CN1618806A - Liver cancer inhibition factor and its coding sequence and use - Google Patents
Liver cancer inhibition factor and its coding sequence and use Download PDFInfo
- Publication number
- CN1618806A CN1618806A CN 200310108761 CN200310108761A CN1618806A CN 1618806 A CN1618806 A CN 1618806A CN 200310108761 CN200310108761 CN 200310108761 CN 200310108761 A CN200310108761 A CN 200310108761A CN 1618806 A CN1618806 A CN 1618806A
- Authority
- CN
- China
- Prior art keywords
- hccs17
- polypeptide
- sequence
- people
- polynucleotide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
Abstract
A novel liver cancer inhibiting factor-HCCS17 protein for suppressing growth of liver cancer cells, the polynucleotide for coding it, the process for preparing said protein by recombination, and the application of said polynucleotide are disclosed.
Description
Technical field
The invention belongs to biological technical field, specifically, the people's liver cancer supressor that the present invention relates in people's liver, to express (Hepatocellular Carcinoma Suppressor 17, HCCS17) and encoding sequence.The invention still further relates to the method for making and the purposes of this HCCS17 polypeptide and polynucleotide.
Background technology
Hepatocellular carcinoma (Hepatocellular carcinoma, generation development HCC) is a complex process that relates to multiple genetic material change, it relates to oncogene N-ras at least, C-myc, cancer suppressor gene p53 and Rb's is unusual.Losing of specific chromosomal region often takes place in malignant tumour, promptly the heterozygosity disappearance (loss ofheterozygosity, LOH).Multinomial studies show that at karyomit(e) 17p, 9p21～p23,4q, 16q21～q23.3,13q, 8p21～p23,6q24～q27 common allele lost, and 1q, 17q, 8q24 common allele increase.Xu etc. utilize CGH and MSA technology 22 unbalance researchs of euchromosome allelotrope to the hepatocellular carcinoma tissue, find that cancerous tissue is at karyomit(e) 1q, 8q, there is amplification region in 13q, and at karyomit(e) 4q, there are the LOH zone in 8p, 16q, 17p, and (Proc Natl Acad Sci U S is Dec 18 A.2001; 98 (26): 15089-94.).Wherein karyomit(e) 17p's is one of modal lost regions, is 49% (Histol Histopathol.1997Oct; 12 (4): 1019-25).
The sudden change of p53 is found in up in the people's cancer more than 50%, and it is that human the evil given birth to modal gene alteration in the tumour.P53 assignment of genes gene mapping 17p13.3, i.e. the LOH zone of HCC.Discover that there is sudden change (the J Gastroenterol Hepatol.1997 Oct of p53 in 32.8% HCC case for one; 12 (9-10): S309-13).The product of p53 gene is regulated cell cycle and apoptosis.The DNA that the mutagenesis factor causes destroys, and induces p53 rapidly, and the inhibition p21 of its activation plain kinases of dependence cycle (cdk) transcribes.The p53 product can hinder the cell cycle of continuing in the G1 phase, and suppresses dna replication dna in conjunction with the anti-strain of proliferating cell nuclear (PCNA), makes destructive DNA that the time of reparation be arranged before duplicating.If can not, it can also cause apoptosis, removes the cell that carries sudden change.There is the p53 product of sudden change then to lose the DNA destruction ability of cell cycle pause afterwards, causes the increase of mutation frequency, and the unstable of cellular genome.The unstable of the group of this gene is a kind of common thing feature of cancer cells, and it can work to oncogene and the further accumulation that changes of cancer suppressor gene in tumour progression.The tumour cell that lacks p53 can not apoptosis, has kept the existence of tumour cell, also can increase chemotherapeutics and radiocurable resistance and resistivity.The p53 inactivation has been explained the p53 sudden change of human malignancies high frequency to these effects of tumour cell existence.
People such as Zhao Xintai carried out karyomit(e) 17p13.3 district's gene clone and with the research of liver cancer dependency, successfully be cloned into liver cancer supressor 1 (Hepatocellular Carcinoma Suppressor 1).Expression in 33 parts of liver cancer samples is starkly lower than cancer beside organism, detects less than genetic expression in 14 parts of cancerous tissues wherein.There is gene to change in 13 parts of liver cancer samples, includes the disappearance of point mutation and various ways.Import this gene in liver cancer cell and inoculate nude mice, with control group relatively, can obviously suppress tumour cell in the effect of the intravital one-tenth knurl of nude mice, illustrate that this gene has cytostatic function (Cancer Res.2001 Oct 15; 61 (20): 7383-7).
Because the liver cancer supressor is for the detection of liver cancer and treat most importantly, so this area presses for exploitation and separates all liver cancer supressors.
Summary of the invention
The purpose of this invention is to provide a kind of new people's liver cancer supressor HCCS17 albumen with and fragment, analogue and derivative.
Another object of the present invention provides the polynucleotide of these polypeptide of coding.
Another object of the present invention provides the method for these polypeptide of production and the purposes of this polypeptide and encoding sequence.
In a first aspect of the present invention, novel isolated HCCS17 polypeptide is provided, it comprises: polypeptide or its conservative property variation polypeptide or its active fragments or its reactive derivative with SEQIDNO:2 aminoacid sequence.
Preferably, this polypeptide is selected from down group:
(a) has the polypeptide of SEQ ID NO:2 aminoacid sequence;
(b) SEQ ID NO:2 aminoacid sequence is formed through replacement, disappearance or the interpolation of one or more amino-acid residues, and have the function that suppresses liver cancer cell growth by (a) polypeptides derived.
More preferably, this polypeptide is the polypeptide with SEQ ID NO:2 aminoacid sequence.
In a second aspect of the present invention, the polynucleotide of isolating these polypeptide of coding are provided, these polynucleotide comprise a nucleotide sequence, and this nucleotide sequence is shown at least 70% homogeny with a kind of nucleotides sequence that is selected from down group: (a) polynucleotide of the above-mentioned people HCCS17 polypeptide of coding; (b) with polynucleotide (a) complementary polynucleotide.Preferably, this polynucleotide encoding has the polypeptide of aminoacid sequence shown in SEQ ID NO:2 or 3.More preferably, the sequence of these polynucleotide is be selected from down group a kind of: the sequence that (a) has 479-958 position among the SEQID NO:1; (b) has the sequence of 1-3122 position among the SEQ ID NO:1.
In a third aspect of the present invention, the carrier that contains above-mentioned polynucleotide is provided, and has been transformed or host cell of transduceing or the host cell that is directly transformed or transduce by above-mentioned polynucleotide by this carrier.
In a fourth aspect of the present invention, provide preparation to have the method for the polypeptide of people HCCS17 protein-active, this method comprises: (a) under the proteic condition of suitable expressing human HCCS17, cultivate the above-mentioned host cell that is transformed or transduce; (b) from culture, isolate polypeptide with people HCCS17 protein-active.
In a fifth aspect of the present invention, provide and above-mentioned people HCCS17 polypeptid specificity bonded antibody.
In a sixth aspect of the present invention, the compound of simulation, promotion, antagonism people HCCS17 polypeptide active is provided, and the compound that suppresses people HCCS17 polypeptide expression.The method of screening and/or prepare these compounds also is provided.Preferably, this compound is encoding sequence or its segmental antisense sequences of people HCCS17 polypeptide.
In a seventh aspect of the present invention, provide and whether had the proteic method of HCCS17 in the test sample, it comprises: sample is contacted with the proteic specific antibody of HCCS17, observe whether form antibody complex, formed antibody complex and just represented to exist in the sample HCCS17 albumen.
In a eighth aspect of the present invention, a kind of method that detects liver cancer or liver cancer susceptibility is provided, this method comprises: whether have insertion, disappearance and replacement mutation in the nucleotide sequence of detection coding HCCS17 polypeptide, preferably these sudden changes have caused amino acid whose change.
In a ninth aspect of the present invention, provide the purposes of polypeptide of the present invention and encoding sequence.Polypeptide for example of the present invention can be used to screen the agonist that promotes people HCCS17 polypeptide active, and perhaps screening suppresses the antagonist of people HCCS17 polypeptide active or is used to the peptide finger print identification.The proteic encoding sequence of people HCCS17 of the present invention or its fragment can be used as primer and be used for pcr amplification reaction, perhaps are used for hybridization as probe, perhaps are used to make gene chip or microarray.
In a tenth aspect of the present invention, a kind of pharmaceutical composition is provided, it contains people HCCS17 polypeptide of the present invention or its agonist, antagonist and the pharmaceutically acceptable carrier of safe and effective amount.These pharmaceutical compositions can be treated illnesss such as liver cancer.
Others of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.
Description of drawings
Following accompanying drawing is used to illustrate specific embodiments of the present invention, and is not used in qualification by the scope of the invention that claims defined.
Fig. 1 is that the homology of people HCCS17 of the present invention and house mouse (Mus musculus) HCCS17 gene nucleic acid sequence (GenBank Accession No.AK078505) compares (FASTA) figure.Wherein, identical Nucleotide marks with " | ".
Fig. 2 is that the homology of people HCCS17 albumen of the present invention and the proteic aminoacid sequence of house mouse HCCS17 (SwissProt Accession No.BAC37312.1) compares (FASTA) figure.Wherein, identical amino acid marks with the amino acid monocase between two sequences, and similar amino acid marks with "+".
