat 1440
gagtttgtgg agcggagcgt tgcccgggcc aagtctcggg tggtcgggaa cccctttgat 1500
agcaagaccg agcaggggcc gcaggtggat gaaactcagt ttaagaagat cctcggctac 1560
atcaacacgg ggaagcaaga gggggcgaag ctgctgtgtg gtgggggcat tgctgctgac 1620
cgtggttact tcatccagcc cactgtgttt ggagatgtgc aggatggcat gaccatcgcc 1680
aaggaggaga tcttcgggcc agtgatgcag atcctgaagt tcaagaccat agaggaggtt 1740
gttgggagag ccaacaattc cacgtacggg ctggccgcag ctgtcttcac aaaggatttg 1800
gacaaggcca attacctgtc ccaggccctc caggcgggca ctgtgtgggt caactgctat 1860
gatgtgtttg gagcccagtc accctttggt ggctacaaga tgtcggggag tggccgggag 1920
ttgggcgagt acgggctgca ggcatacact gaagtgaaaa ctgtcacagt caaagtgcct 1980
cagaagaact cataagaatc atgcaagctt cctccctcag ccattgatgg aaagttcagc 2040
aagatcagca acaaaaccaa gaaaaatgat ccttgcgtgc tgaatatctg aaaagagaaa 2100
tttttcctac aaaatctctt gggtcaagaa agttctagaa tttgaattga taaacatggt 2160
gggttggctg agggtaagag tatatgagga accttttaaa cgacaacaat actgctagct 2220
ttcaggatga tttttaaaaa atagattcaa atgtgttatc ctctctctga aacgcttcct 2280
ataactcgag tttatagggg aagaaaaagc tattgtttac aattatatca ccattaaggc 2340
aactgctaca ccctgctttg tattctgggc taagattcat taaaaactag ctgctcttaa 2400
aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaa 2445
<210>2
<211>517
<212>PRT
＜213〉homo sapiens (Homo sapiens)
<400>2
Met Leu Arg Ala Ala Ala Arg Phe Gly Pro Arg Leu Gly Arg Arg Leu
1 5 10 15
Leu Ser Ala Ala Ala Thr Gln Ala Val Pro Ala Pro Asn Gln Gln Pro
20 25 30
Glu Val Phe Cys Asn Gln Ile Phe Ile Asn Asn Glu Trp His Asp Ala
35 40 45
Val Ser Arg Lys Thr Phe Pro Thr Val Asn Pro Ser Thr Gly Glu Val
50 55 60
Ile Cys Gln Val Ala Glu Gly Asp Lys Glu Asp Val Asp Lys Ala Val
65 70 75 80
Lys Ala Ala Arg Ala Ala Phe Gln Leu Gly Ser Pro Trp Arg Arg Met
85 90 95
Asp Ala Ser His Arg Gly Arg Leu Leu Asn Arg Leu Ala Asp Leu Ile
100 105 110
Glu Arg Asp Arg Thr Tyr Leu Ala Ala Leu Glu Thr Leu Asp Asn Gly
115 120 125
Lys Pro Tyr Val Ile Ser Tyr Leu Val Asp Leu Asp Met Val Leu Lys
130 135 140
Cys Leu Arg Tyr Tyr Ala Gly Trp Ala Asp Lys Tyr His Gly Lys Thr
145 150 155 160
Ile Pro Ile Asp Gly Asp Phe Phe Ser Tyr Thr Arg His Glu Pro Val
165 170 175
Gly Val Cys Gly Gln Ile Ile Pro Trp Asn Phe Pro Leu Leu Met Gln
180 185 190
Ala Trp Lys Leu Gly Pro Ala Leu Ala Thr Gly Asn Val Val Val Met
195 200 205
Lys Val Ala Glu Gln Thr Pro Leu Thr Ala Leu Tyr Val Ala Asn Leu
210 215 220
Ile Lys Glu Ala Gly Phe Pro Pro Gly Val Val Asn Ile Val Pro Gly
225 230 235 240
Phe Gly Pro Thr Ala Gly Ala Ala Ile Ala Ser His Glu Asp Val Asp
245 250 255
Lys Val Ala Phe Thr Gly Ser Thr Glu Ile Gly Arg Val Ile Gln Val
260 265 270
Ala Ala Gly Ser Ser Asn Leu Lys Arg Val Thr Leu Glu Leu Gly Gly
275 280 285
Lys Ser Pro Asn Ile Ile Met Ser Asp Ala Asp Met Asp Trp Ala Val
290 295 300
Glu Gln Ala His Phe Ala Leu Phe Phe Asn Gln Gly Gln Cys Cys Cys
305 310 315 320
Ala Gly Ser Arg Thr Phe Val Gln Glu Asp Ile Tyr Asp Glu Phe Val
325 330 335
Glu Arg Ser Val Ala Arg Ala Lys Ser Arg Val Val Gly Asn Pro Phe
