CN1746187A - Atrial fibrillation peccant gene and uses thereof - Google Patents
Atrial fibrillation peccant gene and uses thereof Download PDFInfo
- Publication number
- CN1746187A CN1746187A CN 200410066265 CN200410066265A CN1746187A CN 1746187 A CN1746187 A CN 1746187A CN 200410066265 CN200410066265 CN 200410066265 CN 200410066265 A CN200410066265 A CN 200410066265A CN 1746187 A CN1746187 A CN 1746187A
- Authority
- CN
- China
- Prior art keywords
- jqf
- polypeptide
- polynucleotide
- atrial fibrillation
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a kind of new human auricular fibrillation pathogene (JQF) and proteins encoded thereof.This JQF is a kind of mutant of KCNJ2 gene, and nucleotide mutant site occurs in the 505th (numbering is pressed Genbank accession number AF153819) of KCNJ2.In addition, the invention still further relates to the preparation method and the purposes of JQF nucleotide sequence and proteins encoded.
Description
Technical field
The present invention relates to molecular genetics, cytobiology and Cardiology field.Specifically, the present invention relates to atrial fibrillation peccant gene JQF and proteins encoded thereof.In addition, the invention still further relates to the preparation method and the purposes of JQF nucleotide sequence and proteins encoded.
Background technology
Definition according to the World Health Organization, atrial fibrillation (atrial fibrillation) is irregular, the rambling electrical activity in atrium, the P ripple disappears on the electrocardiogram(ECG, replace the f wave that shape on the baseline, size, direction and time-histories differ, Ventricular Rate does not wait fully under not height or dissociation situation.
Atrial fibrillation is one of common arrhythmia clinically, it inspires heart failure or haemodynamics obstacle, and fatal arrhythmia such as bring out to quiver in chamber speed or chamber causes thrombus and embolism incident, increase basic cardiopathic mortality ratio, atrial fibrillation itself can also cause cardiac dilatation.
According to statistics, U.S.'s incidence of atrial fibrillation in patients is 0.9%.With advancing age, incidence of atrial fibrillation in patients swash to increase severely high, the over-65s person then up to 5.9%.According to Framinham research, the elderly (＞65 years old) palsy 1/3 is caused by atrial fibrillation.The Europe incidence of atrial fibrillation in patients and the U.S. are similar, and the Asia is lower slightly.Atrial fibrillation is seriously endangering human beings'health, has also brought suitable economical load to society.
Mackenzie had described atrial fibrillation in greater detail in 1904, and hereafter nearly a century is over and done with, yet the mechanism of atrial fibrillation is still unable to decide which is right, and atrial fibrillation remains a major challenge that medical science faces.
As the specific type of atrial fibrillation, idiopathic atrial fibrillation refers to not have the atrial fibrillation on clear and definite heart change basis.Its name is relatively more chaotic, and other title has isolatism idiopathic atrial fibrillation, optimum idiopathic atrial fibrillation and familial idiopathic atrial fibrillation.Nearly 1/3rd atrial fibrillation classifies as idiopathic atrial fibrillation (Lip GYH, Beevers DG (1995) ABC of atrial fibrillation:history, epidemiology, and importance of atrial fibrillation.BMJ 311:1361-1363).
KCNJ2 is a kind of known gene (Genbank accession number AF153819).Other title of KCNJ2 has IRK1, LQT7, HHIRK1, KIR2.1, HHBIRK1.The KCNJ2 gene is positioned at human No. 17 karyomit(e) 17q23.1-q24.2.Present known KCNJ2 has a kind of transcription product.This gene expression product is inward rectifyimg potassium channel Kir2.1.Existing studies show that, the KCNJ2 transgenation can cause Andersen syndrome.Yet, at present less than disclosing or hinting that KCNJ2 was relevant with human auricular fibrillation.
Before the application, the open or report human auricular fibrillation pathogene relevant with human auricular fibrillation has only KCNQ1.
Therefore, for efficient diagnosis and treatment atrial fibrillation, this area presses for seeks all Disease-causing genes relevant with atrial fibrillation.
Summary of the invention
The purpose of this invention is to provide a kind of new human auricular fibrillation pathogene-JQF and encoded protein thereof, with and fragment, analogue and derivative.
Another object of the present invention provides the method for these polypeptide of production and the purposes of this polypeptide and encoding sequence.
In a first aspect of the present invention, a kind of isolating people JQF protein polypeptide is provided, it is selected from down group: the KCNJ2 albumen with 93 amino acids V → I sudden change; Polypeptide with aminoacid sequence shown in the SEQ ID NO:2, or it contains conservative property variation polypeptide or its active fragments or its reactive derivative of aminoacid sequence CVDIRWRWMLVIFCLAFILSWLFFGCVFWLIALLHG.Preferably, this polypeptide is the polypeptide with aminoacid sequence shown in the SEQ ID NO:2.
In a second aspect of the present invention, a kind of isolating polynucleotide are provided, it comprises a nucleotide sequence, and this nucleotide sequence is shown at least 85% homogeny with a kind of nucleotides sequence that is selected from down group: (a) polynucleotide of coding aforementioned polypeptides; (b) with polynucleotide (a) complementary polynucleotide.Preferably, the polypeptide of this polynucleotide encoding has the aminoacid sequence shown in the SEQ ID NO:2; More preferably, these polynucleotide have the sequence of the group of being selected from down:
(1) coding has the polynucleotide of the polypeptide of aminoacid sequence shown in the SEQ ID NO:2;
(2) nucleotide sequence of 1-1512 position among the SEQ ID NO:1;
(3) nucleotide sequence of 229-1509 position among the SEQ ID NO:1;
In a third aspect of the present invention, the carrier that contains above-mentioned polynucleotide is provided, and has been transformed or host cell of transduceing or the host cell that is directly transformed or transduce by above-mentioned polynucleotide by this carrier.
In a fourth aspect of the present invention, the preparation method of preparation JQF polypeptide is provided, this method comprises: (a) under the condition that is fit to expressing protein, cultivate the above-mentioned host cell that is transformed or transduce; (b) from culture, isolate the JQF polypeptide.
In a fifth aspect of the present invention, provide and above-mentioned JQF protein polypeptide specificity bonded antibody.
In a sixth aspect of the present invention, a kind of composition is provided, it contains JQF protein polypeptide of the present invention and the acceptable carrier of 0.001-99wt%.The purposes of wild-type KCNJ2 albumen or gene also is provided, and they are used to prepare the medicine for the treatment of atrial fibrillation.
In a seventh aspect of the present invention, a kind of method whether heart cell exists the atrial fibrillation susceptibility that detects is provided, it comprises step: whether the JQF transcript is compared with wild-type KCNJ2 transcript and is changed in the detection heart cell sample, and just changing, there is the atrial fibrillation susceptibility in expression;
Whether perhaps detect in the heart cell sample the proteic activity of JQF and compare with wild-type KCNJ2 protein-active and change, just changing, there is the atrial fibrillation susceptibility in expression;
Detect perhaps whether JQF group sequence changes with comparing of normal KCNJ2 genome sequence in the genome sample, change and just represent that there is atrial fibrillation susceptibility (i.e. the individual probability of suffering from atrial fibrillation of this test is higher than normal population) in this heart cell.
Preferably, described variation is disappearance, insertion and the replacement mutation of the Nucleotide in the exon.More preferably, described variation is selected from down group: among the SEQ ID NO:1 Nucleotide 505 by G → A, or among the SEQ ID NO:2 93 amino acids by V → I.