Embodiment
The inventor has isolated people's HCCS17 albumen first, and shows that it detects less than genetic expression or gene have various sudden changes in liver cancer tissue.Finished the present invention on this basis.
In the present invention, term " HCCS17 albumen ", " HCCS17 polypeptide " or " liver cancer supressor HCCS17 " are used interchangeably, and all refer to have the albumen or the polypeptide of people's liver cancer supressor HCCS17 aminoacid sequence (SEQ ID NO:2).They comprise the liver cancer supressor HCCS17 that contains or do not contain initial methionine.
As used herein, " isolating " is meant that material separates (if natural substance, primal environment promptly is a natural surroundings) from its primal environment.Do not have separation and purification as polynucleotide under the native state in the active somatic cell and polypeptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then for separation and purification.
As used herein, " isolating HCCS17 albumen or polypeptide " is meant that the HCCS17 polypeptide is substantially free of natural relative other albumen, lipid, carbohydrate or other material.Those skilled in the art can use the purified technology of protein purifying HCCS17 albumen of standard.Basically pure polypeptide can produce single master tape on non-reduced polyacrylamide gel.The purity of HCCS17 polypeptide can be used amino acid sequence analysis.
Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic polypeptide, preferred recombinant polypeptide.Polypeptide of the present invention can be the product of natural purifying, or the product of chemosynthesis, or uses recombinant technology to produce from protokaryon or eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell).The host used according to the recombinant production scheme, polypeptide of the present invention can be glycosylated, maybe can be nonglycosylated.Polypeptide of the present invention also can comprise or not comprise initial methionine residues.
The present invention also comprises the proteic fragment of people HCCS17, derivative and analogue.As used herein, term " fragment ", " derivative " are meant with " analogue " and keep identical biological function of natural human HCCS17 albumen of the present invention or active polypeptide basically.Polypeptide fragment of the present invention, derivative or analogue can be that (i) has one or more conservative or substituted polypeptide of non-conservation amino-acid residue (preferred conservative amino acid residue), and the amino-acid residue of such replacement can be also can not encoded by genetic code, or (ii) in one or more amino-acid residues, has a polypeptide of substituted radical, or (iii) mature polypeptide and another compound (such as the compound that prolongs the polypeptide transformation period, polyoxyethylene glycol for example) merges formed polypeptide, or (iv) additional aminoacid sequence is fused to this peptide sequence and the polypeptide that forms (as leader sequence or secretion sequence or be used for the sequence or the proteinogen sequence of this polypeptide of purifying, or with the fusion rotein of the segmental formation of antigen I gG).According to the instruction of this paper, these fragments, derivative and analogue belong to the known scope of those skilled in the art.
In the present invention, term " people HCCS17 polypeptide " refers to have the SEQ ID NO:2 polypeptide of sequence of people HCCS17 protein-active.This term also comprises having and variant form people HCCS17 albumen identical function, SEQ ID NO:2 sequence.These variant forms comprise (but being not limited to): one or more (it is individual to be generally 1-50, preferably 1-30, more preferably 1-20,1-10 best) amino acid whose disappearance, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally in 20, preferably being in 10, more preferably is in 5) amino acid.For example, in the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic function usually.This term also comprises proteic active fragments of people HCCS17 and reactive derivative.
The variant form of this polypeptide comprises: homologous sequence, conservative property varient, allelic variant, natural mutation, induced mutation body, under high or low tight degree condition can with the coded albumen of the DNA of people HCCS17 DNA hybridization and the polypeptide or the albumen that utilize the antiserum(antisera) of anti-people HCCS17 polypeptide to obtain.The present invention also provides other polypeptide, as comprises people HCCS17 polypeptide or its segmental fusion rotein (fusion rotein shown in SEQ ID NO:3).Except the polypeptide of total length almost, the present invention has also comprised the soluble fragments of people HCCS17 polypeptide.Usually, this fragment have people HCCS17 peptide sequence at least about 10 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, best at least about 100 continuous amino acids.
Invention also provides the analogue of people HCCS17 albumen or polypeptide.The difference of these analogues and natural human HCCS17 polypeptide can be the difference on the aminoacid sequence, also can be the difference that does not influence on the modified forms of sequence, perhaps haves both at the same time.These polypeptide comprise natural or the inductive genetic variant.The induce variation body can obtain by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also can pass through site-directed mutagenesis method or the biological technology of other known moleculars.Analogue also comprises having the analogue that is different from the amino acid whose residue of natural L-(as D-amino acid), and has non-natural analogue that exist or synthetic amino acid (as β, gamma-amino acid).Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.
(the not changing primary structure usually) form of modification comprises: the chemically derived form such as the acetylize or carboxylated of the polypeptide that body is interior or external.Modification also comprises glycosylation, carries out glycosylation modified and polypeptide that produce in the procedure of processing as those in the synthetic and processing of polypeptide or further.This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) and finishes by polypeptide is exposed to.Modified forms also comprises have the phosphorylated amino acid residue sequence of (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the polypeptide that has been improved its anti-proteolysis performance or optimized solubility property by modifying.
In the present invention, " people HCCS17 albumen conservative property variation polypeptide " refers to compare with the aminoacid sequence of SEQ ID NO:2, has 10 at the most, preferably at the most 8, more preferably at the most 5,3 amino acid is replaced by similar performance or close amino acid and is formed polypeptide at the most best.These conservative property variation polypeptide preferably carry out the amino acid replacement according to table 1 and produce.
Table 1
| Initial residue | Representational replacement | The preferred replacement |
| Ala(A) | Val；Leu；Ile | Val |
| Arg(R) | Lys；Gln；Asn | Lys |
| Asn(N) | Gln；His；Lys；Arg | Gln |
| Asp(D) | Glu | Glu |
| Cys(C) | Ser | Ser |
| Gln(Q) | Asn | Asn |
| Glu(E) | Asp | Asp |
| Gly(G) | Pro；Ala | Ala |
| His(H) | Asn；Gln；Lys；Arg | Arg |
| Ile(I) | Leu；Val；Met；Ala；Phe | Leu |
| Leu(L) | Ile；Val；Met；Ala；Phe | Ile |
| Lys(K) | Arg；Gln；Asn | Arg |
| Met(M) | Leu；Phe；Ile | Leu |
| Phe(F) | Leu；Val；Ile；Ala；Tyr | Leu |
| Pro(P) | Ala | Ala |
| Ser(S) | Thr | Thr |
| Thr(T) | Ser | Ser |
| Trp(W) | Tyr；Phe | Tyr |
| Tyr(Y) | Trp；Phe；Thr；Ser | Phe |
| Val(V) | Ile；Leu；Met；Phe；Ala | Leu |
Polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:1 or the varient of degeneracy.As used herein, " varient of degeneracy " is meant that in the present invention coding has the protein of SEQID NO:2, but with the differentiated nucleotide sequence of coding region sequence shown in the SEQ ID NO:1.
In the present invention, term " people HCCS17 albumen (or polypeptide) encoding sequence " refer to the encode nucleotide sequence of polypeptide with people HCCS17 protein-active is as 479-958 position nucleotide sequence and degenerate sequence thereof among the SEQ ID NO:1.This term also comprises can be under the moderate stringent condition, better under the height stringent condition with SEQ IDNO:1 in from the nucleotide sequence of the nucleotide sequence hybridization of Nucleotide 479-958 position.This term also comprise with SEQ ID NO:1 in from the homology of nucleotide sequence at least 70% of Nucleotide 479-958 position, preferably at least 80%, more preferably at least 90%, at least 95% nucleotide sequence best.
This term also comprises encoding to have the variant form of open reading frame sequence among proteic, the SEQ ID NO:1 with natural people HCCS17 identical function.These variant forms comprise (but being not limited to): several (are generally 1-90, preferably 1-60, more preferably 1-20,1-10 best) disappearance, insertion and/or the replacement of Nucleotide, and several (are generally in 60 to hold interpolation 5 ' and/or 3 ', preferably being in 30, more preferably is in 10, is in 5 best) Nucleotide.
The polynucleotide of the mature polypeptide of coding SEQ ID NO:2 comprise: the encoding sequence of an encoding mature polypeptide; The encoding sequence of mature polypeptide and various additional code sequence; Encoding sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence.
Term " polynucleotide of coded polypeptide " can be the polynucleotide that comprise this polypeptide of encoding, and also can be the polynucleotide that also comprise additional code and/or non-coding sequence.
The invention still further relates to the varient of above-mentioned polynucleotide, its coding has the polypeptide of identical aminoacid sequence or fragment, analogue and the derivative of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing the function of its encoded polypeptides in fact.
The invention still further relates to and above-mentioned sequence hybridization and two sequences between have at least 50%, preferably at least 70%, the polynucleotide of at least 80% homogeny more preferably.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide of the present invention.In the present invention, " stringent condition " is meant: (1) than hybridization under low ionic strength and the comparatively high temps and wash-out, as 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time is added with denaturing agent, as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 90%, be more preferably 95% and just hybridize when above.And the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in the SEQ ID NO:2.
The invention still further relates to nucleic acid fragment with above-mentioned sequence hybridization.As used herein, the length of " nucleic acid fragment " contains 15 Nucleotide at least, better is at least 30 Nucleotide, is more preferably at least 50 Nucleotide, preferably more than at least 100 Nucleotide.Nucleic acid fragment can be used for the amplification technique (as PCR) of nucleic acid to determine and/or the proteic polynucleotide of separation coding HCCS17.