340 345 350
Asp Ser Lys Thr Glu Gln Gly Pro Gln Val Asp Glu Thr Gln Phe Lys
355 360 365
Lys Ile Leu Gly Tyr Ile Asn Thr Gly Lys Gln Glu Gly Ala Lys Leu
370 375 380
Leu Cys Gly Gly Gly Ile Ala Ala Asp Arg Gly Tyr Phe Ile Gln Pro
385 390 395 400
Thr Val Phe Gly Asp Val Gln Asp Gly Met Thr Ile Ala Lys Glu Glu
405 410 415
Ile Phe Gly Pro Val Met Gln Ile Leu Lys Phe Lys Thr Ile Glu Glu
420 425 430
Val Val Gly Arg Ala Asn Asn Ser Thr Tyr Gly Leu Ala Ala Ala Val
435 440 445
Phe Thr Lys Asp Leu Asp Lys Ala Asn Tyr Leu Ser Gln Ala Leu Gln
450 455 460
Ala Gly Thr Val Trp Val Asn Cys Tyr Asp Val Phe Gly Ala Gln Ser
465 470 475 480
Pro Phe Gly Gly Tyr Lys Met Ser Gly Ser Gly Arg Glu Leu Gly Glu
485 490 495
Tyr Gly Leu Gln Ala Tyr Thr Glu Val Lys Thr Val Thr Val Lys Val
500 505 510
Pro Gln Lys Asn Ser
515
<210>3
<211>21
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>3
cctgggcaac agagaaagat t 21
<210>4
<211>18
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>4
cccaacagac cccaatcc 18
<210>5
<211>1551
<212>DNA
＜213〉homo sapiens (Homo sapiens)
<400>5
atgttgcgcg ctgccgcccg cttcgggccc cgcctgggcc gccgcctctt gtcagccgcc 60
gccacccagg ccgtgcctgc ccccaaccag cagcccgagg tcttctgcaa ccagattttc 120
ataaacaatg aatggcacga tgccgtcagc aggaaaacat tccccaccgt caatccgtcc 180
actggagagg tcatctgtca ggtagctgaa ggggacaagg aagatgtgga caaggcagtg 240
aaggccgccc gggccgcctt ccagctgggc tcaccttggc gccgcatgga cgcatcacac 300
aggggccggc tgctgaaccg cctggccgat ctgatcgagc gggaccggac ctacctggcg 360
gccttggaga ccctggacaa tggcaagccc tatgtcatct cctacctggt ggatttggac 420
atggtcctca aatgtctccg gtattatgcc ggctgggctg ataagtacca cgggaaaacc 480
atccccattg acggagactt cttcagctac acacgccatg aacctgtggg ggtgtgcggg 540
cagatcattc cgtggaattt cccgctcctg atgcaagcat ggaagctggg cccagccttg 600
gcaactggaa acgtggttgt gatgaaggta gctgagcaga cacccctcac cgccctctat 660
gtggccaacc tgatcaagga ggctggcttt ccccctggtg tggtcaacat tgtgcctgga 720
tttggcccca cggctggggc cgccattgcc tcccatgagg atgtggacaa agtggcattc 780
acaggctcca ctgagattgg ccgcgtaatc caggttgctg ctgggagcag caacctcaag 840
agagtgacct tggagctggg ggggaagagc cccaacatca tcatgtcaga tgccgatatg 900
gattgggccg tggaacaggc ccacttcgcc ctgttcttca accagggcca gtgctgctgt 960
gccggctccc ggaccttcgt gcaggaggac atctatgatg agtttgtgga gcggagcgtt 1020
gcccgggcca agtctcgggt ggtcgggaac ccctttgata gcaagaccga gcaggggccg 1080
caggtggatg aaactcagtt taagaagatc ctcggctaca tcaacacggg gaagcaagag 1140
ggggcgaagc tgctgtgtgg tgggggcatt gctgctgacc gtggttactt catccagccc 1200
actgtgtttg gagatgtgca ggatggcatg accatcgcca aggaggagat cttcgggcca 1260
gtgatgcaga tcctgaagtt caagaccata gaggaggttg ttgggagagc caacaattcc 1320
acgtacgggc tggccgcagc tgtcttcaca aaggatttgg acaaggccaa ttacctgtcc 1380
caggccctcc aggcgggcac tgtgtgggtc aactgctatg atgtgtttgg agcccagtca 1440
ccctttggtg gctacaagat gtcggggagt ggccgggagt tgggcgagta cgggctgcag 1500
gcatacactg aagtgaaaac tgtcacagtc aaagtgcctc agaagaactc a 1551
<210>6
<211>1551
<212>DNA
＜213〉homo sapiens (Homo sapiens)