Also provide a kind of vitro detection sample whether to have the method for the single nucleotide polymorphism of KCNJ2, it is characterized in that, comprised step:
(a) with the KCNJ2 gene of KCNJ2 gene-specific primer amplification sample, obtain amplified production; With
(b) detect whether there is following single nucleotide polymorphism in the amplified production: 505 G → A;
Wherein, the nucleotide position numbering is based on SEQ ID NO:1 or Genbank accession number AF153819.
More preferably, described gene-specific primer has the sequence of one of SEQ ID NO:3-8.
In a eighth aspect of the present invention, a kind of test kit that detects atrial fibrillation is provided, it comprises: the primer of (1) specific amplification people JQF is right, and (2) are detected amplified production and are compared the reagent that whether exists variation required with wild-type KCNJ2.Nucleic acid molecule as primer or probe also is provided, and it contains a successive 15-800 Nucleotide in the above-mentioned polynucleotide.
In a ninth aspect of the present invention, provide the purposes of polypeptide of the present invention and encoding sequence.Polypeptide for example of the present invention can be used to screening and promote the active agonist of people's JQF protein polypeptide, and perhaps screening suppresses the active antagonist of people's JQF protein polypeptide, perhaps is used to the peptide finger print identification.The proteic encoding sequence of people JQF of the present invention or its fragment can be used as primer and be used for pcr amplification reaction.
In a tenth aspect of the present invention, provide the animal pattern that contains people JQF.Preferably, described animal pattern is selected from mouse, rat.
Others of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.
Description of drawings
Fig. 1 has shown to have 505 G → sequencing result of the nucleotide sequence of the mutant KCNJ2 (being JQF) of A sudden change, and wherein, the mutational site marks with arrow, and this coding mutation is corresponding to the 93rd V → I sudden change in the aminoacid sequence.
Fig. 2 has shown to have 505 G in KCNJ2 → the family situation of A sudden change, and this coding mutation is corresponding to the 93rd V → I sudden change in the aminoacid sequence.Wherein, the square expression male sex, circle is represented the women; The band oblique line be dead, and is solid in discovery has atrial fibrillation, and hollow do not have an atrial fibrillation; That arrow is represented is the propositus.
Embodiment
In order to find human auricular fibrillation pathogene, the inventor supposes to encode the KCNJ2 sudden change of main potassium channel-inward rectifyimg potassium channel kir2.1 in the cardiac muscle may be relevant with the familial atrial fibrillation.In 28 familial atrial fibrillation familys, this gene is carried out Mutation Screening, to the relation of in a family, having established sudden change and atrial fibrillation after the coding region performing PCR amplification of candidate gene, the direct order-checking, with the functional analysis of patch clamp row mutant, and get rid of the possibility that there is same transgenation in the normal random individual of 288 examples, finally establishing this JQF gene is one of Disease-causing gene that causes human auricular fibrillation.
The JQF that the present invention identifies is a kind of mutant of KCNJ2.The feature of JQF of the present invention is that it has nucleotide sequence shown in the SEQ ID NO.1, is: JQF505 position (SEQ ID NO:1) Nucleotide is A, and 505 Nucleotide of KCNJ2 gene are G with human KCNJ2 gene order difference.Replace (Fig. 1) owing to G → A has taken place 505 Nucleotide in nucleotide sequence shown in the SEQ IDNO.1, therefore, JQF coding of the present invention has the albumen of aminoacid sequence shown in the SEQ ID NO.2.With the aminoacid sequence difference of human KCNJ2 genes encoding be, the former 93 amino acids (SEQ ID NO:2) be Isoleucine (isoleucine, I), the latter's 93 amino acids be Xie Ansuan (valine, V).
JQF of the present invention and human KCNJ2 only have difference on exon.Exon is positioned at proteic M1 end of KCNJ2 or external spiral district, belongs to high conservative amino-acid residue district, and is relevant with atrial fibrillation.This prompting, the variation of exon is a kind of cause of disease that causes human auricular fibrillation in the KCNJ2 gene.
In the present invention, term " JQF albumen ", " JQF polypeptide " or " JQF proteins encoded " are used interchangeably, and all refer to have albumen or the polypeptide of people JQF proteins encoded aminoacid sequence (SEQ ID NO:2).This term also comprises the JQF coding JQF albumen that contains or do not contain initial methionine.
KCNJ2 compares with wild-type, and the JQF gene is exactly the 505th mutant KCNJ2 gene that G → A sudden change takes place in the nucleotide sequence, and the JQF polypeptide is exactly the 93rd mutant KCNJ2 polypeptide that V → I sudden change takes place in the aminoacid sequence.
The genome sequence of wild-type KCNJ2 is listed in NT-035430[gi:27484741], its CDS is positioned at the 2063620-2064903 position, and the sudden change position of JQF is 2063896 G → A
As used herein, " isolating " is meant that material separates (if natural substance, primal environment promptly is a natural surroundings) from its primal environment.Do not have separation and purification as polynucleotide under the native state in the active somatic cell and polypeptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then for separation and purification.
As used herein, " isolating JQF albumen or polypeptide " is meant that the JQF polypeptide is substantially free of natural relative other albumen, lipid, carbohydrate or other material.Those skilled in the art can use the purified technology of protein purifying JQF albumen of standard.Basically pure polypeptide can produce single master tape on non-reduced polyacrylamide gel.The purity of JQF polypeptide can be used amino acid sequence analysis.
Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic polypeptide, preferred recombinant polypeptide.Polypeptide of the present invention can be the product of natural purifying, or the product of chemosynthesis, or uses recombinant technology to produce from protokaryon or eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell).The host used according to the recombinant production scheme, polypeptide of the present invention can be glycosylated, maybe can be nonglycosylated.Polypeptide of the present invention also can comprise or not comprise initial methionine residues.
The present invention also comprises the proteic fragment of people JQF, derivative and analogue.As used herein, term " fragment ", " derivative " are meant with " analogue " and keep identical biological function of natural human JQF albumen of the present invention or active polypeptide basically.Polypeptide fragment of the present invention, derivative or analogue can be that (i) has one or more conservative or substituted polypeptide of non-conservation amino-acid residue (preferred conservative amino acid residue), and the amino-acid residue of such replacement can be also can not encoded by genetic code, or (ii) in one or more amino-acid residues, has a polypeptide of substituted radical, or (iii) mature polypeptide and another compound (such as the compound that prolongs the polypeptide transformation period, polyoxyethylene glycol for example) merges formed polypeptide, or (iv) additional aminoacid sequence is fused to this peptide sequence and the polypeptide that forms (as leader sequence or secretion sequence or be used for the sequence or the proteinogen sequence of this polypeptide of purifying, or with the fusion rotein of the segmental formation of antigen I gG).According to the instruction of this paper, these fragments, derivative and analogue belong to the known scope of those skilled in the art.
In the present invention, term " people JQF polypeptide " refers to have the SEQ ID NO.2 polypeptide of sequence of people JQF protein-active.This term also comprises having and variant form people JQF albumen identical function, SEQ ID NO.2 sequence.
The variant form of this polypeptide comprises: homologous sequence, conservative property varient, allelic variant, natural mutation, induced mutation body, under high or low tight degree condition can with the coded albumen of the DNA of people JQF DNA hybridization and the polypeptide or the albumen that utilize the antiserum(antisera) of anti-people JQF polypeptide to obtain.
Invention also provides the analogue of people JQF albumen or polypeptide.The difference of these analogues and natural human JQF polypeptide can be the difference on the aminoacid sequence, also can be the difference that does not influence on the modified forms of sequence, perhaps haves both at the same time.These polypeptide comprise natural or the inductive genetic variant.