Polypeptide among the present invention and polynucleotide preferably provide with isolating form, more preferably are purified to homogeneous.
People HCCS17 Nucleotide full length sequence of the present invention or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence.When sequence is longer, usually needs to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplifies is stitched together by proper order.
In case obtained relevant sequence, just can obtain relevant sequence in large quantity with recombination method.This normally is cloned into carrier with it, changes cell again over to, separates obtaining relevant sequence then from the host cell after the propagation by ordinary method.
In addition, also the method for available synthetic is synthesized relevant sequence, especially fragment length more in short-term.Usually, by first synthetic a plurality of small segments, and then connect and to obtain the very long fragment of sequence.
At present, can be fully obtain the dna sequence dna of code book invention albumen (or its fragment, or derivatives thereof) by chemosynthesis.This dna sequence dna can be introduced in various existing dna moleculars as known in the art (or as carrier) and the cell then.In addition, also can will suddenly change and introduce in the protein sequence of the present invention by chemosynthesis.
Use method (Saiki, the et al.Science 1985 of round pcr DNA amplification/RNA; 230:1350-1354) be optimized for acquisition gene of the present invention.When particularly being difficult to obtain the cDNA of total length from the library, can preferably use RACE method (the terminal rapid amplifying method of RACE-cDNA), the primer that is used for PCR can suitably be selected according to sequence information of the present invention disclosed herein, and available ordinary method is synthetic.Available ordinary method is as the DNA/RNA fragment by gel electrophoresis separation and purifying amplification.
The present invention also relates to comprise the carrier of polynucleotide of the present invention, and the host cell that produces through genetically engineered with carrier of the present invention or HCCS17 albumen coded sequence, and the method that produces polypeptide of the present invention through recombinant technology.
Recombinant DNA technology (Science, 1984 by routine; 224:1431), can utilize polymerized nucleoside acid sequence of the present invention to can be used to express or produce the HCCS17 polypeptide of reorganization.In general following steps are arranged:
(1). with the polynucleotide (or varient) of coding of the present invention people HCCS17 polypeptide, or with the recombinant expression vector that contains these polynucleotide proper host cell that transforms or transduce;
(2). the host cell of in suitable medium, cultivating;
(3). separation, protein purification from substratum or cell.
Among the present invention, people HCCS17 polynucleotide sequence can be inserted in the recombinant expression vector.Term " recombinant expression vector " refers to that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carriers.The carrier of Shi Yonging includes but not limited in the present invention: and the expression vector based on T7 of in bacterium, expressing (Rosenberg, et al.Gene, 1987,56:125); The pMSXND expression vector of in mammalian cell, expressing (Lee and Nathans, J Bio Chem.263:3521,1988) and at the carrier that derives from baculovirus of expressed in insect cells.In a word, as long as can duplicate in host and stablize, any plasmid and carrier can be used.A key character of expression vector is to contain replication orgin, promotor, marker gene and translation controlling elements usually.
Method well-known to those having ordinary skill in the art can be used to make up and contains people HCCS17 DNA sequences encoding and suitable transcribing/the translate expression vector of control signal.These methods comprise (Sambroook, et al.Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory.New York, 1989) such as extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technologys of body.Described dna sequence dna can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; Lambda particles phage P
LPromotor; Eukaryotic promoter comprises LTRs and some other known may command gene expression promoter in protokaryon or eukaryotic cell or its virus of CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retrovirus.Expression vector also comprises ribosome bind site and the transcription terminator that translation initiation is used.
In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance.
Comprise the carrier of above-mentioned suitable dna sequence dna and suitable promotor or control sequence, can be used to transform appropriate host cell, so that it can marking protein.
Host cell can be a prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, streptomyces; The bacterial cell of Salmonella typhimurium; Fungal cell such as yeast; Vegetable cell; The insect cell of fruit bat S2 or Sf9; The zooblast of CHO, COS, 293 cells or Bowes melanoma cells etc.
When polynucleotide of the present invention are expressed in higher eucaryotic cells, be enhanced if will make to transcribe when in carrier, inserting enhancer sequence.Enhanser is the cis acting factor of DNA, and nearly 10 to 300 base pairs act on promotor transcribing with enhancing gene usually.Can for example be included in the SV40 enhanser of 100 to 270 base pairs of replication origin side in late period one, at the polyoma enhanser of replication origin side in late period one and adenovirus enhanser etc.
Persons skilled in the art all know how to select appropriate carriers, promotor, enhanser and host cell.
Can carry out with routine techniques well known to those skilled in the art with the recombinant DNA transformed host cell.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results
2Method is handled, and used step is well-known in this area.Another kind method is to use MgCl
2If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, conventional mechanical method such as microinjection, electroporation, liposome packing etc.
The transformant that obtains can be cultivated with ordinary method, expresses the polypeptide of coded by said gene of the present invention.According to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.
The extracellular can be expressed or be secreted into to recombinant polypeptide in the above methods in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.The example of these methods includes, but are not limited to: conventional renaturation handles, with protein precipitant handle (salt analysis method), centrifugal, the broken bacterium of infiltration, superly handle, the combination of super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.
The people HCCS17 albumen or the polypeptide of reorganization are of use in many ways.These purposes include, but is not limited to: the direct disease due to the low or forfeiture and be used to screen and promote or antibody, polypeptide or other part of antagonism HCCS17 protein function as pharmacological agent HCCS17 protein function.The peptide molecule that can suppress or stimulate people HCCS17 protein function that can be used for seeking therapeutic value with the recombinant human HCCS17 protein screening peptide library of expressing.
On the other hand, the present invention also comprises people HCCS17 DNA or the polypeptide of its fragment coding has specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody.Here, " specificity " is meant that antibody capable is incorporated into people HCCS17 gene product or fragment.Preferably, refer to that those can combine with people HCCS17 gene product or fragment but nonrecognition and be incorporated into the antibody of other irrelevant antigen molecule.Among the present invention antibody comprise those can in conjunction with and suppress the proteic molecule of people HCCS17, comprise that also those do not influence the antibody of people HCCS17 protein function.The present invention also comprise those can with modify or without the people HCCS17 gene product bonded antibody of modified forms.
The present invention not only comprises complete mono-clonal or polyclonal antibody, but also comprises having immunocompetent antibody fragment, as Fab ' or (Fab)
2Fragment; Heavy chain of antibody; Light chain of antibody; Genetically engineered strand Fv molecule (people such as Ladner, U.S. Patent No. 4,946,778); Or chimeric antibody, as have the murine antibody binding specificity but still keep antibody from people's antibody moiety.
Antibody of the present invention can be prepared by the known various technology of those skilled in that art.For example, the people HCCS17 gene product of purifying or its have antigenic fragment, can be applied to animal to induce the generation of polyclonal antibody.Similarly, expressing human HCCS17 albumen or its have antigenic segmental cell and can be used to immune animal and produce antibody.Antibody of the present invention also can be monoclonal antibody.This type of monoclonal antibody can utilize hybridoma technology prepare (see people such as Kohler,
Nature256; 495,1975; People such as Kohler,
Eur.J.Immunol.6:511,1976; People such as Kohler,
Eur.J.Immunol.6:292,1976; People such as Hammerling,
In Monoclonal Antibodies and T Cell Hybridomas, Elsevier, N.Y., 1981).Antibody of the present invention comprises the antibody that can block people HCCS17 protein function and the antibody that does not influence people HCCS17 protein function.Each antibody-like of the present invention can utilize the fragment or the functional zone of people HCCS17 gene product, obtains by the routine immunization technology.These fragments or functional zone can utilize recombinant methods or utilize Peptide synthesizer synthetic.Can come immune animal and produce with the gene product of producing in the prokaryotic cell prokaryocyte (for example E.Coli) with the unmodified form bonded antibody of people HCCS17 gene product; With posttranslational modification form bonded antibody (as the albumen or the polypeptide of glycosylation or phosphorylation), can come immune animal and obtain with the gene product that produces in the eukaryotic cell (for example yeast or insect cell).
People HCCS17 antibody of the present invention can be used for identifying the cell of expressing human HCCS17 albumen or polypeptide, as Jurkat T cell.For example, can with a kind of detectable molecule for example fluorescein isothiocyanic acid (FITC) come labelling human HCCS17 specific antibody, allow people HCCS17 specific antibody contact then, detect and people HCCS17 specific antibody bonded cell with fluorescent microscope or flow cytometer again with cell sample.
Except cell surface detects people HCCS17, can also analyze this protein with the Western engram technology.Cell pyrolysis liquid can from culturing cell or take from patient's tissue sample such as liver extract, and be dissolved in the lysis buffer that contains stain remover.Use sds polyacrylamide gel electrophoresis isolated cell extract (simultaneously with the people HCCS17 polypeptide of purifying as positive control) then, then it is transferred on the nitrocellulose by electrophoresis hybridization.In order to survey people HCCS17 polypeptide, can use typical antibodies detection method, for example radioautograph or alkaline phosphatase enzyme assay method with the immunity of Western trace.And can use the contrast of immunization serum or incoherent monoclonal antibody as non-specific responding.