<400>6
atgttgcgcg ctgccgcccg cttcgggccc cgcctgggcc gccgcctctt gtcagccgcc 60
gccacccagg ccgtgcctgc ccccaaccag cagcccgagg tcttctgcaa ccagattttc 120
ataaacaatg aatggcacga tgccgtcagc aggaaaacat tccccaccgt caatccgtcc 180
actggagagg tcatctgtca ggtagctgaa ggggacaagg aagatgtgga caaggcagtg 240
aaggccgccc gggccgcctt ccagctgggc tcaccttggc gccgcatgga cgcatcacac 300
aggggccggc tgctgaaccg cctggccgat ctgatcgagc gggaccggac ctacctggcg 360
gccttggaga ccctggacaa tggcaagccc tatgtcatct cctacctggt ggatttggac 420
atggtcctca aatgtctccg gtattatgcc ggctgggctg ataagtacca cgggaaaacc 480
atccccattg acggagactt cttcagctac acacgccatg aacctgtggg ggtgtgcggg 540
cagatcattc cgtggaattt cccgctcctg atgcaagcat ggaagctggg cccagccttg 600
gcaactggaa acgtggttgt gatgaaggta gctgagcaga cacccctcac cgccctctat 660
gtggccaacc tgatcaagga ggctggcttt ccccctggtg tggtcaacat tgtgcctgga 720
tttggcccca cggctggggc cgccattgcc tcccatgagg atgtggacaa agtggcattc 780
acaggctcca ctgagattgg ccgcgtaatc caggttgctg ctgggagcag caacctcaag 840
agagtgacct tggagctggg ggggaagagc cccaacatca tcatgtcaga tgccgatatg 900
gattgggccg tggaacaggc ccacttcgcc ctgttcttca accagggcca gtgctgctgt 960
gccggctccc ggaccttcgt gcaggaggac atctatgatg agtttgtgga gcggagcgtt 1020
gcccgggcca agtctcgggt ggtcgggaac ccctttgata gcaagaccga gcaggggccg 1080
caggtggatg aaactcagtt taagaagatc ctcggctaca tcaacacggg gaagcaagag 1140
ggggcgaagc tgctgtgtgg tgggggcatt gctgctgacc gtggttactt catccagccc 1200
actgtgtttg gagatgtgca ggatggcatg accatcgcca aggaggagat cttcgggcca 1260
gtgatgcaga tcctgaagtt caagaccata gaggaggttg ttgggagagc caacaattcc 1320
acgtacgggc tggccgcagc tgtcttcaca aaggatttgg acaaggccaa ttacctgtcc 1380
caggccctcc aggcgggcac tgtgtgggtc aactgctatg atgtgtttgg agcccagtca 1440
ccctttggtg gctacaagat gtcggggagt ggccgggagt tgggcgagta cgggctgcag 1500
gcatacacta aagtgaaaac tgtcacagtc aaagtgcctc agaagaactc a 1551
Claims (10)
1. whether a vitro detection sample exists the method for the single nucleotide polymorphism of aldehyde dehydrogenase 2 gene A LDH2, it is characterized in that, comprises step:
(a) with the ALDH2 gene of ALDH2 gene-specific primer amplification sample, obtain amplified production; With
(b) detect whether there is following single nucleotide polymorphism in the amplified production:
1951 G → A;
Wherein, the nucleotide position numbering is based on SEQ ID NO:1.
2. the method for claim 1 is characterized in that, described gene-specific primer has the sequence of SEQID NO:3 and 4.
3. the method for claim 1 is characterized in that, the length of described amplified production is 50-3000bp, and contains among the SEQ ID N0:1 the 1951st.
4. test kit of predicting the validity of pannonit treatment acute angina pectoris, it is characterized in that, it comprises the primer of specific amplification ALDH2 gene or transcript, and it is 50-3000bp that described primer amplification goes out length, and contains among the SEQID NO:1 the 1951st amplified production.