Modified forms comprises: the chemically derived form such as the acetylize or carboxylated of the polypeptide that body is interior or external.Modification also comprises glycosylation, carries out glycosylation modified and polypeptide that produce in the procedure of processing as those in the synthetic and processing of polypeptide or further.This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) and finishes by polypeptide is exposed to.Modified forms also comprises have the phosphorylated amino acid residue sequence of (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the polypeptide that has been improved its anti-proteolysis performance or optimized solubility property by modifying.
In the present invention, " people JQF albumen conservative property variation polypeptide " refers to compare with the aminoacid sequence of SEQ ID NO:2, has 10 at the most, preferably at the most 8, more preferably at the most 5,3 amino acid is replaced by similar performance or close amino acid and is formed polypeptide at the most best.
Polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:1 or the varient of degeneracy.As used herein, " varient of degeneracy " is meant that in the present invention coding has the protein of SEQ ID NO:2, but with the differentiated nucleotide sequence of coding region sequence shown in the SEQ ID NO:1.
Term " polynucleotide of coded polypeptide " can be the polynucleotide that comprise this polypeptide of encoding, and also can be the polynucleotide that also comprise additional code and/or non-coding sequence.
The invention still further relates to the varient of above-mentioned polynucleotide, its coding has the polypeptide of identical aminoacid sequence or fragment, analogue and the derivative of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide.
The invention still further relates to and above-mentioned sequence hybridization and two sequences between have at least 50%, preferably at least 70%, the polynucleotide of at least 80% homogeny more preferably.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide of the present invention.
The invention still further relates to nucleic acid fragment with above-mentioned sequence hybridization.As used herein, the length of " nucleic acid fragment " contains 15 Nucleotide at least, better is at least 30 Nucleotide, is more preferably at least 50 Nucleotide, preferably more than at least 100 Nucleotide.Nucleic acid fragment can be used for the amplification technique (as PCR) of nucleic acid to determine and/or the proteic polynucleotide of separation coding JQF.
People JQF Nucleotide full length sequence of the present invention or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence.When sequence is longer, usually needs to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplifies is stitched together by proper order.
In case obtained relevant sequence, just can obtain relevant sequence in large quantity with recombination method.This normally is cloned into carrier with it, changes cell again over to, separates obtaining relevant sequence then from the host cell after the propagation by ordinary method.
In addition, also the method for available synthetic is synthesized relevant sequence, especially fragment length more in short-term.Usually, by first synthetic a plurality of small segments, and then connect and to obtain the very long fragment of sequence.
At present, can be fully obtain the dna sequence dna of code book invention albumen (or its fragment, or derivatives thereof) by chemosynthesis.This dna sequence dna can be introduced in various existing dna moleculars as known in the art (or as carrier) and the cell then.In addition, also can will suddenly change and introduce in the aminoacid sequence of the present invention by chemosynthesis.
The present invention also relates to comprise the carrier of polynucleotide of the present invention, and the host cell that produces through genetically engineered with carrier of the present invention or JQF albumen coded sequence, and the method that produces polypeptide of the present invention through recombinant technology.
Recombinant DNA technology (Science, 1984 by routine; 224:1431), can utilize polymerized nucleoside acid sequence of the present invention to can be used to express or produce the JQF polypeptide of reorganization.In general following steps are arranged:
(1). with the polynucleotide (or varient) of coding of the present invention people JQF polypeptide, or with the recombinant expression vector that contains these polynucleotide proper host cell that transforms or transduce;
(2). the host cell of in suitable medium, cultivating;
(3). separation, protein purification from substratum or cell.
Among the present invention, people JQF polynucleotide sequence can be inserted in the recombinant expression vector.Term " recombinant expression vector " refers to that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carriers.In a word, as long as can duplicate in host and stablize, any plasmid and carrier can be used.A key character of expression vector is to contain replication orgin, promotor, marker gene and translation controlling elements usually.
Method well-known to those having ordinary skill in the art can be used to make up and contains people JQF DNA sequences encoding and suitable transcribing/the translate expression vector of control signal.These methods comprise extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technology of body etc.Described dna sequence dna can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; Lambda particles phage PL promotor; Eukaryotic promoter comprises LTRs and some other known may command gene expression promoter in protokaryon or eukaryotic cell or its virus of CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retrovirus.Expression vector also comprises ribosome bind site and the transcription terminator that translation initiation is used.
In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance.
Comprise the carrier of above-mentioned suitable dna sequence dna and suitable promotor or control sequence, can be used to transform appropriate host cell, so that it can marking protein.
Host cell can be a prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, streptomyces; The bacterial cell of Salmonella typhimurium; Fungal cell such as yeast; Vegetable cell; The insect cell of fruit bat S2 or Sf9; The zooblast of CHO, COS, 293 cells or Bowes melanoma cells etc.
When polynucleotide of the present invention are expressed in higher eucaryotic cells, be enhanced if will make to transcribe when in carrier, inserting enhancer sequence.
Persons skilled in the art all know how to select appropriate carriers, promotor, enhanser and host cell.
Can carry out with routine techniques well known to those skilled in the art with the recombinant DNA transformed host cell.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results
2Method is handled, and used step is well-known in this area.Another kind method is to use MgCl
2If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, conventional mechanical method such as microinjection, electroporation, liposome packing etc.
The transformant that obtains can be cultivated with ordinary method, expresses the polypeptide of coded by said gene of the present invention.According to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.
The extracellular can be expressed or be secreted into to recombinant polypeptide in the above methods in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.The example of these methods includes, but are not limited to: conventional renaturation handles, with protein precipitant handle (salt analysis method), centrifugal, the broken bacterium of infiltration, superly handle, the combination of super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.
The people JQF albumen or the polypeptide of reorganization are of use in many ways.These purposes include, but is not limited to: the direct disease due to the low or forfeiture and be used to screen and promote or antibody, polypeptide or other part of antagonism JQF protein function as pharmacological agent JQF protein function.The peptide molecule that can suppress or stimulate people JQF protein function that can be used for seeking therapeutic value with the recombinant human JQF protein screening peptide library of expressing.
On the other hand, the present invention also comprises people JQF DNA or the polypeptide of its fragment coding has specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody.Here, " specificity " is meant that antibody capable is incorporated into people JQF product or fragment.Preferably, refer to that those can combine with people JQF product or fragment but nonrecognition and be incorporated into the antibody of other irrelevant antigen molecule.A kind of particularly preferred antibody is to discern JQF albumen but the proteic antibody of nonrecognition wild-type KCNJ2.Among the present invention antibody comprise those can in conjunction with and suppress the proteic molecule of people JQF, comprise that also those do not influence the antibody of people JQF protein function.The present invention also comprise those can with modify or without the people JQF product bonded antibody of modified forms.
The present invention not only comprises complete mono-clonal or polyclonal antibody, but also comprises having immunocompetent antibody fragment, as Fab ' or (Fab)
2Fragment; Heavy chain of antibody; Light chain of antibody; Genetically engineered strand Fv molecule; Or chimeric antibody.