Whether and quantity the expression of also available Nothern blotting technical Analysis people HCCS17 gene product, the i.e. existence of rna transcription thing in cell of analyst HCCS17.
The Western engram analysis of the Nothern engram analysis of people HCCS17 DNA and people HCCS17 specific antibody can be united use, with the expression of confirmer HCCS17 in biological specimen.People HCCS17 DNA can also be used for Southern engram analysis or in situ hybridization analysis, with this assignment of genes gene mapping on karyomit(e), and can carry out genetic linkage analysis to find out other possible disease related gene.
In addition, the present invention also provides a kind of nucleic acid molecule that can be used as probe, and this molecule has 8-100 of people HCCS17 nucleotide coding sequence, preferably 15-50 continuous nucleotide usually.This probe can be used for whether existing in the test sample nucleic acid molecule of coding people HCCS17.
The present invention also provides the method that whether has people HCCS17 nucleotide sequence in the test sample, and it comprises with above-mentioned probe and sample and hybridizing whether detection probes combination has taken place then.Preferably, this sample is the product behind the pcr amplification, and wherein the pcr amplification primer is corresponding to people HCCS17 nucleotide coding sequence, and can be positioned at the both sides or the centre of this encoding sequence.Primer length is generally 15-50 Nucleotide.
Antibody among the present invention can be used for treating or prevention and the relevant disease of people HCCS17 albumen.The antibody that gives suitable dosage can stimulate or block proteic generation of people HCCS17 or activity.
Antibody also can be used for being designed to the immunotoxin at a certain privileged sites in the body.As the monoclonal antibody of people HCCS17 albumen high-affinity can with bacterium or plant poison (as diphtheria toxin, ricin, abrine etc.) covalent attachment.A kind of usual method is with sulfydryl linking agent such as SPDP, attacks the amino of antibody, by the exchange of disulfide linkage, toxin is incorporated on the antibody, and this hybrid antibody can be used for killing the cell of people HCCS17 protein positive.
The production of polyclonal antibody can choose HCCS17 albumen or polypeptide immune animal, as rabbit, mouse, rat etc.Multiple adjuvant can be used for the enhancing immunity reaction, includes but not limited to freund's adjuvant etc.
Utilize albumen of the present invention,, can filter out with HCCS17 albumen interactional material takes place, as acceptor, inhibitor, agonist or antagonist etc. by various conventional screening methods.
Albumen of the present invention and antibody thereof, inhibitor, agonist, antagonist or acceptor etc. when using (administration) in treatment, can provide different effects.Usually, can these materials are formulated in nontoxic, inert and the pharmaceutically acceptable aqueous carrier medium, wherein pH is about 5-8 usually, and preferably pH is about 6-8, although the pH value can be with being changed to some extent by preparation Substance Properties and illness to be treated.The pharmaceutical composition for preparing can carry out administration by conventional route, comprising (but being not limited to): intramuscular, intraperitoneal, intravenously, subcutaneous, intracutaneous or topical.
Polypeptide of the present invention can be directly used in disease treatment, for example, is used for the treatment of liver cancer.When using HCCS17 albumen of the present invention, also can use the other treatment agent simultaneously.
The present invention also provides a kind of pharmaceutical composition, and it contains HCCS17 polypeptide of the present invention or its agonist, antagonist and the pharmaceutically acceptable carrier or the vehicle of safe and effective amount.This class carrier comprises (but being not limited to): salt solution, damping fluid, glucose, water, glycerine, ethanol and combination thereof.Pharmaceutical preparation should be complementary with administering mode.Pharmaceutical composition of the present invention can be made into the injection form, for example is prepared by ordinary method with the physiological saline or the aqueous solution that contains glucose and other assistant agents.Pharmaceutical composition such as tablet and capsule can be prepared by ordinary method.Pharmaceutical composition such as injection, solution, tablet and capsule should be made under aseptic condition.The dosage of activeconstituents is the treatment significant quantity, for example every day about 1 microgram/kg body weight-Yue 5 mg/kg body weight.In addition, polypeptide of the present invention also can use with the other treatment agent.
When making pharmaceutical composition, be that the HCCS17 albumen of safe and effective amount or its antagonist, agonist are applied to Mammals, wherein this safe and effective amount is usually at least about 10 micrograms/kg body weight, and in most of the cases be no more than about 8 mg/kg body weight, preferably this dosage is about 10 micrograms/kg body weight-Yue 1 mg/kg body weight.Certainly, concrete dosage also should be considered factors such as route of administration, patient health situation, and these all are within the skilled practitioners skill.
The proteic polynucleotide of people HCCS17 also can be used for multiple therapeutic purpose.Gene therapy technology can be used for treating because cell proliferation, growth or the metabolic disturbance due to the proteic expression of HCCS17 of the proteic nothing expression of HCCS17 or unusual/non-activity.The HCCS17 albumen that the gene therapy vector (as virus vector) of reorganization can be designed to express variation is to suppress endogenic HCCS17 protein-active.Deriving from viral expression vector such as retrovirus, adenovirus, adeno-associated virus (AAV), hsv, parvovirus etc. can be used for the HCCS17 transgenosis to cell.The method that structure carries the recombinant viral vector of HCCS17 gene is found in existing document (Sambrook, et al.).Recombinant human HCCS17 gene can be packaged in the liposome in addition, and then is transferred in the cell.
Suppress the oligonucleotide (comprising sense-rna and DNA) of people HCCS17 mRNA and ribozyme also within the scope of the invention.Ribozyme is the enzyme sample RNA molecule that a kind of energy specificity is decomposed specific RNA, and its mechanism of action is to carry out the endonuclease effect after ribozyme molecule and the hybridization of complementary target RNA-specific.The RNA of antisense and DNA and ribozyme can obtain with existing any RNA or DNA synthetic technology, as the technology widespread use of solid phase phosphoamide chemical synthesis synthetic oligonucleotide.Antisense rna molecule can be transcribed acquisition by the dna sequence dna of this RNA that encodes in external or body.This dna sequence dna has been incorporated into the downstream of rna polymerase promoter of carrier.In order to increase the stability of nucleic acid molecule, available several different methods is modified it, and as increasing the sequence length of both sides, the connection between the ribonucleoside is used phosphoric acid thioester bond or peptide bond but not phosphodiester bond.
Polynucleotide imports tissue or intracellular method comprises: directly be injected into polynucleotide in the in-vivo tissue; Or external by carrier (as virus, phage or plasmid etc.) earlier with the polynucleotide transfered cell in, again cell is transplanted in the body etc.
Can be incorporated into the rondom polypeptide storehouse that solid formation forms by the various amino acid that may make up by screening with the protein bound peptide molecule of people HCCS17 obtains.During screening, must carry out mark to people HCCS17 protein molecular.
The invention still further relates to the diagnostic testing process of quantitative and detection and localization people HCCS17 protein level.These tests are known in the art, and comprise that FISH measures and radioimmunoassay.The people HCCS17 protein level that is detected in the test can be with laying down a definition the importance of people HCCS17 albumen in various diseases and be used to the disease of diagnosing HCCS17 albumen to work.
Whether having the proteic method of HCCS17 in a kind of detection test sample is to utilize the proteic specific antibody of HCCS17 to detect, and it comprises: sample is contacted with the HCCS17 protein specific antibody; Observe whether form antibody complex, formed antibody complex and just represented to exist in the sample HCCS17 albumen.
The proteic polynucleotide of HCCS17 can be used for the diagnosis and the treatment of HCCS17 protein related diseases.Aspect diagnosis, the proteic polynucleotide of HCCS17 can be used for detecting the proteic expression of HCCS17 HCCS17 abnormal exprssion whether or under morbid state.Can be used for the hybridization of biopsy specimen to judge the proteic abnormal expression of HCCS17 as the HCCS17 dna sequence dna.Hybridization technique comprises the Southern blotting, Northern blotting, in situ hybridization etc.These technological methods all are disclosed mature technologies, and relevant test kit all can obtain from commercial channels.Part or all of polynucleotide of the present invention can be used as probe stationary on microarray (microarray) or DNA chip (being called " gene chip " again), is used for analyzing the differential expression analysis and the gene diagnosis of tissue gene.Carry out RNA-polymerase chain reaction (RT-PCR) amplification in vitro with the special primer of HCCS17 albumen and also can detect the proteic transcription product of HCCS17.
The sudden change that detects the HCCS17 gene also can be used for the disease of diagnosing HCCS17 albumen relevant.The form of HCCS17 protein mutation comprises that the point mutation compared with normal wild type HCCS17 dna sequence dna, transposition, disappearance, reorganization and other are any unusual etc.Available existing technology such as Southern blotting, dna sequence analysis, PCR and in situ hybridization detect sudden change.In addition, sudden change might influence proteic expression, therefore can judge indirectly that with Northern blotting, Western blotting gene has or not sudden change.
Sequence of the present invention identifies it also is valuable to karyomit(e).In brief, the proteic cDNA of HCCS17 prepares PCR primer (preferred 15-35bp) according to the present invention, sequence can be positioned on the karyomit(e).Then, these primers are used for the somatocyte hybrid cell that the PCR screening contains each bar human chromosome.Have only those hybrid cells that contain corresponding to the people's gene of primer can produce the fragment of amplification.