5. test kit as claimed in claim 4 is characterized in that, it also contains the reagent that is selected from down group:
(a) with SEQ ID NO:1 in the 1951st sudden change bonded probe;
(b) the 1951st sudden change restriction enzyme among the identification SEQ ID NO:1.
6. test kit as claimed in claim 5 is characterized in that, described sudden change is following single nucleotide polymorphism:
1951 G → A;
Wherein, the nucleotide position numbering is based on SEQ ID NO:1.
7. test kit as claimed in claim 4 is characterized in that described primer has the sequence of SEQ ID NO:3 and 4.
8. the validity to pannonit treatment acute angina pectoris is carried out forecast method, it is characterized in that it comprises step:
Detect ALDH2 gene, transcript and/or the albumen of individuality to be checked, and compare with normal ALDH2 gene, transcript and/or albumen,
There are differences and just show that the validity to pannonit treatment acute angina pectoris with regard to this individuality is lower than common acute angina pectoris crowd.
9. method as claimed in claim 8 is characterized in that, detection be gene or the transcript of ALDH2, and with normal ALDH2 nucleotide sequence comparing difference.
10. method as claimed in claim 9 is characterized in that, described difference is following single nucleotide polymorphism:
1951 G → A;
Wherein, the nucleotide position numbering is based on SEQ ID NO:1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200410066374 CN1749415A (en) | 2004-09-15 | 2004-09-15 | Pannonit treatment acute angina pectoris curative effect detection method and test kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200410066374 CN1749415A (en) | 2004-09-15 | 2004-09-15 | Pannonit treatment acute angina pectoris curative effect detection method and test kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1749415A true CN1749415A (en) | 2006-03-22 |
Family
ID=36605071
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200410066374 Pending CN1749415A (en) | 2004-09-15 | 2004-09-15 | Pannonit treatment acute angina pectoris curative effect detection method and test kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1749415A (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101669030A (en) * | 2007-03-08 | 2010-03-10 | 利兰·斯坦福青年大学托管委员会 | Mitochondrial aldehyde dehydrogenase-2 modulators and methods of use thereof |
| CN103361432A (en) * | 2013-07-26 | 2013-10-23 | 天津市秀鹏生物技术开发有限公司 | Primer group and kit for detecting genetic typing of human aldehyde dehydrogenase 2 (ALDH2) |
| US8772295B2 (en) | 2008-10-28 | 2014-07-08 | The Board Of Trustees Of The Leland Stanford Junior University | Modulators of aldehyde dehydrogenase and methods of use thereof |
| US8906942B2 (en) | 2008-09-08 | 2014-12-09 | The Board Of Trustees Of The Leland Stanford Junior University | Modulators of aldhehyde dehydrogenase activity and methods of use thereof |
| US9670162B2 (en) | 2013-03-14 | 2017-06-06 | The Board Of Trustees Of The Leland Stanford Junio | Mitochondrial aldehyde dehyrogenase-2 modulators and methods of use thereof |
| US10457659B2 (en) | 2011-04-29 | 2019-10-29 | The Board Of Trustees Of The Leland Stanford Junior University | Compositions and methods for increasing proliferation of adult salivary stem cells |
-
2004
- 2004-09-15 CN CN 200410066374 patent/CN1749415A/en active Pending
Cited By (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2126574B1 (en) * | 2007-03-08 | 2015-12-23 | The Board of Trustees of the Leland Stanford Junior University | Mitochondrial aldehyde dehydrogenase-2 modulators and methods of use thereof |
| US9315484B2 (en) | 2007-03-08 | 2016-04-19 | The Board of Trustees—Leland Stanford Junior University | Mitochondrial aldehyde dehydrogenase-2 modulators and methods of use thereof |
| CN101669030B (en) * | 2007-03-08 | 2016-01-13 | 小利兰·斯坦福大学托管委员会 | Mitochondrial aldehyde dehydrogenase-2 modulators and its using method |
| CN101669030A (en) * | 2007-03-08 | 2010-03-10 | 利兰·斯坦福青年大学托管委员会 | Mitochondrial aldehyde dehydrogenase-2 modulators and methods of use thereof |
| US20150105456A1 (en) | 2007-03-08 | 2015-04-16 | The Board Of Trustees Of The Leland Stanford Junior University | Mitochondrial Aldehyde Dehydrogenase-2 Modulators and Methods of Use Thereof |