Antibody of the present invention can be prepared by the known various technology of those skilled in that art.For example, the people JQF product of purifying or its have antigenic fragment, can be applied to animal to induce the generation of polyclonal antibody.Similarly, expressing human JQF albumen or its have antigenic segmental cell and can be used to immune animal and produce antibody.Antibody of the present invention also can be monoclonal antibody.This type of monoclonal antibody can utilize hybridoma technology to prepare.Each antibody-like of the present invention can utilize the fragment or the functional zone of people JQF product, obtains by the routine immunization technology.These fragments or functional zone can utilize recombinant methods or utilize Peptide synthesizer synthetic.Can come immune animal and produce with the gene product of producing in the prokaryotic cell prokaryocyte (for example E.Coli) with the unmodified form bonded antibody of people JQF product; With posttranslational modification form bonded antibody (as the albumen or the polypeptide of glycosylation or phosphorylation), can come immune animal and obtain with the gene product that produces in the eukaryotic cell (for example yeast or insect cell).
JQF proteins encoded antibody of the present invention can be used for identifying the cell of expressing the JQF proteins encoded, as the myocardial cell.For example, can with a kind of detectable molecule for example fluorescein isothiocyanic acid (FITC) come mark JQF proteins encoded specific antibody, allow JQF proteins encoded specific antibody contact then, detect and JQF proteins encoded specific antibody bonded cell with fluorescent microscope or flow cytometer again with cell sample.
Except cell surface detects the JQF proteins encoded, can also analyze this protein with the Western engram technology.Cell pyrolysis liquid can from culturing cell or take from patient's tissue sample such as cardiac muscle extract, and be dissolved in the lysis buffer that contains stain remover.Use sds polyacrylamide gel electrophoresis isolated cell extract (simultaneously with the JQF proteins encoded polypeptide of purifying as positive control) then, then it is transferred on the nitrocellulose by electrophoresis hybridization.In order to survey the JQF proteins encoded, can use typical antibodies detection method, for example radioautograph or alkaline phosphatase enzyme assay method with the immunity of Western trace.And can use the contrast of immunization serum or incoherent monoclonal antibody as non-specific responding.
Whether and quantity the expression of also available Nothern blotting technical Analysis JQF proteins encoded promptly analyzes the existence of JQF proteins encoded rna transcription thing in cell.
The Western engram analysis of the Nothern engram analysis of JQF proteins encoded DNA and JQF proteins encoded specific antibody can be united use, to confirm the expression of JQF proteins encoded in biological specimen.JQF proteins encoded DNA can also be used for Southern engram analysis or in situ hybridization analysis, with this assignment of genes gene mapping on karyomit(e), and can carry out genetic linkage analysis to find out other possible disease related gene.
Along with the part of human auricular fibrillation molecular genetic mechanism is established, the human auricular fibrillation gene diagnosis may be carried out at specific crowd.The gene diagnosis method comprises sequencing technologies, DNA chip technology etc.Present sequencing technologies and DNA chip all can detect the variation of single or multiple Nucleotide in a certain nucleotide sequence easily.A kind of preferred detection method is to detect whether the coding region exists Nucleotide to change among the JQF (comprising cDNA sequence and genome sequence), for example among the SEQ ID NO:1 505 Nucleotide whether by G → A.
Along with the discovery of JQF, can adopt transgenic technology in cell, to express corresponding protein, and then by patch clamp or voltage clamp technical study atrial fibrillation electricity physiology.Also can pass through homologous recombination method and embryonic stem cell approach or gene microinjection, set up the heredity Animal models of atrial fibrillation, then by research atrial fibrillation electricity physiology such as polygraphs.This electricity physiological foundation may just be one of the electrophysiological mechanism of non-atrial fibrillation morbidity of using the heredity decision or link.
On transgenic cell model and rotation thing cell model, can directly screen atrial fibrillation new drug lead compound by electrophysiological technique.
Can infer the proteins encoded space structure by computer, for the board design of atrial fibrillation new drug provides the basis.
Pathogenetic the illustrating of human auricular fibrillation of heredity decision is expected to study other type human auricular fibrillation from new visual angle (ionic channel), facilitates the research of all types human auricular fibrillation to make a breakthrough.
The excavation and the optimization of the new drug of the human auricular fibrillation of heredity decision may facilitate the research of all types human auricular fibrillation to make a breakthrough.
Utilize albumen of the present invention,, can filter out with JQF albumen interactional material takes place, as acceptor, inhibitor, agonist or antagonist etc. by various conventional screening methods.
Albumen of the present invention and antibody thereof, inhibitor, agonist, antagonist or acceptor etc. when using (administration) in treatment, can provide different effects.Usually, can these materials are formulated in nontoxic, inert and the pharmaceutically acceptable aqueous carrier medium, wherein pH is about 5-8 usually, and preferably pH is about 6-8, although the pH value can be with being changed to some extent by preparation Substance Properties and illness to be treated.The pharmaceutical composition for preparing can carry out administration by conventional route, comprising (but being not limited to): intramuscular, intraperitoneal, intravenously, subcutaneous or topical.
The present invention also provides a kind of pharmaceutical composition, and it contains wild-type KCNJ2 polypeptide and the pharmaceutically acceptable carrier or the vehicle of safe and effective amount.This class carrier comprises (but being not limited to): salt solution, damping fluid, glucose, water, glycerine, ethanol and combination thereof.Pharmaceutical preparation should be complementary with administering mode.Pharmaceutical composition of the present invention can be made into the injection form, for example is prepared by ordinary method with the physiological saline or the aqueous solution that contains glucose and other assistant agents.Pharmaceutical composition such as tablet and capsule can be prepared by ordinary method.Pharmaceutical composition such as injection, solution, tablet and capsule should be made under aseptic condition.The dosage of activeconstituents is the treatment significant quantity, for example every day about 1 microgram/kg body weight-Yue 5 mg/kg body weight.In addition, polypeptide of the present invention also can use with the other treatment agent.
When making pharmaceutical composition, be that wild-type KCNJ2 albumen with safe and effective amount is applied to Mammals, wherein this safe and effective amount is usually at least about 1 microgram/kg body weight, and in most of the cases be no more than about 5 mg/kg body weight, preferably this dosage is about 10 micrograms/kg body weight-Yue 1 mg/kg body weight.Certainly, concrete dosage also should be considered factors such as route of administration, patient health situation, and these all are within the skilled practitioners skill.
Based on the present invention, derive from viral expression vector such as retrovirus, adenovirus, adeno-associated virus (AAV), hsv, parvovirus etc. and can be used for wild-type KCNJ2 is transferred in the cell.The method that structure carries the recombinant viral vector of wild-type KCNJ2 is found in existing document (Sambrook, et al.).KCNJ2 can be packaged in the liposome in addition, and then is transferred in the cell.
Polynucleotide imports tissue or intracellular method comprises: directly be injected into polynucleotide in the in-vivo tissue; Or external by carrier (as virus, phage or plasmid etc.) earlier with the polynucleotide transfered cell in, again cell is transplanted in the body etc.
Can be incorporated into the rondom polypeptide storehouse that solid formation forms by the various amino acid that may make up by screening with the protein bound peptide molecule of people JQF obtains.During screening, must carry out mark to people JQF protein molecular.
The invention still further relates to the diagnostic testing process of quantitative and detection and localization people JQF protein level.These tests are known in the art, and comprise that FISH measures and radioimmunoassay.The people JQF protein level that is detected in the test can be with laying down a definition the importance of people JQF albumen in various diseases and be used to the disease of diagnosing JQF albumen to work.
Whether having the proteic method of JQF in a kind of detection test sample is to utilize the proteic specific antibody of JQF to detect, and it comprises: sample is contacted with the JQF protein specific antibody; Observe whether form antibody complex, formed antibody complex and just represented to exist in the sample JQF albumen.
The proteic polynucleotide of JQF can be used for diagnosis and the treatment of JQF protein related diseases (after one's own heart atrial fibrillation is moving).A kind of method is to detect the sudden change of JQF, with diagnosis atrial fibrillation disease or atrial fibrillation susceptibility.The form of JQF protein mutation comprises that other point mutation of comparing with wild-type KCNJ2 dna sequence dna, transposition, disappearance, reorganization and other are any unusual etc., especially is arranged in the exon mutant form.Available existing technology such as Southern blotting, dna sequence analysis, PCR and in situ hybridization detect sudden change.In addition, sudden change might influence proteic expression, therefore can judge indirectly that with Northern blotting, Western blotting gene has or not sudden change.In addition, part or all of polynucleotide of the present invention can be used as probe stationary on microarray (microarray) or DNA chip (being called " gene chip " again), is used for gene diagnosis.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
The identification of JQF
The strategy of the identification JQF of Cai Yonging is in the present embodiment: (1) studies show that potassium channel may be relevant with atrial fibrillation; (2) suppose that the main potassium channel gene sudden change in the cardiac muscle may be relevant with the familial atrial fibrillation; Whether (3) detect potassium channel gene undergos mutation in the atrial fibrillation family; (4) further get rid of the possibility that must the above normally random individual of quantity has same transgenation; (5) carry out the mutant functional analysis with patch clamp, finally establish this human auricular fibrillation pathogene.
In the present embodiment, determine that according to above-mentioned strategy the step of identification JQF is: (1) according to ARR mechanism, determine may be relevant with the familial atrial fibrillation candidate gene; (2) in the atrial fibrillation family, candidate gene is carried out examination; (3) with patch clamp the mutant that examination goes out is carried out functional analysis, finally determine human auricular fibrillation pathogene.Detailed process is as follows:
In the present embodiment, analyzed the exon of a kind of inward rectifyimg potassium channel kir2.1 gene-KCNJ2.According to the KCNJ2 gene order, use Primer3 software design exon primer.Primer sequence is as shown in table 1:
Table 1 primer sequence
| The forward direction primer | Reverse primer |
| tcagtagacagaccttggtagaacc(SEQ ID NO：3) | gtgacacatctgaaaccatagcc(SEQ ID NO：4) |
| tcttctccattgagacccagac(SEQ ID NO：5) | ctagataagagctacggcactgtgt(SEQ ID NO：6) |
| tatttctggtgtccccaatcac(SEQ ID NO：7) | gtataactgttttgggcctctgac(SEQ ID NO：8) |
Adopt conventional PCR reaction system, it mainly contains following composition:
| Required reagent | The reagent starting point concentration | The system final concentration |
| Damping fluid (Mg 2+Plus) dNTP primer Taq polysaccharase template (extractive genomic dna) | 10× 10uM 20mM 5U/ul 100ng/ | 1× 0.2uM 0.2uM 0.03-0.05U/ul 10ng/ul |
The cumulative volume of reaction is 25ul, uses ddH
2O supplies volume.
To add excellent thin-walled PCR pipe and put into the enterprising performing PCR reaction of PTC-220 thermal cycler.The PCR reaction conditions: pre-95 ℃ of 15min of sex change, 94 ℃ of 30s of sex change subsequently, the 64 ℃ of 45s that anneal extend 72 ℃ of 1min, and 72 ℃ of 8min are extended in totally 35 circulations at last.Get the PCR product, electrophoresis in 1% sepharose that contains 0.5 μ g/ μ l ethidium bromide confirms expanding effect.The purpose fragment of pcr amplification is used DYEnamic behind electrophoresis evaluation and purifying
TMET dye terminator kit (Amershan Biosciences) carries out two-way sequencing reaction.The sequencing reaction condition: 95 ℃ of sex change 20s, 50 ℃ of annealing 15s, 60 ℃ are extended 1min, 25 circulations.Product carries out nucleotide sequencing at the MegaBACE500 automatic sequencer behind Ammoniom-Acetate, ethanol sedimentation purifying.Sequencing result is analyzed comprehensive positive and negative two-way sequence results identification sudden change by Sequence analyzer software and naked eyes.
Analyze through sequencing result and " genotype-phenotype ", there is pathogenic mutation in tentative confirmation KCNJ2 gene, and the sudden change relevant especially with atrial fibrillation (Fig. 1, arrow place are KCNJ2 transgenation point) of the 505th of KCNJ2.Afterwards, in the normal healthy controls of 288 routine consanguinity-less relations, do not find 505 G → A sudden change of KCNJ2.Functional study shows that the V93I sudden change of KCNJ2 causes " the function acquisition " of KCNQ1-KCNJ2 uniqueness to sexually revise, and determines that finally JQF gene or its coded protein can cause human auricular fibrillation.
The JQF gene has nucleotide sequence shown in the SEQ ID NO.1, and wherein open reading frame is positioned at 229-1509, and its proteins encoded has the described aminoacid sequence of SEQ ID NO:2.
(Genbank accession number AF153819) compares with proteins encoded with normal wild-type KCNJ2 gene, and there be following the variation in JQF gene and albumen: Nucleotide 505 is by G → A among the SEQ ID NO:1, and 93 amino acids are by V → I among the SEQ ID NO:2.
Discuss
Fig. 2 situation that developed the color with family of JQF.
The clinical characters of these familys is as follows:
Table 1 atrial fibrillation family situation (
+Be age at death, is the present age)
| The family member | Sex | Age | Make a definite diagnosis the age | Palpitaition repeatedly | The atrial fibrillation type |
| I-1 II-2 II-3 II-6 III-2 III-3 III-6 | Men and women woman man man | 82 + 56 + 59 56 57 42 33 | 58 50 54 50 57 is unknown | + + + + - - - | Continuation continuation paroxysmal paroxysmal paroxysmal is unknown |
Be not all KCNJ2V93I sudden change persons all show atrial fibrillation (as III-3, III-6), explanation reasons is as follows:
(1), that these carry sudden change person is also young relatively, and the atrial fibrillation pilosity is born in the older;
(2), the paroxysmal atrial fibrillation is accidental takes place, the time length is short, records surely though there is generation also to differ sometimes;
(3), KCNJ2V93I sudden change nonpenetrance in the familial atrial fibrillation;
(4), KCNJ2V93I sudden change only is the easy trouble factor of familial atrial fibrillation, environmental factors tool in the generation of atrial fibrillation has certain effect.
The foundation of heredity Animal models of atrial fibrillation
Adopt people's KCNJ2 cDNA probe scanning 129Sv mouse genomic library, clone mouse genome KCNJ2 gene.After PCR, restriction enzyme mapping analysis and shotgun sequencing confirm, select the fragment that is positioned at mouse KCNJ2 upstream and downstream, after containing nucleotide sequence shown in the SEQ ID NO:1 and neomycin resistance gene and TK gene and connecting, homologous recombination is in mouse KCNJ2 gene locus specifically.Make the ES cell of transfection can carry out dual medicament selection (G418 and Gancyclvir), the scope of the ES cell clone of screening homologous recombination is dwindled.The ES cell clone that is obtained confirms the homologous recombination that it is correct through PCR and Southern engram analysis, and is expelled to after karyotyping in the blastocyst (blastocysts) of C57BL/6 strain mouse, the blastocyst of injection is implanted in the acceptor Mouse Uterus again.Filter out the mosaic (chimera) of newborn mice, then with itself and normal mouse mating, to obtain heterozygote through sexual cell heredity.The mutual mating of heterozygote obtains the homozygote animal that JQF imports (knock-in).
Mosaic, heterozygote and homozygote animal that JQF imports are compared with normal homology mouse, aspect the electric physiology, any difference of occurring on whole animal level, cell levels and the molecular level, one is verified, can be considered the phenotype that gene imports, concrete research method is taked appropriate means studied with the difference of apparent motion thing phenotype.Generally speaking, research method mainly contains two aspects, and the one, JQF imports the generation of mouse; The 2nd, the analysis of animal phenotype.
Embodiment 3
The preparation of JQF proteins encoded and purification
In this embodiment, the JQF sequence of total length or fragment are built into commercial protein merge among the expression vector, in intestinal bacteria, carry out prokaryotic expression with the form of gst fusion protein, and purification of recombinant proteins.
(1) construction of prokaryotic expression vector, and transformed into escherichia coli
According to JQF proteins encoded complete encoding sequence (SEQ ID NO:1), design amplifies complete coding and reads the primer of frame (correspond respectively to encoding sequence 5 ' and about 20 above Nucleotide of 3 ' end), and on positive anti-primer, introduce restriction endonuclease sites (this decides according to the pGEX-2T carrier of selecting for use) respectively, so that construction of expression vector.With the JQF amplified production that obtains among the embodiment 1 is template, behind pcr amplification, with JQF guarantee to read be cloned under the correct prerequisite of frame the pGEX-2T carrier (Pharmacia, Piscataway, NJ).Identify that good expression vector utilizes CaCl
2Method changes bacillus coli DH 5 alpha over to, and Screening and Identification obtains containing the engineering bacteria DH5 α-pGEX-2T-JQF of pGEX-2T-JQF expression vector.
(2) isolation identification of the engineering bacteria of expression GST-JQF recombinant protein
DH5 α-pGEX-2T-JQF the engineering bacteria of picking list bacterium colony contains jolting overnight incubation in the LB substratum of 100 μ g/ml penbritins in 3ml, draw nutrient solution by 1: 100 concentration and in new LB substratum (containing 100 μ g/ml penbritins), cultivated about 3 hours, to OD
600After reaching 0.5, adding IPTG continues at 37 ℃ to final concentration 1mmol/L and cultivated respectively 0,1,2,3 hours.It is centrifugal to get the different 1ml bacterium liquid of incubation time, in the bacterial precipitation thing, add lysate (2 * SDS sample-loading buffer, 50 μ l, distilled water 45 μ l, 3-mercaptoethanol 5 μ l), the suspendible bacterial precipitation, boiled in the boiling water bath 5 minutes, centrifugal 1 minute of 10000rpm, supernatant adds electrophoresis in the 12%SDS-PAGE glue.The bacterial strain that the protein content of dyeing back observation expection molecular weight size increases with the IPTG induction time is the engineering bacteria of expressing the GST-JQF fusion rotein.
(3) the extraction purifying of GST-JQF fusion rotein
The proteic engineering bacteria DH5 of abduction delivering GST-JQF amalgamation and expression α-pGEX-2T-JQF as stated above.Bacterium centrifugation after inducing adds the resuspended bacterium of 20ml PBS, ultrasonication bacterium by every 400ml bacterium.The ultrasonic completely liquid of broken bacterium adds 50% saturated Triptide Sepharose 4B of PBS by every milliliter of amount that adds 20 microlitres, 37 ℃ of joltings were in conjunction with 30 minutes, 10000rpm precipitated the Triptide Sepharose 4B that combines GST-JQF in centrifugal 10 minutes, abandoned supernatant.Clean twice by the amount that every milliliter of ultrasonic liquid gained precipitation adds 100 μ l PBS, then add 10 μ l reduced glutathione elutriants by every milliliter of ultrasonic liquid gained precipitation, room temperature was put 10 minutes, centrifugal 10 minutes of 10000rpm, and supernatant is the fusion rotein of wash-out.Repeat twice of wash-out.The supernatant of wash-out is stored in-80 ℃, and carries out the SDS-PAGE electrophoresis, detects purification effect, and the molecular weight of the reorganization JQF fusion rotein of acquisition conforms to estimated molecular weight.
Embodiment 4
JQF proteins encoded or polypeptide carry out eukaryotic cell expression in insect cell
(1) structure of JQF rhabdovirus expression vector and transfection Sf 9 insect cell strain
According to the complete encoding sequence (SEQ ID NO.1) of JQF, design amplifies the primer that complete coding is read frame, and introduces restriction endonuclease sites (this is decided by the carrier of selecting for use) respectively on positive anti-primer, thus construction of expression vector.With JQF cDNA guarantee to be cloned under the prerequisite of reading frame the pVL1392 carrier (Invitrogen, Carlsbad, CA).Identify good expression vector 3 μ g, wild-type linearized baculovirus dna (BaculoGold
TMACMNPV DNA, Pharmingen, San Diego, CA) 1 μ g and Lipofection (Gibco-BRL, NY) 25 μ l add in the insect substratum of 1ml serum-free, the 15 seconds mixings that vibrate, incubated at room 15 minutes is standby.Get 1ml (2 * 10
6) Sf9 insect cell suspension is in 60mm tissue culturing plate, change transfection media after adherent 1 hour, incubated at room was abandoned substratum after 15 minutes, add the dna vector transfection mixture for preparing previously, Parafilm seals culture plate, cultivated 4 hours in 27 ℃ of joltings of room temperature, then change perfect medium and cultivated 3 days, it is standby to collect supernatant.
(2) change the Screening and Identification of the insect cell line of recombinant expression vector over to
The insect cell of transfection after 3 days made cell suspension (2 * 10 with fresh culture
6/ 1ml), get the 1ml cell suspension and place 60mm tissue culture ware, add the 3ml substratum, the culture supernatant that 100 μ l collect, adherent 1 hour, abandon the 2ml substratum, continue incubated at room temperature 1 hour, and discarded all substratum, add the 3ml semisolid medium that contains 20 μ l, 4% X-gal of preheating, cultivate after 5-7 days picking white cell clone and in 96 well culture plates, cultivated 3-5 days, then draw supernatant infection Sf9 insect cell.
Collect the cell that infects and carry out the Western evaluation.The SDS-PAGE electrophoresis will be carried out after the lysis, glue behind the electrophoresis prints to protein transduction on the nitrocellulose membrane in the half-dried electrotransfer instrument of the Multiphor of Pharmacia II, nitrocellulose membrane is placed confining liquid sealing 1 hour, then in the antibody-solutions of anti-JQF proteins encoded, sealed 1 hour, the jolting of TBS liquid is cleaned 5 minutes 2 times totally, then film is placed the anti-second antibody solution jolting of biotin labeled anti-JQF proteins encoded one 1 hour, TBS cleans, adding avidin-alkaline phosphatase enzyme complex reacted 30 minutes, TBS cleans 2 times, adds freshly prepared colour developing liquid colour developing and observes protein band.
The Sf9 cell clone of picking high expression level people JQF.
(3) the JQF proteins encoded extracts purifying
Supernatant with the Sf9 cell clone of high expression level JQF proteins encoded infects the Sf9 cell in a large number, infects collecting cell after 48 hours, the PBS washing.Per 2 * 10
8Cell adds 20ml cell pyrolysis liquid (0.5%TritonX-100,20mM Na
3PO
4(sodium phosphate, pH7.8), 500mM NaCl, 1mM Na
3VO
4(vanadic acid sodium), 1mMPefabloc, 1 μ g/ml pepstatin, leupeptin and aprotinin) broken cell, the centrifugal 20min of 12000 * g removes cell debris, and supernatant is by per 2 * 10
8Cell add 2ml NTA-agarose (Qiagen, Germany), 4 ℃ of absorption 1 hour.Then with containing the His damping fluid washed twice of 100nM imidazoles, with containing 20mM N, N '-two piperazine, 500mM NaCl, the buffer solution elution of 300mM imidazoles is to obtain the albumen of purifying.Elutriant is stored in 4 ℃, and carries out the purity of the JQF proteins encoded of SDS-PAGE electrophoresis detection extraction.According to molecular weight identification JQF proteins encoded.
Embodiment 5
The preparation of anti-JQF proteins encoded antibody
(1) preparation of immune mouse and splenocyte
It is standby that the people JQF albumen that obtains among the embodiment 3 is separated the back with chromatography, also can separate with the SDS-PAGE gel electrophoresis, electrophoretic band is cut off from gel, and with isopyknic complete Freund ' s adjuvant emulsion.Get the female mouse of 6-8 week Balb/C in age, the albumen with 50-100 μ g/0.2ml emulsification carries out peritoneal injection to mouse.After 14 days, with the same antigen of non-complete Freund ' s adjuvant emulsion to mouse with the dosage of 50-100 μ g/0.2ml again booster immunization once be used for after 3-5 days merging.Wherein, the splenocyte preparation, preparation feeder cell and cytogamy are carried out according to a conventional method.
(2) detection of antibodies
After cytogamy 10-15 days, need to check by the hole, in case find vigorous hybrid cell colony growth, the JQF albumen of just should choosing is done the preliminary screening of antibody activity, method commonly used has: immunofluorescent test, emission immunity test (RIA), enzyme linked immunosorbent assay (ELISA).After checking out the hole of antibody activity, clone cultivation at once, and isolate antibody.
Detected result shows that isolated antibody can combine with JQF albumen generation specificity.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table
＜110〉Tongji University
＜120〉atrial fibrillation peccant gene and uses thereof
<130>046555
<160>8
<170>PatentIn version 3.1
<210>1
<211>1512
<212>DNA
＜213〉homo sapiens (Homo sapiens)
<400>1
cttttcttgc aggacatgtt ctctggatgt cagctgagtc attaaagtaa ctctgcatgt 60
cagtagacag accttggtag aaccacaagg ctcccagaga cacccatctc tcctcatttt 120
tttggtgtgt gtgtcttcac cgaacattca aaactgtttc tccaaagcgt tttgcaaaaa 180
ctcagactgt tttccaaagc agaagcactg gagtccccag cagaagcgat gggcagtgtg 240
cgaaccaacc gctacagcat cgtctcttca gaagaagacg gtatgaagtt ggccaccatg 300
gcagttgcaa atggctttgg gaacgggaag agtaaagtcc acacccgaca acagtgcagg 360
agccgctttg tgaagaaaga tggccactgt aatgttcagt tcatcaatgt gggtgagaag 420
gggcaacggt acctcgcaga catcttcacc acgtgtgtgg acattcgctg gcggtggatg 480
ctggttatct tctgcctggc tttcatcctg tcatggctgt tttttggctg tgtgttttgg 540
ttgatagctc tgctccatgg ggacctggat gcatccaaag agggcaaagc ttgtgtgtcc 600
gaggtcaaca gcttcacggc tgccttcctc ttctccattg agacccagac aaccataggc 660
tatggtttca gatgtgtcac ggatgaatgc ccaattgctg ttttcatggt ggtgttccag 720
tcaatcgtgg gctgcatcat cgatgctttc atcattggcg cagtcatggc caagatggca 780
aagccaaaga agagaaacga gactcttgtc ttcagtcaca atgccgtgat tgccatgaga 840
gacggcaagc tgtgtttgat gtggcgagtg ggcaatcttc ggaaaagcca cttggtggaa 900
gctcatgttc gagcacagct cctcaaatcc agaattactt ctgaagggga gtatatccct 960
ctggatcaaa tagacatcaa tgttgggttt gacagtggaa tcgatcgtat atttctggtg 1020
tccccaatca ctatagtcca tgaaatagat gaagacagtc ctttatatga tttgagtaaa 1080
caggacattg acaacgcaga ctttgaaatc gtggtcatac tggaaggcat ggtggaagcc 1140
actgccatga cgacacagtg ccgtagctct tatctagcaa atgaaatcct gtggggccac 1200
cgctatgagc ctgtgctctt tgaagagaag cactactaca aagtggacta ttccaggttc 1260
cacaaaactt acgaagtccc caacactccc ctttgtagtg ccagagactt agcagaaaag 1320
aaatatatcc tctcaaatgc aaattcattt tgctatgaaa atgaagttgc cctcacaagc 1380
aaagaggaag acgacagtga aaatggagtt ccagaaagca ctagtacgga cacgccccct 1440
gacatagacc ttcacaacca ggcaagtgta cctctagagc ccaggccctt acggcgagag 1500
tcggagatat ga 1512
<210>2
<211>427
<212>PRT
＜213〉homo sapiens (Homo sapiens)
<400>2
Met Gly Ser Val Arg Thr Asn Arg Tyr Ser Ile Val Ser Ser Glu Glu
1 5 10 15
Asp Gly Met Lys Leu Ala Thr Met Ala Val Ala Asn Gly Phe Gly Asn
20 25 30
Gly Lys Ser Lys Val His Thr Arg Gln Gln Cys Arg Ser Arg Phe Val
35 40 45
Lys Lys Asp Gly His Cys Asn Val Gln Phe Ile Ash Val Gly Glu Lys
50 55 60
Gly Gln Arg Tyr Leu Ala Asp Ile Phe Thr Thr Cys Val Asp Ile Arg
65 70 75 80
Trp Arg Trp Met Leu Val Ile Phe Cys Leu Ala Phe Ile Leu Ser Trp
85 90 95
Leu Phe Phe Gly Cys Val Phe Trp Leu Ile Ala Leu Leu His Gly Asp
100 105 110
Leu Asp Ala Ser Lys Glu Gly Lys Ala Cys Val Ser Glu Val Asn Ser
115 120 125
Phe Thr Ala Ala Phe Leu Phe Ser Ile Glu Thr Gln Thr Thr Ile Gly
130 135 140
Tyr Gly Phe Arg Cys Val Thr Asp Glu Cys Pro Ile Ala Val Phe Met
145 150 155 160
Val Val Phe Gln Ser Ile Val Gly Cys Ile Ile Asp Ala Phe Ile Ile
165 170 175
Gly Ala Val Met Ala Lys Met Ala Lys Pro Lys Lys Arg Asn Glu Thr
180 185 190
Leu Val Phe Ser His Asn Ala Val Ile Ala Met Arg Asp Gly Lys Leu
195 200 205
Cys Leu Met Trp Arg Val Gly Asn Leu Arg Lys Ser His Leu Val Glu
210 215 220
Ala His Val Arg Ala Gln Leu Leu Lys Ser Arg Ile Thr Ser Glu Gly
225 230 235 240
Glu Tyr Ile Pro Leu Asp Gln Ile Asp Ile Asn Val Gly Phe Asp Ser
245 250 255
Gly Ile Asp Arg Ile Phe Leu Val Ser Pro Ile Thr Ile Val His Glu
260 265 270
Ile Asp Glu Asp Ser Pro Leu Tyr Asp Leu Ser Lys Gln Asp Ile Asp
275 280 285
Asn Ala Asp Phe Glu Ile Val Val Ile Leu Glu Gly Met Val Glu Ala
290 295 300
Thr Ala Met Thr Thr Gln Cys Arg Ser Ser Tyr Leu Ala Asn Glu Ile
305 310 315 320
Leu Trp Gly His Arg Tyr Glu Pro Val Leu Phe Glu Glu Lys His Tyr
325 330 335
Tyr Lys Val Asp Tyr Ser Arg Phe His Lys Thr Tyr Glu Val Pro Asn
340 345 350
Thr Pro Leu Cys Ser Ala Arg Asp Leu Ala Glu Lys Lys Tyr Ile Leu
355 360 365
Ser Asn Ala Asn Ser Phe Cys Tyr Glu Asn Glu Val Ala Leu Thr Ser
370 375 380
Lys Glu Glu Asp Asp Ser Glu Asn Gly Val Pro Glu Ser Thr Ser Thr
385 390 395 400
Asp Thr Pro Pro Asp Ile Asp Leu His Asn Gln Ala Ser Val Pro Leu
405 410 415
Glu Pro Arg Pro Leu Arg Arg Glu Ser Glu Ile
420 425
<210>3
<211>25
<212>DNA
＜213〉homo sapiens (Homo sapiens)
<400>3
tcagtagaca gaccttggta gaacc 25
<210>4
<211>23
<212>DNA
＜213〉homo sapiens (Homo sapiens)
<400>4
gtgacacatc tgaaaccata gcc 23
<210>5
<211>22
<212>DNA
＜213〉homo sapiens (Homo sapiens)
<400>5
tcttctccat tgagacccag ac 22
<210>6
<211>25
<212>DNA
＜213〉homo sapiens (Homo sapiens)
<400>6
ctagataaga gctacggcac tgtgt 25
<210>7
<211>22
<212>DNA
＜213〉homo sapiens (Homo sapiens)
<400>7
tatttctggt gtccccaatc ac 22
<210>8
<211>24
<212>DNA
＜213〉homo sapiens (Homo sapiens)
<400>8
gtataactgt tttgggcctc tgac 24
Claims (10)
1. isolating JQF polypeptide is characterized in that it is selected from down group:
Polypeptide with aminoacid sequence shown in the SEQ ID NO:2,
Or it contains conservative property variation polypeptide or its active fragments or its reactive derivative of aminoacid sequence CVDIRWRWMLVIFCLAFILSWLFFGCVFWLIALLHG.
2. polypeptide as claimed in claim 1 is characterized in that, this polypeptide is the polypeptide with aminoacid sequence shown in the SEQ ID NO:2.
3. isolating polynucleotide is characterized in that, it comprises a nucleotide sequence, and this nucleotide sequence is selected from down group:
(a) polynucleotide of polypeptide as claimed in claim 1 or 2 of encoding;
(b) with (a) described in polynucleotide complementary polynucleotide.
4. polynucleotide as claimed in claim 3 is characterized in that, these polynucleotide contain the nucleotide sequence that is selected from down group:
(1) coding has the polynucleotide of the polypeptide of aminoacid sequence shown in the SEQ ID NO:2;
(2) nucleotide sequence of 1-1512 position among the SEQ ID NO:1;
(3) nucleotide sequence of 229-1509 position among the SEQ ID NO:1;
5. a carrier is characterized in that, it contains the described polynucleotide of claim 3.
6. a genetically engineered host cell is characterized in that, the host cell that it is transformed or transduce by the described carrier of claim 5.
7. a method for preparing people JQF polypeptide is characterized in that, this method comprises:
(a) under the condition that is fit to expressing protein, cultivate the described host cell of claim 6;
(b) from culture, isolate people JQF polypeptide.
8. energy and the described people JQF of claim 1 protein-specific bonded antibody.
9. test kit that detects atrial fibrillation is characterized in that it comprises:
(1) primer of specific amplification people JQF is right,
(2) be used to detect amplified production and compare the reagent that whether exists variation required with wild-type KCNJ2.
10. method that the animal for preparing heredity atrial fibrillation is touched type, described animal is inhuman Mammals, it is characterized in that, the method comprising the steps of:
(a) change a kind of genetic constructs over to zooblast, described genetic constructs comprises 5 ' homology arm and 3 ' homology arm, and marker gene and the sudden change element of introducing the JQF exon between homology arm for screening, described sudden change element is the nucleotide sequence of coding CVDIRWRWMLVIFCLAFILSWLFFGCVFWLIALLHG, and described 5 ' homology arm and the same respectively nucleotide sequence that comes from the sudden change element upstream and downstream of people JQF exon in the genome of 3 ' homology arm;
(b), obtain the zooblast that genome conformity goes into to have the sudden change element by homologous recombination;
(c) the zooblast regeneration from step (b) obtains transgenic animal.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200410066265 CN1746187A (en) | 2004-09-10 | 2004-09-10 | Atrial fibrillation peccant gene and uses thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200410066265 CN1746187A (en) | 2004-09-10 | 2004-09-10 | Atrial fibrillation peccant gene and uses thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1746187A true CN1746187A (en) | 2006-03-15 |
Family
ID=36165927
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200410066265 Pending CN1746187A (en) | 2004-09-10 | 2004-09-10 | Atrial fibrillation peccant gene and uses thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1746187A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10081846B2 (en) | 2014-02-06 | 2018-09-25 | Nippon Steel & Sumitomo Metal Corporation | Steel wire |
-
2004
- 2004-09-10 CN CN 200410066265 patent/CN1746187A/en active Pending
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10081846B2 (en) | 2014-02-06 | 2018-09-25 | Nippon Steel & Sumitomo Metal Corporation | Steel wire |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1258317A (en) | Process for expression of genes of dengue viruses | |
| CN1746187A (en) | Atrial fibrillation peccant gene and uses thereof | |
| CN1194012C (en) | Sperm formation relative protein and its coding sequence and use | |
| CN1948335A (en) | Candida albicans mycellium regulating and controlling factor gene and its use | |
| CN1244595C (en) | Tumor suppressor protein and its application | |
| CN1234728C (en) | Novel human lymphokine, its coding sequence and use | |
| CN1209369C (en) | Cell death inducing protein and its coding sequence and use | |
| CN1746186A (en) | Atrial fibrillation peccant gene and uses thereof | |
| CN1216910C (en) | Novel liver regeneration related protein, its code sequence and application | |
| CN1281622C (en) | Excreted proteins as indicators related to tumor and application | |
| CN1510139A (en) | Human auricular fibrillation pathogenic gene, encoding protein and use thereof | |
| CN1670197A (en) | Arginase of Japanese blood fluke, its coding nucleic acid and application | |
| CN1257271C (en) | Serine proteinase and coded sequence thereof | |
| CN1289524C (en) | Human telomerase active inhibitor protein and use thereof | |
| CN1281962C (en) | Tumor relevant secretory protein as a liver cancer marker and uses thereof | |
| CN1948334A (en) | Candida albicans cell wall adhesion factor gene and its use | |
| CN1390852A (en) | Human auricular fibrillation pathogene and coding protein and its usage | |
| CN1169832C (en) | Identification and function research of gene p28-II | |
| CN1238379C (en) | New osteoclast formation inhibiting factor and its coding sequence and use | |
| CN1267727A (en) | New human phosphorylated zymoprotein of pyruvate dehydrogenase and its code sequence | |
| CN1724664A (en) | Human HOLF 402 protein and its coding sequence | |
| CN1272540A (en) | Human immune factor related protein and its coded sequence | |
| CN1271007A (en) | New human chitinase protein and its code sequence | |
| CN1670204A (en) | Autolytic enzyme of streptococcus pneumoniae, its coding nucleic acid and application | |
| CN1618806A (en) | Liver cancer inhibition factor and its coding sequence and use |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Open date: 20060315 |