In case sequence is positioned to chromosome position accurately, the physical location of this sequence on karyomit(e) just can be associated with the gene map data.These data for example are found in, V.Mckusick, Mendelian Inheritancein Man (can by with the online acquisition of Johns Hopkins University Welch Medical Library).Can pass through linkage analysis then, determine gene and navigated to relation between the disease on the chromosomal region already.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:ColdSpring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
The clone of people HCCS17 gene
1. separate tissue (Tissue isolation)
Liver derives from 5 adult man liver cancer patients, (contains the part normal liver tissue) behind the liver cancer resection operation, places the freezing preservation of liquid nitrogen immediately.
2.mRNA separation (mRNA isolation)
Take out tissue, grind, add the 50ml pipe that fills lysate, fully after the vibration, move in the glass homogenizer again with mortar.Move to 50ml after the homogenate and newly manage, and extracted total RNA (TRIzol Reagents, Gibco, NY, USA).Identify total RNA quality with the denaturing formaldehyde gel electrophoresis.Cellulose column with band Oligo d (T) separates mRNA among total RNA, quantitatively.
3.cDNA the structure in library (Construction of cDNA library)
With mRNA is template, and synthetic double chain cDNA, reverse transcription primer are GAGAGAGAGAGAGAGAGAGAACTAGTCTCGAGTTTTTTTTTTTTTTTTTT (SEQ ID NO:3).After mending flat end, add the joint that contains the EcoRI point of contact, joint sequence is respectively AATTCGGCACGAG (SEQ ID NO:4) and GGTAGCTTTAGTGAAAACAG (SEQ ID NO:5).Behind the phosphorylation EcoRI end, use XhoI digestion with restriction enzyme 1.5 hours, carry out fragment again and separate.Cross the fragment of post screening length＞500bp, use the phenol-chloroform extracting, ethanol sedimentation, the sterilized water dissolving, be connected to Uni-ZAP XR carrier (Stratagene, CA9203, USA), with Zap-cDNA Gigapack III Gold Cloning Kit (Stratagene, CA9203 USA) packs, and the host bacterium is used XL 1-Blue MRF ' (Stratagene, CA9203, USA) bacterium.Coated plate is also measured titre.
4. order-checking and database are set up (Seqencing and Database Constructing)
Select the clone who has the external source fragment to insert in the library, amplification back extracting plasmid (Qiagen, Germany), hold as 3 ' and the 5 ' universal primer of holding with T3 and T7, adopt thing fluorescent mark (Big-Dye, Perkin-Elmer, method USA) of stopping, (Perkin-Elmer carries out the EST large scale sequencing on USA) at ABI 377 sequenators.Sequencing result is removed the carrier sequence with FACTURA software, is transferred to the processing of carrying out next step on SUN Ultra 450 Server.All sequence informations are used the GCG software package again, and (Wisconsin group, USA) BLAST in and the existing database of FASTA software search (Genebank+EMBL) are lower than 95% sequence with no homology or homology and are considered as new gene and set up database.
5. the full-length clone of gene (Cloning of Full-length cDNA)
On the new gene fragment order information basis that obtains, carry out the cDNA full-length clone, carry out in two stages:
(1) " electronic cloning " (Electronic Cloning)
Search the dbEST database with new gene fragment order as probe, with overlap＞50bp, homology is at (the Expressed Sequence Tag of the expressed sequence tag more than 98%, being called for short " EST ") sequence thinks same sequence (consensus sequence), take out and splice with AUTOASSEMBLER software, part EST can the extension probes sequence.Whether the sequence that is extended with the STRIDER software analysis has complete open reading frame (Open Reading Frame again, ORF), on Nucleotide and amino acid levels, whether homology is arranged with definite this sequence with BLAST search Genbank or SwissProt, to help how differentiate resulting full length gene integrity with other species.By the method for electronic cloning, can obtain the full length sequence of people HCCS17 gene usually.
(2) the terminal rapid amplifying of cDNA (Rapid Amplification of cDNA Ends, RACE)
If do not obtain complete cDNA total length yet by " electronic cloning " method, then at 5 ' or 3 ' end design primer of existing sequence, (Clontech Lab, Inc carry out the long range PCR reaction in USA) in human liver Marathon-Ready cDNA library.Then to PCR product cloning, order-checking.The sequence that is extended with AUTOASSEMBLER and STRIDER software analysis has or not complete ORF, as not having, repeats said process until obtaining total length.
(3)RT-PCR
For 5 ' and 3 ' end known sequences,, can consider to adopt the method for RT-PCR if the centre still has an intersegmental crack (gap) to obtain from existing public database or its data storehouse.At sequence 5 ' end design primer, 3 ' end primer adopts Oligo-dT, increases in the liver total RNA storehouse.Then product is cloned, checked order.Splice at last and obtain total length.
By being used in combination above-mentioned 3 kinds of methods, obtained candidate's the proteic complete encoding sequence of people HCCS17 (SEQ ID NO:1).
Obtain on the total length basis of (comprising complete open reading frame at least) in splicing, further R1:5 '-gaaggcggac cgtacgtggc-3 ' (SEQ ID NO:6) is a forward primer to the design primer, oligonucleotide R2:5 '-accctgcaga aagtcgtctg-3 ' (SEQ ID NO:7) is a reverse primer, with the total RNA of extractive liver organization is template, carry out the RT-PCR amplification, the PCR condition of R1/R2 be 94 ℃ 5 minutes, carried out 35 circulations in 1 minute with 94 ℃ 30 seconds, 57 ℃ 30 seconds and 72 ℃ thereupon, extended 5 minutes with 72 ℃ at last.The electrophoresis detection pcr amplification product, the acquisition expanding fragment length is 791bp.Clone, check order with pcr amplification product according to a conventional method then, the result shows the sequence of amplified production corresponding to 400-1191 position among the SEQ ID NO:1, contains complete ORF.
The sequence information and the homology analysis of people HCCS17 gene:
People HCCS17 full-length cDNA (the GenBank Accession No.AF113538 that the present invention is new.Because of applying for maintaining secrecy, so open before the application to the public) length be 3122bp, detailed sequence is seen SEQ ID NO:1, wherein open reading frame is positioned at 479-960 position Nucleotide.Derive the aminoacid sequence of people HCCS17 according to full-length cDNA, totally 160 amino-acid residues, molecular weight 17754.02, pI are 6.95.Detailed sequence is seen SEQ ID NO:2.
The full length cDNA sequence of people HCCS17 and coded protein thereof are carried out Nucleotide and protein homology retrieval with blast program in Non-redundant GenBank+EMBL+DDBJ+PDB and Non-redundant GenBank CDStranslations+PDB+SwissProt+Superdate+PIR database, found that there is certain homology in the gene of it and house mouse.On nucleotide level, the 803-1789 bit base of the mRNA whole coding sequence (GenBank Accession No.AK078505) of it and house mouse unnamed protein gene has 70.6% homogeny (Fig. 1).On amino acid levels, the 23-598 amino acids residue of it and house mouse HCCS17 albumen (SwissProt Accession No.BAC37312.1) has 78% homogeny and 88% similarity (Fig. 2).Therefore all there are higher homology in people HCCS17 gene and house mouse HCCS17 gene on nucleic acid still is protein level, belong to same family and both also have very high similarity on function.
People HCCS17 of the present invention is used for further functional study except can be used as this family's a member, also can be used for producing fusion rotein with other albumen, such as producing fusion rotein with immunoglobulin (Ig).In addition, people HCCS17 of the present invention can also merge with other members of this family or exchange fragment, to produce new albumen.For example proteic N end of people HCCS17 of the present invention and the proteic N end of house mouse HCCS17 are exchanged, to produce the albumen that new activity is higher or have new features.
At the antibody of inventor HCCS17, be used to screen other members of this family, perhaps be used for affinity purification associated protein (as other members of this family).
In addition, inventor HCCS17 nucleic acid (encoding sequence or antisense sequences) can be introduced into cell, with expression level that improves people HCCS17 or the overexpression that suppresses people HCCS17.People HCCS17 albumen of the present invention or its active polypeptide fragment can be applied to patient, with treatment or alleviate because of people HCCS17 disappearance, no function or unusual cause related disorders arranged.In addition, can also be with carrying out relevant diagnosis or prognosis judgement based on nucleotide sequence of the present invention or antibody.
Because people HCCS17 albumen of the present invention has the natural acid sequence that is derived from the people, therefore, compare with the albumen of the same clan that derives from other species (as house mouse), estimate to have higher active and/or lower side effect (for example in the intravital immunogenicity of people lower or do not have) being applied to man-hour.
Embodiment 3
The proteic 26S Proteasome Structure and Function research of people HCCS17:
With the proteic aminoacid sequence of people HCCS17 the PROSITE database (network address is: http://expasy.hcuge.ch/sprot/scnpsit1.html) retrieval motif (motif), obtain following result:
1??MAPALWRACN
GLMAAFFALA?ALVQVNDPDA?EVWVVVYTIP?AVLTLLVGLN
51??PEVTGNVIWK?SISAIHILFC??TVWAVGLASY?LLHRTQQNIL?HEEEGRELSG
101??LVIITAWIIL?CHSSSKNPVG??GRIQLAIAIV?ITLFPFISWV?YIYINKEMRS
151??SWPTHCKTVI
(1) in aminoacid sequence, there is following function motif:
(i) black matrix district (114-116): protein kinase C phosphorylation site (Protein kinase C phosphorylationsite)
(ii) underscore district (11-16): N-myristoylation site (N-myristoylation site)
(2) functional analysis:
N-myristoylation site, protein kinase C phosphorylation site are all relevant with posttranslational modification (post-translationalmodifications).