| US9102651B2 (en) | 2007-03-08 | 2015-08-11 | The Board of Trustees-Leland Stanford Junior University | Mitochondrial aldehyde dehydrogenase-2 modulators and methods of use thereof |
| US8906942B2 (en) | 2008-09-08 | 2014-12-09 | The Board Of Trustees Of The Leland Stanford Junior University | Modulators of aldhehyde dehydrogenase activity and methods of use thereof |
| US9345693B2 (en) | 2008-09-08 | 2016-05-24 | The Board of Trustees-Leland Stanford Junior University | Modulators of aldehyde dehydrogenase activity and methods of use thereof |
| US8772295B2 (en) | 2008-10-28 | 2014-07-08 | The Board Of Trustees Of The Leland Stanford Junior University | Modulators of aldehyde dehydrogenase and methods of use thereof |
| US9370506B2 (en) | 2008-10-28 | 2016-06-21 | The Board Of Trustees Of The Leland Stanford Junior University | Modulators of aldehyde dehydrogenase and methods of use thereof |
| US10457659B2 (en) | 2011-04-29 | 2019-10-29 | The Board Of Trustees Of The Leland Stanford Junior University | Compositions and methods for increasing proliferation of adult salivary stem cells |
| US9670162B2 (en) | 2013-03-14 | 2017-06-06 | The Board Of Trustees Of The Leland Stanford Junio | Mitochondrial aldehyde dehyrogenase-2 modulators and methods of use thereof |
| US10227304B2 (en) | 2013-03-14 | 2019-03-12 | The Board Of Trustees Of The Leland Stanford Junior University | Mitochondrial aldehyde dehydrogenase-2 modulators and methods of use thereof |
| CN103361432A (en) * | 2013-07-26 | 2013-10-23 | 天津市秀鹏生物技术开发有限公司 | Primer group and kit for detecting genetic typing of human aldehyde dehydrogenase 2 (ALDH2) |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1169966C (en) | Isolated, tyrosinase derived peptides and uses thereof | |
| CN1749415A (en) | Pannonit treatment acute angina pectoris curative effect detection method and test kit | |
| CN1948335A (en) | Candida albicans mycellium regulating and controlling factor gene and its use | |
| CN101033487A (en) | Method of detecting KLK1 gene rs5517 polymorphism correlated to primary hypertension | |
| CN1194012C (en) | Sperm formation relative protein and its coding sequence and use | |
| CN1281621C (en) | Method of diagnosing and treating heritage spasm paraplegia using NIPAl gene mutation hot point | |
| CN1289524C (en) | Human telomerase active inhibitor protein and use thereof | |
| CN1824776A (en) | Dilatation type cardiomyopathy diagnosis and therapeutic method and reagent used for said method | |
| CN1661052A (en) | Relativity between gene of endothelin 1 and essential hypertension | |
| CN1304568C (en) | Novel human complement C1r-like serine proteinase analogue, and its encoding sequence and use | |
| CN1510139A (en) | Human auricular fibrillation pathogenic gene, encoding protein and use thereof | |
| CN1614033A (en) | Angiotensin II-2 type receptor gene and its correlation of essential hypertension | |
| CN1661069A (en) | Relativity between gene of angiotensin I converting enzyme and essential hypertension | |
| CN1661074A (en) | Relativity between gene of catalase and essential hypertension | |
| CN1355311A (en) | Polypeptide-human protein Ser-Thr phosphatase 14.30 and polynucleotide for coding it | |
| CN1746187A (en) | Atrial fibrillation peccant gene and uses thereof | |
| CN1661078A (en) | Relativity between converzyme gene of angiotensing I and essential hypertension | |
| CN1597980A (en) | Electric pressure controlling sodium pass 7 type alpha subunit gene relativity with primary hypertension | |
| CN1654676A (en) | Correlation between ornithine decarboxylase 1 gene and primary hypertension | |
| CN1534043A (en) | Ubiquition type molecule of human bone marrow substrate cell source and its coding sequence and use | |
| CN1661081A (en) | Relativity between gene of catalase and essential hypertension | |
| CN1661080A (en) | Relativity between gene of catalase and essential hypertension | |
| CN1661077A (en) | Relativity between gene of catalase and essential hypertension | |
| CN1661075A (en) | Relativity between gene of catalase and essential hypertension | |
| CN1661073A (en) | Relativity between gene of catalase and essential hypertension |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| AD01 | Patent right deemed abandoned |
Effective date of abandoning: 20060322 |
|
| C20 | Patent right or utility model deemed to be abandoned or is abandoned |