With the proteic aminoacid sequence of people HCCS17 the blocks database (network address is: index structure territory http://www.blocks.fhcrc.org) obtains following result:
1??MAPALWRACN?GLMAAFFALA??ALVQVNDPDA?EVWVVVYTIP?AVLTLLVGLN
51??PEVTGNVIWK?SISAIHIL
FC?TVWAVGLASY?LLHRTQQNIL?HEEEGRELSG
101?
LVIITAWIIL?CHSSSKNPVG?GRIQLAIAIV?ITLFPFISWV?YIYINKEMRS
151??SWPTHCKTVI
(1) in aminoacid sequence, there is following structural domain district:
Underscore district (340-349): the guanosine diphosphate (GDP) inhibition functional module (GDP dissociationinhibitor) of dissociating
(2) functional analysis
In this aminopeptidase gene acid sequence, have the guanosine diphosphate (GDP) inhibition functional module of dissociating, thereby the function that can predict signal conduction such as itself and guanosine diphosphate (GDP) is in the cards.
In sum, this gene and the proteic similarity of house mouse HCCS17 have further been confirmed from proteic structure of people HCCS17 and physicochemical property.Because protein structure has determined the specific biochemical theory of function, therefore people HCCS17 of the present invention has the similar or identical functions of house mouse HCCS17.This gene is being brought into play important effect in the exocytosis process.
Embodiment 4
The distribution expression pattern of people HCCS17 gene
1. the Northern express spectra of different tissues.Press people's such as Ton C. method (Ton C et al., BiochemBiophys Res Commun 1997 Dec 18; 241 (2): 589-594; Hwang DM, et al., Circulation 1997 Dec 16; 96 (12): 4146-4203), the BLAST retrieval will be done in the dbEST database of people HCCS17 cDNA sequence in the GCG software package, in the human EST that obtains, the EST of probable value＜10e-10, homogeny＞95% has 76, can be considered the transcriptional expression of this gene in tissue originally, draw the tissue spectrum of expressing this gene thus.
The result shows that HCCS17 all has expression in skeletal muscle, colon, heart, liver, spleen, testis, kidney, shows that it is all bringing into play important effect in the many histoorgans of human body.
2. the express spectra of HCCS17 in liver cancer tissue and the normal liver tissue.Carry out the Northern trace by following ordinary method: filter membrane to be checked places the hybridization solution of 10ml through 68 ℃ of preheatings, in hybrid heater (Bellco) in 68 ℃ of prehybridizations 30 minutes; The cDNA probe that mark is good was in 95～100 ℃ of sex change 2～5 minutes, and (cDNA probe final concentration is 2～10ng/ml or 1～2 * 10 to put rapid cooling back adding hybridization solution on ice
6Cpm/ml), fully mixing was hybridized 2 hours in 68 ℃.After hybridization finishes, filter membrane with 2 * SSC, the drip washing of 0.05%SDS room temperature for several times, the washing lotion several is changed in continuing vibration flushing 30～40 minutes therebetween.Use 0.1 * SSC, 0.1%SDS in 50 ℃ of vibration flushings 20～40 minutes subsequently.Last filter membrane wrapped up with plastic fresh-keeping membrane, in-70 ℃ of exposure X line films 24～48 hours.
The result shows that the expression amount of HCCS17 is significantly less than normal liver tissue in many parts of liver cancer tissue samples, in addition detect less than.This shows HCCS17 down-regulated expression in liver cancer tissue, is that a kind of prediction of liver cancer supressor conforms to HCCS17.
Embodiment 5
The preparation and the purification of people HCCS17 polypeptide
In this embodiment, the people HCCS17 encoding sequence of total length or fragment are built into commercial protein merge among the expression vector, to express and purification of recombinant proteins.
1. people HCCS17 polypeptide is carried out prokaryotic expression with the form of gst fusion protein in intestinal bacteria.
Construction of prokaryotic expression vector, and transformed into escherichia coli
Complete encoding sequence (SEQ ID NO:1) according to people HCCS17, design amplifies complete coding and reads the primer of frame (corresponding respectively to about 20 above Nucleotide of encoding sequence 5 ' and 3 ' end), and on positive anti-primer, introduce restriction endonuclease sites (this decides according to the pGEX-2T carrier of selecting for use) respectively, so that construction of expression vector.With the amplified production that obtains among the embodiment 1 is template, behind pcr amplification, with people HCCS17 gene guarantee to read be cloned under the correct prerequisite of frame the pGEX-2T carrier (Pharmacia, Piscataway, NJ).Identify that good expression vector utilizes CaCl
2Method changes bacillus coli DH 5 alpha over to, and Screening and Identification obtains containing the engineering bacteria DH5 α-pGEX-2T-HCCS17 of pGEX-2T-HCCS17 expression vector.
Express the isolation identification of the engineering bacteria of GST-HCCS17 recombinant protein
DH5 α-pGEX-2T-HCCS17 the engineering bacteria of picking list bacterium colony contains jolting overnight incubation in the LB substratum of 100 μ g/ml penbritins in 3ml, draw nutrient solution by 1: 100 concentration and in new LB substratum (containing 100 μ g/ml penbritins), cultivated about 3 hours, to OD
600After reaching 0.5, adding IPTG continues at 37 ℃ to final concentration 1mmol/L and cultivated respectively 0,1,2,3 hours.It is centrifugal to get the different 1ml bacterium liquid of incubation time, in the bacterial precipitation thing, add lysate (2 * SDS sample-loading buffer, 50 μ l, distilled water 45 μ l, 3-mercaptoethanol 5 μ l), the suspendible bacterial precipitation, boiled in the boiling water bath 5 minutes, centrifugal 1 minute of 10000rpm, supernatant adds electrophoresis in the 12%SDS-PAGE glue.The bacterial strain that the protein content of dyeing back observation expection molecular weight size increases with the IPTG induction time is the engineering bacteria of expressing the GST-HCCS17 fusion rotein.
The extraction purifying of GST-HCCS17 fusion rotein
The proteic engineering bacteria DH5 of abduction delivering GST-HCCS17 amalgamation and expression α-pGEX-2T-HCCS17 as stated above.Bacterium centrifugation after inducing adds the resuspended bacterium of 20ml PBS, ultrasonication bacterium by every 400ml bacterium.The ultrasonic completely liquid of broken bacterium adds 50% saturated Triptide Sepharose 4B of PBS by every milliliter of amount that adds 20 microlitres, 37 ℃ of joltings were in conjunction with 30 minutes, 10000rpm precipitated the Triptide Sepharose 4B that combines GST-HCCS17 in centrifugal 10 minutes, abandoned supernatant.Clean twice by the amount that every milliliter of ultrasonic liquid gained precipitation adds 100 μ l PBS, then add 10 μ l reduced glutathione elutriants by every milliliter of ultrasonic liquid gained precipitation, room temperature was put 10 minutes, centrifugal 10 minutes of 10000rpm, and supernatant is the fusion rotein of wash-out.Repeat twice of wash-out.The supernatant of wash-out is stored in-80 ℃, and carries out the SDS-PAGE electrophoresis, detects purification effect.Protein band at the 38-39kDa place promptly is the fusion rotein of people GST-HCCS17.
Embodiment 6
People HCCS17 albumen or polypeptide carry out eukaryotic cell expression in human embryo kidney (HEK) 293 cells
1. the structure of people HCCS17 rhabdovirus expression vector and rotaring redyeing 293 cell strain
According to the complete encoding sequence (SEQ ID NO:1) of people HCCS17, design amplifies the primer that complete coding is read frame, and introduces restriction endonuclease sites (this is decided by the carrier of selecting for use) respectively on positive anti-primer, so that construction of expression vector.With the amplified production that obtains among the embodiment 1 is template, behind pcr amplification, with people HCCS17 cDNA under the prerequisite that guarantees reading frame, be cloned into the pcDNA3.1A carrier (Invitrogen, Carlsbad, CA).Identify good expression vector 3 μ g, pcDNA3.1A DNA (BaculoGold
TMACMNPV DNA, Pharmingen, San Diego, CA) 1 μ g and Lipofection (Gibco-BRL, NY) 25 μ l add in the DMEM substratum of 1ml serum-free, the 15 seconds mixings that vibrate, incubated at room 15 minutes is standby.Get 1ml (2 * 10
6) 293 cell suspensions are in 60mm tissue culturing plate, change transfection media after adherent 1 hour, incubated at room was abandoned substratum after 15 minutes, add the dna vector transfection mixture for preparing previously, Parafilm seals culture plate, cultivated 4 hours in 27 ℃ of joltings of room temperature, then change perfect medium and cultivated 3 days, it is standby to collect supernatant.
2. change the Screening and Identification of 293 cell strains of recombinant expression vector over to
293 cells of transfection after 3 days carry out Western to be identified.The SDS-PAGE electrophoresis will be carried out after the lysis, glue behind the electrophoresis prints to protein transduction on the nitrocellulose membrane in the half-dried electrotransfer instrument of the Multiphor of Pharmacia II, nitrocellulose membrane is placed confining liquid sealing 1 hour, then in the antibody-solutions of anti-people HCCS17, sealed 1 hour, the jolting of TBS liquid is cleaned 5 minutes 2 times totally, then film is placed the anti-second antibody solution jolting of biotin labeled anti-people HCCS17 one 1 hour, TBS cleans, adding avidin-alkaline phosphatase enzyme complex reacted 30 minutes, TBS cleans 2 times, adds freshly prepared colour developing liquid colour developing and observes protein band.
293 cell clones of picking high expression level people HCCS17.
3. the proteic extraction purifying of people HCCS17
With the Sf9 cell clone collecting cell of high expression level people HCCS17, the PBS washing.Per 2 * 10
8Cell adds 20ml cell pyrolysis liquid (0.5%Triton X-100,20mM Na
3PO
4(sodium phosphate, pH7.8), 500mM NaCl, 1mM Na
3VO
4(vanadic acid sodium), 1mM Pefabloc, 1 μ g/ml pepstatin, leupeptin and aprotinin) broken cell, centrifugal 20 min of 12000 * g remove cell debris, and supernatant is by per 2 * 10
8Cell add 2ml NTA-agarose (Qiagen, Germany), 4 ℃ of absorption 1 hour.Then with containing the His damping fluid washed twice of 100nM imidazoles, with containing 20mM N, N '-two piperazine, 500mM NaCl, the buffer solution elution of 300mM imidazoles is to obtain the albumen of purifying.Elutriant is stored in 4 ℃, and carries out the proteic purity of people HCCS17 that the SDS-PAGE electrophoresis detection is extracted.Protein band at the 17-20kDa place promptly is a people HCCS17 albumen.
Embodiment 7
The preparation of anti-people HCCS17 antibody
1. the preparation of immune mouse and splenocyte: it is standby that the people HCCS17 albumen that obtains among embodiment 5 and the embodiment 6 is separated the back with chromatography, also can separate with the SDS-PAGE gel electrophoresis, electrophoretic band is cut off from gel, and with isopyknic complete Freund ' s adjuvant emulsion.Get the female mouse of 6-8 week Balb/C in age, the albumen with 50-100 μ g/0.2ml emulsification carries out peritoneal injection to mouse.After 14 days, with the same antigen of non-complete Freund ' s adjuvant emulsion to mouse with the dosage of 50-100 μ g/0.2ml again booster immunization once be used for after 3-5 days merging.Wherein, E Zheng chief editor, " tissue culture and molecular cell learn a skill ", Beijing Publishing House, the 210th page are seen in the splenocyte preparation.
2. by " tissue culture and molecular cell learn a skill " (the same), the method in the 371st page, preparation feeder cell.
3. by " tissue culture and molecular cell learn a skill " (the same), the method in the 213rd page is carried out cytogamy.
4. detection of antibodies: after cytogamy 10-15 days, need to check by the hole, in case find vigorous hybrid cell colony growth, the HCCS17 albumen of just should choosing is done the preliminary screening of antibody activity, and method commonly used has: immunofluorescent test, emission immunity test (RIA), enzyme linked immunosorbent assay (ELISA).After checking out the hole of antibody activity, clone cultivation at once, and isolate antibody.The specific reaction of antibody is active to be assessed in the ability of external precipitation people HCCS17 protein gene translation product with it.
Found that antibody can combine with albumen of the present invention specifically.
Discuss
HCCS17 has the obvious suppression effect to the growth of liver cancer cell, and cell cycle also has tangible influence, can block 7703 liver cancer cells in the G2 phase (result does not show).The growth of cell is that the gene that carries out the promotion cell cycle produces the result who goes and suppress delicate balance between its gene product of carrying out.The exception table severity of any product, as the overexpression of a kind of oncogene, or a kind of inactivation of cancer suppressor gene, all may cause the out of control of cell growth.The generation of cancer is a process that relates to the rapid accumulated change of multistep of multiple oncogene activation and cancer suppressor gene inactivation.When the knowledge of regulating oncogene and cancer suppressor gene is increased, also will increase with medicine or gene therapy possibility of intervention.Use the function that viral genetic vector substitutes cancer suppressor gene, or the antisense member of expressing oncogene in can not the cancer person of surgical excision is so that tumor regression or inhibition, and can combines with systemic chemotherapy, thus prolongation patient's life.HCCS17 albumen of the present invention helps people to study the interaction of oncogene and cancer suppressor gene, develops new strategy of cancer treatment.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table
＜110〉Research Center of Shanghai Human Genome
＜120〉liver cancer supressor and encoding sequence thereof and purposes
<130>036340
<160>7
<170>PatentIn?version?3.1
<210>1
<211>3122
<212>DNA
＜213〉homo sapiens (Homo sapiens)
<400>1
tctttccttc?tttctttttc?tttctttctc?tttcttcctc?tctcccctcc?cgcctgcctt????60
ccttcctttt?ttccttcttt?tttttctttc?ttcttttttt?ttttttttgt?gaggaaggta???120
gctttagtga?aaacagggtt?tggagttgaa?cctatacggg?ttcaaattcg?acttccgtcc???180
accaccgaga?cctgcgctcc?ctgagggact?cgctttccca?tccgcgaaac?caggacggcg???240
ccgcctacac?cccgcggcgt?tcggggcggg?ctgaatgggt?cgctgagtgg?gggctacacc???300
cacgcccttc?gctccccgcc?cccgggcgga?gcgacggcca?cggcagtgtc?cccaaggcac???360
cgaaaccgag?gcgggggtct?cggtccctcc?gcgcaaggag?gaaggcggac?cgtacgtggc???420
aggactcacc?gccccgcacg?tggcaggact?caccgccccg?cgccgtgttc?tccgagccat???480
ggcgccagcg?ctgtggcggg?cctgcaacgg?actcatggcc?gccttcttcg?cgctggcggc???540
cttggtgcag?gtaaatgacc?cagatgcaga?ggtgtgggtg?gtggtgtaca?caatccctgc???600
agtactgacc?ctgcttgttg?gacttaaccc?tgaagtcaca?ggtaatgtta?tttggaaaag???660
tatctctgca?atacacatac?tcttttgtac?ggtgtgggct?gttggcttgg?cgtcctacct???720
cttgcatcgt?acacaacaga?acatcttaca?tgaggaagaa?ggcagggagc?tgtctggtct???780
ggtgattatt?acagcatgga?ttatcctgtg?ccacagttcc?tcaaagaatc?cagttggtgg???840
aagaattcaa?ttggctattg?ccattgtaat?cacacttttc?ccatttatct?catgggtcta???900
catatatatt?aacaaggaaa?tgcggtcctc?ttggccaact?cactgcaaga?cagtaattta???960
aataaattca?agaacttcgt?ttttaaaatg?aatattttca?atcaattttt?tataaacatt??1020
aggggaacaa?gccaggagtt?tatttcaggt?aatttgggct?aatagtttta?aaactccaaa??1080
taacttttta?agggtgcata?taattcgatg?taagattgga?tgggacaagt?aagagatggt??1140
ctgatatttt?ccagacgact?ttctgcaggg?tcttgtgtca?taatgtagtg?gaaaaggcta??1200
gagaatagaa?gtttaaaaat?acgagttcta?acttaacttt?gtaactatgt?aatttgggca??1260
aatatataaa?cctcctggtg?gatatttatc?tataaaatag?gattaatgcc?agatctactt??1320
acttacacag?taacaaggat?caatctagat?aatgtaagaa?cactctgaag?atataaagtg??1380
tttggaaaga?ttacggaggg?ctgcccatga?ttaaaataga?ggggagcagg?gattgggtaa??1440
tatactgaaa?tagacattca?agagagggct?ataccccgat?cttttttttt?ttttaagaca??1500
gtcccactct?attgcccagg?ctggagtgca?gtggcatgat?catggctcac?tgcagtcctg??1560
acctcccggg?gctcaggtga?tcctcctacc?tcagcctccc?aagaagctac?gactacaagt??1620
gtgcaccacc?atgcccggct?aaattttttt?aaattttttg?tagaggcagg?gtttcaccgt??1680
gttgtccagg?ctggtcttga?attcctgagt?tcaagcgatc?tgtccacctt?ggcctcccaa??1740
agtgctggga?ttacaggtgt?gagccaccat?gcccagtcca?gccctaaact?aatcttatcc??1800
agagctggca?tagtgcagtg?aactaaagga?gaactctaga?tgaatcaaat?gagcaggcat??1860
gtcttggaaa?gaaagggaag?ctggatagaa?taaaggaatt?agggaccaaa?caagaaggca??1920
atagggacta?taactacatt?ctaaatgaga?aataaggtca?aaatctatat?acattcttta??1980
taaatggatg?tccaaagtaa?tcctagggag?gagagctttt?ttttttttca?tttccatttt??2040
catttaaaaa?tggatacttg?attattggaa?aacttacaat?tgtgtttgga?acaacttggg??2100
tatttgaatc?taattttcca?attgcaaatt?ttatgatacc?taaatacaga?taaagtattt??2160
ccaatgaaaa?tttagtgtcc?aaatgagtgg?ggctataaat?gtaaaataca?ctggatttta??2220
aagacatggt?agaaaaagaa?cagaaaatat?tttttgtatt?gattacatgt?tgaaacaata??2280
ttttggctat?aatgggttaa?atatactatt?aaagttgatt?ttatctgttt?ctgtttactt??2340
ttatttacgt?ggcttacatt?gcatttctgt?tggacagtcc?tgtatttaag?tatctagatg??2400
gcaacatttt?acatacacaa?gcatcaaact?ctgtggtcag?atactgtttt?ttctgatcta??2460
ggaaagagat?ctgggaaata?cttcactcaa?aaagaacgag?tagtgccttc?cacaggttag??2520
gagagtgtaa?atgagtctgg?tagtttgtct?atttttattg?tctttattac?tatagtaaat??2580
attctataaa?tatttgttaa?aggaggtatg?tgtattttgt?ttttgttatt?ggcacagtgg??2640
ccactgaatg?gtgagaaatt?atctaagatt?aagacttgaa?tgagtaaaaa?gggggaaaac??2700
aaatctagtt?gatattaaaa?cagtcaaagt?gaaacttaag?ggtcagtaaa?atacacataa??2760
aggatttgag?ttttccagtg?tatattttgc?ttacatattt?gtggctttta?taactccttt??2820
agtattaata?aactactgaa?gtcacatgca?aaaaaaaaac?agactcattt?gcaaattccc??2880
tgtgggctct?atccattgac?caagtcatgt?ttacttctgt?gcttaaagac?agtaatgttc??2940
aagatgtgct?ttcatcatgt?atgcctctcc?catatcagac?tacgaaatta?tgtgactatt??3000
catagtctct?ttcgcatctt?cagttaagca?tataaaaggc?acttttggtg?gaatagtctt??3060
ttgaagagta?ttaatgaaat?tgaatttaag?tattattatt?aaatttaata?tttctattaa??3120
aa?????????????????????????????????????????????????????????????????3122
<210>2
<211>160
<212>PRT
＜213〉homo sapiens (Homo sapiens)
<400>2
Met?Ala?Pro?Ala?Leu?Trp?Arg?Ala?Cys?Asn?Gly?Leu?Met?Ala?Ala?Phe
1???????????????5???????????????????10??????????????????15
Phe?Ala?Leu?Ala?Ala?Leu?Val?Gln?Val?Asn?Asp?Pro?Asp?Ala?Glu?Val
20??????????????????25??????????????????30
Trp?Val?Val?Val?Tyr?Thr?Ile?Pro?Ala?Val?Leu?Thr?Leu?Leu?Val?Gly
35??????????????????40??????????????????45
Leu?Asn?Pro?Glu?Val?Thr?Gly?Asn?Val?Ile?Trp?Lys?Ser?Ile?Ser?Ala
50??????????????????55??????????????????60
Ile?His?Ile?Leu?Phe?Cys?Thr?Val?Trp?Ala?Val?Gly?Leu?Ala?Ser?Tyr
65??????????????????70??????????????????75??????????????????80
Leu?Leu?His?Arg?Thr?Gln?Gln?Asn?Ile?Leu?His?Glu?Glu?Glu?Gly?Arg
85??????????????????90??????????????????95
Glu?Leu?Ser?Gly?Leu?Val?Ile?Ile?Thr?Ala?Trp?Ile?Ile?Leu?Cys?His
100?????????????????105?????????????????110
Ser?Ser?Ser?Lys?Asn?Pro?Val?Gly?Gly?Arg?Ile?Gln?Leu?Ala?Ile?Ala
115?????????????????120?????????????????125
Ile?Val?Ile?Thr?Leu?Phe?Pro?Phe?Ile?Ser?Trp?Val?Tyr?Ile?Tyr?Ile
130?????????????????135?????????????????140
Asn?Lys?Glu?Met?Arg?Ser?Ser?Trp?Pro?Thr?His?Cys?Lys?Thr?Val?Ile
145?????????????????150?????????????????155?????????????????160
<210>3
<211>50
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>3
gagagagaga?gagagagaga?actagtctcg?agtttttttt?tttttttttt?????????????????50
<210>4
<211>13
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>4
aattcggcac?gag?????????????????????????????????????????????????????????13
<210>5
<211>20
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>5
ggtagcttta?gtgaaaacag??????????????????????????????????????????????????20
<210>6
<211>20
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>6
gaaggcggac?cgtacgtggc??????????????????????????????????????????????20
<210>7
<211>20
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>7
aatagtcaca?taatttcgta??????????????????????????????????????????????20
Claims (10)
1. isolating people HCCS17 polypeptide is characterized in that this polypeptide is selected from down group:
(a) has the polypeptide of SEQ ID NO:2 aminoacid sequence;
(b) SEQ ID NO:2 aminoacid sequence is formed through replacement, disappearance or the interpolation of one or more amino-acid residues, and have the function that suppresses liver cancer cell growth by (a) polypeptides derived.
2. polypeptide as claimed in claim 1 is characterized in that, this polypeptide is the polypeptide with SEQ ID NO:2 aminoacid sequence.
3. isolating polynucleotide is characterized in that, it comprises a nucleotide sequence, and this nucleotide sequence is selected from down group:
(a) polynucleotide of polypeptide according to claim 1 of encoding;
(b) with polynucleotide (a) complementary polynucleotide.
4. polynucleotide as claimed in claim 3 is characterized in that, this polynucleotide encoding has the polypeptide of aminoacid sequence shown in the SEQ ID NO:2.
5. polynucleotide as claimed in claim 3 is characterized in that, the sequence of these polynucleotide is selected from down a kind of of group:
(a) has the sequence of 479-958 position among the SEQ ID NO:1;
(b) has the sequence of 1-3122 position among the SEQ ID NO:1.
6. a carrier is characterized in that, it contains the described polynucleotide of claim 3.
7. a genetically engineered host cell is characterized in that, it contains the described carrier of claim 6.
8. the preparation method of a peptide species is characterized in that, this method comprises:
(a) under conditions suitable for the expression, cultivate the described host cell of claim 7;
(b) from culture, isolate people HCCS17 protein polypeptide.
9. energy and the described people HCCS17 of claim 1 polypeptid specificity bonded antibody.
10. whether there is the proteic method of HCCS17 in a test sample, it is characterized in that, comprising:
The described antibody of sample and claim 9 is contacted,
Observe whether form antibody complex, formed antibody complex and just represented to exist in the sample HCCS17 albumen.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200310108761 CN1618806A (en) | 2003-11-21 | 2003-11-21 | Liver cancer inhibition factor and its coding sequence and use |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200310108761 CN1618806A (en) | 2003-11-21 | 2003-11-21 | Liver cancer inhibition factor and its coding sequence and use |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1618806A true CN1618806A (en) | 2005-05-25 |
Family
ID=34758709
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200310108761 Pending CN1618806A (en) | 2003-11-21 | 2003-11-21 | Liver cancer inhibition factor and its coding sequence and use |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1618806A (en) |
-
2003
- 2003-11-21 CN CN 200310108761 patent/CN1618806A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1234728C (en) | Novel human lymphokine, its coding sequence and use | |
| CN1194012C (en) | Sperm formation relative protein and its coding sequence and use | |
| CN1618806A (en) | Liver cancer inhibition factor and its coding sequence and use | |
| CN1290861C (en) | New type human bone marrow substrate cell source 1 type phosphoric acid enzyme inhibition factor, its coded sequence and use | |
| CN1289524C (en) | Human telomerase active inhibitor protein and use thereof | |
| CN1277844C (en) | Novel human cyclin, its coding sequence and application | |
| CN1155613C (en) | Human tumor associated gene in 1-zone 3-band 3-subband of short arm of human chromosome No.17 and its coding protein | |
| CN1267727A (en) | New human phosphorylated zymoprotein of pyruvate dehydrogenase and its code sequence | |
| CN1209372C (en) | Human tumor relative gene CT120 in human 17p 13.3 area and coding protein thereof | |
| CN1304568C (en) | Novel human complement C1r-like serine proteinase analogue, and its encoding sequence and use | |
| CN1920026A (en) | Human hMnk2 gene order, encode albumen and preparation method thereof | |
| CN1170843C (en) | Noven huamn protein with function of promoting growth of cancer cell and its code sequence | |
| CN1169832C (en) | Identification and function research of gene p28-II | |
| CN1272540A (en) | Human immune factor related protein and its coded sequence | |
| CN1948490A (en) | Human hRAB-14 gene sequence, its coding protein and preparation method | |
| CN1322732A (en) | New liver cancer up expressing gene and its encoded protein and application | |
| CN1631898A (en) | Mitochondria traffic protein molecule for human marrow stromal cell and sequence encoding same and use thereof | |
| CN1272545A (en) | Human neurogenic glutamine transport protein and its coded sequence | |
| CN1534043A (en) | Ubiquition type molecule of human bone marrow substrate cell source and its coding sequence and use | |
| CN1618805A (en) | Nerve system development related protein and its coding sequence and use | |
| CN1510139A (en) | Human auricular fibrillation pathogenic gene, encoding protein and use thereof | |
| CN1268567A (en) | New human plasminogen activating factor regulating protein and its coding sequence | |
| CN1618807A (en) | Secretory protein and its coding sequence and use | |
| CN1338472A (en) | Polypeptide-human zinc finger protein 75.68 and polynucleotide for coding it | |
| CN1267732A (en) | Human methyl transferase protein and its code sequence |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |