CN1618805A - Nerve system development related protein and its coding sequence and use - Google Patents
Nerve system development related protein and its coding sequence and use Download PDFInfo
- Publication number
- CN1618805A CN1618805A CN 200310108758 CN200310108758A CN1618805A CN 1618805 A CN1618805 A CN 1618805A CN 200310108758 CN200310108758 CN 200310108758 CN 200310108758 A CN200310108758 A CN 200310108758A CN 1618805 A CN1618805 A CN 1618805A
- Authority
- CN
- China
- Prior art keywords
- holf50
- polypeptide
- leu
- sequence
- ser
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
Abstract
A novel nervous system development associated protein hOLF50 for promoting nerve cell development to form neurites, the polynucleotide for coding it, the process for preparing said protein by recombination, and the application of said polynucleotide are disclosed.
Description
Technical field
The invention belongs to biological technical field, specifically, the present invention relates to the polynucleotide of new coding hOLF50 hOLF50, and the polypeptide of this polynucleotide encoding.The invention still further relates to the purposes and the preparation of these polynucleotide and polypeptide.
Background technology
Secretory protein is the very important albumen of a class function, is bringing into play important effect in the growth of multicellular organism, growth, cytodifferentiation propagation, apoptosis, cell communication, signal transduction.Secretory protein accounts for 1/10th of human protein's group in the human body, they have participated in various procedures such as signal pathway, blood coagulation, immune defense, cancer generation, as a lot of main factors in digestive ferment, extracellular matrix and the blood plasma, and hormone, neuropeptide, cytokine etc. all are secretory proteins.Some secretory proteins have the potential clinical value, and have obtained actually using widely, as tethelin, Interferon, rabbit and interleukin-etc.
Secretory protein is by signal peptide (signal peptide) mediation, enters endoplasmic reticulum, is secreted into the extracellular then.Signal peptide research in the protein molecule starts from the sixties in 20th century, the work of this respect is to carry out on the basis of research secretory protein, research at that time is intended to understand, and the synthetic new polypeptide chain is which kind of approach to be secreted into extracellular by on rrna.Moral descendants U.S. scientist Blobel (G.Blobel) because of the pioneering research to signal peptide in the protein molecule, has obtained the prize of 1999 annual Nobel's physiology or medical science.
The hypothesis of signal sequence of Blobel proposes the N-terminal at some new polypeptide chains, and the peptide section that has a segment length not wait is made up of 20～30 amino-acid residues usually.Their existence has determined the new polypeptide chain that contains this class peptide section can be secreted into the extracellular, and in being secreted into extracellular mature protein, has then no longer contained this class peptide section.The peptide chain that contains this class peptide section is usually by the interior signal of the organoids (comprising endoplasmic reticulum, golgi body and lysosome etc.) that communicate with the extracellular a bit, thereby is also referred to as signal peptide.Just signal peptide in the synthetic new polypeptide chain and signal peptide identification particle (SRP) combination, SRP and its receptors bind, and rrna and ribosome receptor combination then.After signal peptide enters the new polypeptide chain guiding in the endoplasmic, under the effect of signal peptidase mixture, the signal peptide of having finished mission is cut, the peptide chain of cut signal peptide is in endoplasmic and golgi body, further pass through various types of detailed post-treatment that turn over, comprise the modification (for example glycosylation etc.) of folding, some residues of peptide chain, the activation of precursor etc., finally become the protein that ad hoc structure and function are arranged, and the privileged site that is positioned in the body is exercised its function.
The unique total universal characteristics of secretory protein is exactly N-terminal signal peptide, and signal peptide is all inequality in each albumen, but some similarly character are arranged.Be that some mostly are hydrophilic positively charged residue behind the initial methionine(Met), this district is the n district, is the hydrophobic region h district of 7-15 residue then, and leucine, L-Ala and Xie Ansuan are rich in this district, and last c district comprises the shearing site of signal peptide proteolytic enzyme.At-1 and more than-3 tendencies of shearing site amino acid for L-Ala or other band short-side chains ,-4 and-6 then be to help the proline(Pro) sheared.
In view of the nervous system development associated protein is relevant with the normal development of some cell, so this area presses for the new nervous system development associated protein of exploitation.
Summary of the invention
The purpose of this invention is to provide a kind of new hOLF50 hOLF50 albumen with and fragment, analogue and derivative.
Another object of the present invention provides the polynucleotide of these polypeptide of coding.
Another object of the present invention provides the method for these polypeptide of production and the purposes of this polypeptide and encoding sequence.
In a first aspect of the present invention, novel isolated hOLF50 polypeptide is provided, it comprises: polypeptide or its conservative property variation polypeptide or its active fragments or its reactive derivative with SEQID NO:2 or 3 aminoacid sequences.
Preferably, this polypeptide is selected from down group:
(a) has the polypeptide of SEQ ID NO:2 or 3 aminoacid sequences;
(b) replacement, disappearance or the interpolation through one or more amino-acid residues of SEQ ID NO:2 or 3 aminoacid sequences formed, and have the function that promotes the PC-12 cell to form cynapse by (a) polypeptides derived.
More preferably, this polypeptide is the polypeptide with SEQ ID NO:2 or 3 aminoacid sequences.
In a second aspect of the present invention, the polynucleotide of isolating these polypeptide of coding are provided, these polynucleotide comprise a nucleotide sequence, and this nucleotide sequence is shown at least 70% homogeny with a kind of nucleotides sequence that is selected from down group: (a) polynucleotide of the above-mentioned people hOLF50 polypeptide of coding; (b) with polynucleotide (a) complementary polynucleotide.Preferably, this polynucleotide encoding has the polypeptide of aminoacid sequence shown in SEQ ID NO:2 or 3.More preferably, the sequence of these polynucleotide is be selected from down group a kind of: the nucleotide sequence that (a) has 286-1686 position among the SEQ ID NO:1; (b) has the nucleotide sequence of 391-1686 position among the SEQ ID NO:1; (c) has the nucleotide sequence of 1-2741 position among the SEQ IDNO:1.
In a third aspect of the present invention, the carrier that contains above-mentioned polynucleotide is provided, and has been transformed or host cell of transduceing or the host cell that is directly transformed or transduce by above-mentioned polynucleotide by this carrier.
In a fourth aspect of the present invention, provide preparation to have the method for the polypeptide of people hOLF50 protein-active, this method comprises: (a) under the proteic condition of suitable expressing human hOLF50, cultivate the above-mentioned host cell that is transformed or transduce; (b) from culture, isolate polypeptide with people hOLF50 protein-active.
In a fifth aspect of the present invention, provide and above-mentioned people hOLF50 polypeptid specificity bonded antibody.The nucleic acid molecule that can be used for detecting also is provided, and it contains a successive 10-2741 Nucleotide in the above-mentioned polynucleotide.
In a sixth aspect of the present invention, the compound of simulation, promotion, antagonism people hOLF50 polypeptide active is provided, and the compound that suppresses people hOLF50 polypeptide expression.The method of screening and/or prepare these compounds also is provided.Preferably, this compound is encoding sequence or its segmental antisense sequences of people hOLF50 polypeptide.
In a seventh aspect of the present invention, provide and whether had the proteic method of hOLF50 in the test sample, it comprises: sample is contacted with the proteic specific antibody of hOLF50, observe whether form antibody complex, formed antibody complex and just represented to exist in the sample hOLF50 albumen.
In a eighth aspect of the present invention, a kind of disease relevant with people hOLF50 polypeptide unconventionality expression or method of disease susceptibility of detecting is provided, this method comprises: whether have sudden change in the nucleotide sequence of detection coding said polypeptide.
In a ninth aspect of the present invention, provide the purposes of polypeptide of the present invention and encoding sequence.Especially hOLF50 albumen of the present invention can be used for promoting in vitro and in vivo the growth of neurocyte, and also available preparation promotes the composition of nerve growth.
In a tenth aspect of the present invention, a kind of pharmaceutical composition is provided, it contains people hOLF50 polypeptide of the present invention or its agonist, antagonist and the pharmaceutically acceptable carrier of safe and effective amount.These pharmaceutical compositions can be treated the illness of neural system aspect.
Others of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.
Description of drawings
Following accompanying drawing is used to illustrate specific embodiments of the present invention, and is not used in qualification by the scope of the invention that claims defined.
Figure 1A has shown the Nucleotide (SEQ ID NO:1) of hOLF50 gene of the present invention; Wherein full length gene is 2741bp; The coding region is: 286 to 1686.
Figure 1B has shown the proteic full length amino acid sequence of people hOLF50 of the present invention (SEQ ID NO:2).This albumen total length is 467 amino acid, pI=6.68, Mw=54KDa.Wherein, signal peptide is 1-35 position (black matrix zone), and the maturation protein of having removed signal peptide is shown in SEQ ID NO:3.The OLF structural domain is positioned at 210-460 position (underscore zone).The N-glycosylation site has 7 with marking in the square frame, and the position is respectively the 85th, 169,270,289,376,413,455.
Fig. 2 has shown the electrophorogram that hOLF50 is carried out pcr amplification.
Fig. 3 has shown the result who hOLF50 is carried out the Western trace.
Fig. 4 has shown the result who hOLF50 is carried out the Northern trace.
Fig. 5 has shown the expression of results of hOLF50 in Chinese hamster ovary celI, and molecular weight is about 60KDa.
Fig. 6 has shown the expression of results of hOLF50 in intestinal bacteria, and the molecular weight of the fusion rotein of the N end fragment of GST-hOLF50 is about 60KDa.
Fig. 7 has shown the promoter action of hOLF50 to neurocyte PC-12 growth, and wherein blank is not for adding any material; Negative control is for adding the Chinese hamster ovary celI nutrient solution, and the hOLF50 culture supernatant is the culture supernatant of the CHO of expression hOLF50.
Embodiment
The present invention has isolated a nervous system development associated protein-hOLF50 albumen from philtrum first, and has proved that it has the function that promotes neurocyte to form spinous process, has finished the present invention on this basis.Albumen of the present invention is specific expressed at the normal cerebral tissue of human body (more at hippocampus Hippocampus), hOLF50 albumen has played vital role in the keeping of later stage that central nervous system is grown and mature neuron function, have potential drug development potentiality.
In the present invention, term " hOLF50 albumen ", " hOLF50 polypeptide " or " nervous system development associated protein hOLF50 " are used interchangeably, and all refer to have the full length amino acid sequence (SEQ ID NO:2) of hOLF50 hOLF50 or the albumen or the polypeptide of mature amino acid sequence (SEQ ID NO:3).They comprise the nervous system development associated protein hOLF50 that contains or do not contain initial methionine.
As used herein, " isolating " is meant that material separates (if natural substance, primal environment promptly is a natural surroundings) from its primal environment.Do not have separation and purification as polynucleotide under the native state in the active somatic cell and polypeptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then for separation and purification.
As used herein, " isolating hOLF50 albumen or polypeptide " is meant that the hOLF50 polypeptide is substantially free of natural relative other albumen, lipid, carbohydrate or other material.Those skilled in the art can use the purified technology of protein purifying hOLF50 albumen of standard.Basically pure polypeptide can produce single master tape on non-reduced polyacrylamide gel.The purity of hOLF50 polypeptide can be used amino acid sequence analysis.
Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic polypeptide, preferred recombinant polypeptide.Polypeptide of the present invention can be the product of natural purifying, or the product of chemosynthesis, or uses recombinant technology to produce from protokaryon or eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell).The host used according to the recombinant production scheme, polypeptide of the present invention can be glycosylated, maybe can be nonglycosylated.Polypeptide of the present invention also can comprise or not comprise initial methionine residues.
The present invention also comprises the proteic fragment of people hOLF50, derivative and analogue.As used herein, term " fragment ", " derivative " are meant with " analogue " and keep identical biological function of natural human hOLF50 albumen of the present invention or active polypeptide basically.Polypeptide fragment of the present invention, derivative or analogue can be that (i) has one or more conservative or substituted polypeptide of non-conservation amino-acid residue (preferred conservative amino acid residue), and the amino-acid residue of such replacement can be also can not encoded by genetic code, or (ii) in one or more amino-acid residues, has a polypeptide of substituted radical, or (iii) mature polypeptide and another compound (such as the compound that prolongs the polypeptide transformation period, polyoxyethylene glycol for example) merges formed polypeptide, or (iv) additional aminoacid sequence is fused to this peptide sequence and the polypeptide that forms (as leader sequence or secretion sequence or be used for the sequence or the proteinogen sequence of this polypeptide of purifying, or with the fusion rotein of the segmental formation of antigen I gG).According to the instruction of this paper, these fragments, derivative and analogue belong to the known scope of those skilled in the art.
In the present invention, term " people hOLF50 polypeptide " refers to have the SEQ IDNO:2 or 3 polypeptide of sequence of people hOLF50 protein-active.This term also comprises having and variant forms people hOLF50 albumen identical function, SEQ IDNO:2 or 3 sequences.These variant forms comprise (but being not limited to): one or more (it is individual to be generally 1-50, preferably 1-30, more preferably 1-20,1-10 best) amino acid whose disappearance, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally in 20, preferably being in 10, more preferably is in 5) amino acid.For example, in the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic function usually.This term also comprises proteic active fragments of people hOLF50 and reactive derivative.
The variant form of this polypeptide comprises: homologous sequence, conservative property varient, allelic variant, natural mutation, induced mutation body, under high or low tight degree condition can with the coded albumen of the DNA of people hOLF50 DNA hybridization and the polypeptide or the albumen that utilize the antiserum(antisera) of anti-people hOLF50 polypeptide to obtain.The present invention also provides other polypeptide, as comprises people hOLF50 polypeptide or its segmental fusion rotein (fusion rotein shown in SEQ ID NO:3).Except the polypeptide of total length almost, the present invention has also comprised the soluble fragments of people hOLF50 polypeptide.Usually, this fragment have people hOLF50 peptide sequence at least about 10 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, best at least about 100 continuous amino acids.
Invention also provides the analogue of people hOLF50 albumen or polypeptide.The difference of these analogues and natural human hOLF50 polypeptide can be the difference on the aminoacid sequence, also can be the difference that does not influence on the modified forms of sequence, perhaps haves both at the same time.These polypeptide comprise natural or the inductive genetic variant.The induce variation body can obtain by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also can pass through site-directed mutagenesis method or the biological technology of other known moleculars.Analogue also comprises having the analogue that is different from the amino acid whose residue of natural L-(as D-amino acid), and has non-natural analogue that exist or synthetic amino acid (as β, gamma-amino acid).Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.
(the not changing primary structure usually) form of modification comprises: the chemically derived form such as the acetylize or carboxylated of the polypeptide that body is interior or external.Modification also comprises glycosylation, carries out glycosylation modified and polypeptide that produce in the procedure of processing as those in the synthetic and processing of polypeptide or further.This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) and finishes by polypeptide is exposed to.Modified forms also comprises have the phosphorylated amino acid residue sequence of (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the polypeptide that has been improved its anti-proteolysis performance or optimized solubility property by modifying.
In the present invention, " people hOLF50 albumen conservative property variation polypeptide " refers to compare with the aminoacid sequence of SEQ ID NO:2 or 3, has 10 at the most, preferably at the most 8, more preferably at the most 5,3 amino acid is replaced by similar performance or close amino acid and is formed polypeptide at the most best.These conservative property variation polypeptide preferably carry out the amino acid replacement according to table 1 and produce.
Table 1
| Initial residue | Representational replacement | The preferred replacement |
| Ala(A) | Val；Leu；Ile | Val |
| Arg(R) | Lys；Gln；Asn | Lys |
| Asn(N) | Gln；His；Lys；Arg | Gln |
| Asp(D) | Glu | Glu |
| Cys(C) | Ser | Ser |
| Gln(Q) | Asn | Asn |
| Glu(E) | Asp | Asp |
| Gly(G) | Pro；Ala | Ala |
| His(H) | Asn；Gln；Lys；Arg | Arg |
| Ile(I) | Leu；Val；Met；Ala；Phe | Leu |
| Leu(L) | Ile；Val；Met；Ala；Phe | Ile |
| Lys(K) | Arg；Gln；Asn | Arg |
| Met(M) | Leu；Phe；Ile | Leu |
| Phe(F) | Leu；Val；Ile；Ala；Tyr | Leu |
| Pro(P) | Ala | Ala |
| Ser(S) | Thr | Thr |
| Thr(T) | Ser | Ser |
| Trp(W) | Tyr；Phe | Tyr |
| Tyr(Y) | Trp；Phe；Thr；Ser | Phe |
| Val(V) | Ile；Leu；Met；Phe；Ala | ?Leu |
Polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:1 or the varient of degeneracy.As used herein, " varient of degeneracy " is meant that in the present invention coding has the protein of SEQ ID NO:2 or 3, but with the differentiated nucleotide sequence of coding region sequence shown in the SEQ ID NO:1.
The polynucleotide of coding SEQ ID NO:2 or 3 mature polypeptide comprise: the encoding sequence of an encoding mature polypeptide; The encoding sequence of mature polypeptide and various additional code sequence; The encoding sequence of mature polypeptide is (with optional additional code sequence 1 and non-coding sequence.
Term " polynucleotide of coded polypeptide " can be the polynucleotide that comprise this polypeptide of encoding, and also can be the polynucleotide that also comprise additional code and/or non-coding sequence.
The invention still further relates to the varient of above-mentioned polynucleotide, its coding has the polypeptide of identical aminoacid sequence or fragment, analogue and the derivative of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing the function of its encoded polypeptides in fact.
The invention still further relates to and above-mentioned sequence hybridization and two sequences between have at least 50%, preferably at least 70%, the polynucleotide of at least 80% homogeny more preferably.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide of the present invention.In the present invention, " stringent condition " is meant: (1) than hybridization under low ionic strength and the comparatively high temps and wash-out, as 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time is added with denaturing agent, as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 90%, be more preferably 95% and just hybridize when above.And the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in SEO ID NO:2 or 3.
The invention still further relates to nucleic acid fragment with above-mentioned sequence hybridization.As used herein, the length of " nucleic acid fragment " contains 15 Nucleotide at least, better is at least 30 Nucleotide, is more preferably at least 50 Nucleotide, preferably more than at least 100 Nucleotide.Nucleic acid fragment can be used for the amplification technique (as PCR) of nucleic acid to determine and/or the proteic polynucleotide of separation coding hOLF50.
Polypeptide among the present invention and polynucleotide preferably provide with isolating form, more preferably are purified to homogeneous.
People hOLF50 Nucleotide full length sequence of the present invention or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence.When sequence is longer, usually needs to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplifies is stitched together by proper order.
In case obtained relevant sequence, just can obtain relevant sequence in large quantity with recombination method.This normally is cloned into carrier with it, changes cell again over to, separates obtaining relevant sequence then from the host cell after the propagation by ordinary method.
In addition, also the method for available synthetic is synthesized relevant sequence, especially fragment length more in short-term.Usually, by first synthetic a plurality of small segments, and then connect and to obtain the very long fragment of sequence.
At present, can be fully obtain the dna sequence dna of code book invention albumen (or its fragment, or derivatives thereof) by chemosynthesis.This dna sequence dna can be introduced in various existing dna moleculars as known in the art (or as carrier) and the cell then.In addition, also can will suddenly change and introduce in the protein sequence of the present invention by chemosynthesis.
Use method (Saiki, the et al.Science 1985 of round pcr DNA amplification/RNA; 230:1350-1354) be optimized for acquisition gene of the present invention.When particularly being difficult to obtain the cDNA of total length from the library, can preferably use RACE method (the terminal rapid amplifying method of RACE-cDNA), the primer that is used for PCR can suitably be selected according to sequence information of the present invention disclosed herein, and available ordinary method is synthetic.Available ordinary method is as the DNA/RNA fragment by gel electrophoresis separation and purifying amplification.
The present invention also relates to comprise the carrier of polynucleotide of the present invention, and the host cell that produces through genetically engineered with carrier of the present invention or hOLF50 albumen coded sequence, and the method that produces polypeptide of the present invention through recombinant technology.
Recombinant DNA technology (Science, 1984 by routine; 224:1431), can utilize polymerized nucleoside acid sequence of the present invention to can be used to express or produce the hOLF50 polypeptide of reorganization.In general following steps are arranged:
(1). with the polynucleotide (or varient) of coding of the present invention people hOLF50 polypeptide, or with the recombinant expression vector that contains these polynucleotide proper host cell that transforms or transduce;
(2). the host cell of in suitable medium, cultivating;
(3). separation, protein purification from substratum or cell.
Among the present invention, people hOLF50 polynucleotide sequence can be inserted in the recombinant expression vector.Term " recombinant expression vector " refers to that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carriers.The carrier of Shi Yonging includes but not limited in the present invention: and the expression vector based on T7 of in bacterium, expressing (Rosenberg, et al.Gene, 1987,56:125); The pMSXND expression vector of in mammalian cell, expressing (Lee and Nathans, J Bio Chem.263:3521,1988) and at the carrier that derives from baculovirus of expressed in insect cells.In a word, as long as can duplicate in host and stablize, any plasmid and carrier can be used.A key character of expression vector is to contain replication orgin, promotor, marker gene and translation controlling elements usually.
Method well-known to those having ordinary skill in the art can be used to make up and contains people hOLF50 DNA sequences encoding and suitable transcribing/the translate expression vector of control signal.These methods comprise (Sambroook, et al.Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory.New York, 1989) such as extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technologys of body.Described dna sequence dna can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; Lambda particles phage P
LPromotor; Eukaryotic promoter comprises LTRs and some other known may command gene expression promoter in protokaryon or eukaryotic cell or its virus of CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retrovirus.Expression vector also comprises ribosome bind site and the transcription terminator that translation initiation is used.
In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance.
Comprise the carrier of above-mentioned suitable dna sequence dna and suitable promotor or control sequence, can be used to transform appropriate host cell, so that it can marking protein.
Host cell can be a prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, streptomyces; The bacterial cell of Salmonella typhimurium; Fungal cell such as yeast; Vegetable cell; The insect cell of fruit bat S2 or Sf9; The zooblast of CHO, COS, 293 cells or Bowes melanoma cells etc.
When polynucleotide of the present invention are expressed in higher eucaryotic cells, be enhanced if will make to transcribe when in carrier, inserting enhancer sequence.Enhanser is the cis acting factor of DNA, and nearly 10 to 300 base pairs act on promotor transcribing with enhancing gene usually.Can for example be included in the SV40 enhanser of 100 to 270 base pairs of replication origin side in late period one, at the polyoma enhanser of replication origin side in late period one and adenovirus enhanser etc.
Persons skilled in the art all know how to select appropriate carriers, promotor, enhanser and host cell.
Can carry out with routine techniques well known to those skilled in the art with the recombinant DNA transformed host cell.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results
2Method is handled, and used step is well-known in this area.Another kind method is to use MgCl
2If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, conventional mechanical method such as microinjection, electroporation, liposome packing etc.
The transformant that obtains can be cultivated with ordinary method, expresses the polypeptide of coded by said gene of the present invention.According to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.
The extracellular can be expressed or be secreted into to recombinant polypeptide in the above methods in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.The example of these methods includes, but are not limited to: conventional renaturation handles, with protein precipitant handle (salt analysis method), centrifugal, the broken bacterium of infiltration, superly handle, the combination of super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.
The people hOLF50 albumen or the polypeptide of reorganization are of use in many ways.These purposes include, but is not limited to: the direct disease due to the low or forfeiture and be used to screen antibody, polypeptide or other part that promotes or resist the hOLF50 protein function as about thing treatment hOLF50 protein function.The peptide molecule that can suppress or stimulate people hOLF50 protein function that can be used for seeking therapeutic value with the recombinant human hOLF50 protein screening peptide library of expressing.
On the other hand, the present invention also comprises people hOLF50 DNA or the polypeptide of its fragment coding has specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody.Here, " specificity " is meant that antibody capable is incorporated into people hOLF50 gene product or fragment.Preferably, refer to that those can combine with people hOLF50 gene product or fragment but nonrecognition and be incorporated into the antibody of other irrelevant antigen molecule.Among the present invention antibody comprise those can in conjunction with and suppress the proteic molecule of people hOLF50, comprise that also those do not influence the antibody of people hOLF50 protein function.The present invention also comprise those can with modify or without the people hOLF50 gene product bonded antibody of modified forms.
The present invention not only comprises complete mono-clonal or polyclonal antibody, but also comprises having immunocompetent antibody fragment, as Fab ' or (Fab)
2Fragment; Heavy chain of antibody; Light chain of antibody; Genetically engineered strand Fv molecule (people such as Ladner, U.S. Patent No. 4,946,778); Or chimeric antibody, as have the murine antibody binding specificity but still keep antibody from people's antibody moiety.
Antibody of the present invention can be prepared by the known various technology of those skilled in that art.For example, the people hOLF50 gene product of purifying or its have antigenic fragment, can be applied to animal to induce the generation of polyclonal antibody.Similarly, expressing human hOLF50 albumen or its have antigenic segmental cell and can be used to immune animal and produce antibody.Antibody of the present invention also can be monoclonal antibody.This type of monoclonal antibody can utilize hybridoma technology prepare (see people such as Kohler,
Nature256; 495,1975; People such as Kohler,
Eur.J.Immunol.6:511,1976; People such as Kohler,
Eur.J.Immunol.6:292,1976; People such as Hammerling,
In Monoclonal Antibodies and T Cell Hybridomas, Elsevier, N.Y., 1981).Antibody of the present invention comprises the antibody that can block people hOLF50 protein function and the antibody that does not influence people hOLF50 protein function.Each antibody-like of the present invention can utilize the fragment or the functional zone of people hOLF50 gene product, obtains by the routine immunization technology.These fragments or functional zone can utilize recombinant methods or utilize Peptide synthesizer synthetic.Can come immune animal and produce with the gene product of producing in the prokaryotic cell prokaryocyte (for example E.Coli) with the unmodified form bonded antibody of people hOLF50 gene product; With posttranslational modification form bonded antibody (as the albumen or the polypeptide of glycosylation or phosphorylation), can come immune animal and obtain with the gene product that produces in the eukaryotic cell (for example yeast or insect cell).
The proteic antibody of anti-people hOLF50 can be used in the immunohistochemistry technology, detects the people hOLF50 albumen in the biopsy specimen.
Antibody among the present invention can be used for treating or prevention and the relevant disease of people hOLF50 albumen.The antibody that gives suitable dosage can stimulate or block proteic generation of people hOLF50 or activity.
Antibody also can be used for being designed to the immunotoxin at a certain privileged sites in the body.As the monoclonal antibody of people hOLF50 albumen high-affinity can with bacterium or plant poison (as diphtheria toxin, ricin, abrine etc.) covalent attachment.A kind of usual method is with sulfydryl linking agent such as SPDP, attacks the amino of antibody, by the exchange of disulfide linkage, toxin is incorporated on the antibody, and this hybrid antibody can be used for killing the cell of people hOLF50 protein positive.
The production of polyclonal antibody can choose hOLF50 albumen or polypeptide immune animal, as rabbit, mouse, rat etc.Multiple adjuvant can be used for the enhancing immunity reaction, includes but not limited to freund's adjuvant etc.
Utilize albumen of the present invention,, can filter out with hOLF50 albumen interactional material takes place, as acceptor, inhibitor, agonist or antagonist etc. by various conventional screening methods.
Albumen of the present invention and antibody thereof, inhibitor, agonist, antagonist or acceptor etc. when using (administration) in treatment, can provide different effects.Usually, can these materials are formulated in nontoxic, inert and the pharmaceutically acceptable aqueous carrier medium, wherein pH is about 5-8 usually, and preferably pH is about 6-8, although the pH value can be with being changed to some extent by preparation Substance Properties and illness to be treated.The pharmaceutical composition for preparing can carry out administration by conventional route, comprising (but being not limited to): intramuscular, intraperitoneal, intravenously, subcutaneous, intracutaneous or topical.
Polypeptide of the present invention can be directly used in disease treatment, for example, is used for the treatment of nerve degenerative diseases aspect.When using hOLF50 albumen of the present invention, also can use the other treatment agent simultaneously.
The present invention also provides a kind of pharmaceutical composition, and it contains hOLF50 polypeptide of the present invention or its agonist, antagonist and the pharmaceutically acceptable carrier or the vehicle of safe and effective amount.This class carrier comprises (but being not limited to): salt solution, damping fluid, glucose, water, glycerine, ethanol and combination thereof.Pharmaceutical preparation should be complementary with administering mode.Pharmaceutical composition of the present invention can be made into the injection form, for example is prepared by ordinary method with the physiological saline or the aqueous solution that contains glucose and other assistant agents.Pharmaceutical composition such as tablet and capsule can be prepared by ordinary method.Pharmaceutical composition such as injection, solution, tablet and capsule should be made under aseptic condition.The dosage of activeconstituents is the treatment significant quantity, for example every day about 1 microgram/kg body weight-Yue 5 mg/kg body weight.In addition, polypeptide of the present invention also can use with the other treatment agent.
When making pharmaceutical composition, be that the hOLF50 albumen of safe and effective amount or its antagonist, agonist are applied to Mammals, wherein this safe and effective amount is usually at least about 10 micrograms/kg body weight, and in most of the cases be no more than about 8 mg/kg body weight, preferably this dosage is about 10 micrograms/kg body weight-Yue 1 mg/kg body weight.Certainly, concrete dosage also should be considered factors such as route of administration, patient health situation, and these all are within the skilled practitioners skill.
The proteic polynucleotide of people hOLF50 also can be used for multiple therapeutic purpose.Gene therapy technology can be used for treating because cell proliferation, growth or the metabolic disturbance due to the proteic expression of hOLF50 of the proteic nothing expression of hOLF50 or unusual/non-activity.The hOLF50 albumen that the gene therapy vector (as virus vector) of reorganization can be designed to express variation is to suppress endogenic hOLF50 protein-active.Deriving from viral expression vector such as retrovirus, adenovirus, adeno-associated virus (AAV), hsv, parvovirus etc. can be used for the hOLF50 transgenosis to cell.The method that structure carries the recombinant viral vector of hOLF50 gene is found in existing document (Sambrook, et al.).Recombinant human hOLF50 gene can be packaged in the liposome in addition, and then is transferred in the cell.
Suppress the oligonucleotide (comprising sense-rna and DNA) of people hOLF50 mRNA and ribozyme also within the scope of the invention.Ribozyme is the enzyme sample RNA molecule that a kind of energy specificity is decomposed specific RNA, and its mechanism of action is to carry out the endonuclease effect after ribozyme molecule and the hybridization of complementary target RNA-specific.The RNA of antisense and DNA and ribozyme can obtain with existing any RNA or DNA synthetic technology, as the technology widespread use of solid phase phosphoamide chemical synthesis synthetic oligonucleotide.Antisense rna molecule can be transcribed acquisition by the dna sequence dna of this RNA that encodes in external or body.This dna sequence dna has been incorporated into the downstream of rna polymerase promoter of carrier.In order to increase the stability of nucleic acid molecule, available several different methods is modified it, and as increasing the sequence length of both sides, the connection between the ribonucleoside is used phosphoric acid thioester bond or peptide bond but not phosphodiester bond.
Polynucleotide imports tissue or intracellular method comprises: directly be injected into polynucleotide in the in-vivo tissue; Or external by carrier (as virus, phage or plasmid etc.) earlier with the polynucleotide transfered cell in, again cell is transplanted in the body etc.
Can be incorporated into the rondom polypeptide storehouse that solid formation forms by the various amino acid that may make up by screening with the protein bound peptide molecule of people hOLF50 obtains.During screening, must carry out mark to people hOLF50 protein molecular.
The invention still further relates to the diagnostic testing process of quantitative and detection and localization people hOLF50 protein level.These tests are known in the art, and comprise that FISH measures and radioimmunoassay.The people hOLF50 protein level that is detected in the test can be with laying down a definition the importance of people hOLF50 albumen in various diseases and be used to the disease of diagnosing hOLF50 albumen to work.
Whether having the proteic method of hOLF50 in a kind of detection test sample is to utilize the proteic specific antibody of hOLF50 to detect, and it comprises: sample is contacted with the hOLF50 protein specific antibody; Observe whether form antibody complex, formed antibody complex and just represented to exist in the sample hOLF50 albumen.
The proteic polynucleotide of hOLF50 can be used for the diagnosis and the treatment of hOLF50 protein related diseases.Aspect diagnosis, the proteic polynucleotide of hOLF50 can be used for detecting the proteic expression of hOLF50 hOLF50 abnormal exprssion whether or under morbid state.Can be used for the hybridization of biopsy specimen to judge the proteic abnormal expression of hOLF50 as the hOLF50 dna sequence dna.Hybridization technique comprises the Southern blotting, Northern blotting, in situ hybridization etc.These technological methods all are disclosed mature technologies, and relevant test kit all can obtain from commercial channels.Part or all of polynucleotide of the present invention can be used as probe stationary on microarray (microarray) or DNA chip (being called " gene chip " again), is used for analyzing the differential expression analysis and the gene diagnosis of tissue gene.Carry out RNA-polymerase chain reaction (RT-PCR) amplification in vitro with the special primer of hOLF50 albumen and also can detect the proteic transcription product of hOLF50.
The sudden change that detects the hOLF50 gene also can be used for the disease of diagnosing hOLF50 albumen relevant.The form of hOLF50 protein mutation comprises that the point mutation compared with normal wild type hOLF50 dna sequence dna, transposition, disappearance, reorganization and other are any unusual etc.Available existing technology such as Southern blotting, dna sequence analysis, PCR and in situ hybridization detect sudden change.In addition, sudden change might influence proteic expression, therefore can judge indirectly that with Northern blotting, Western blotting gene has or not sudden change.
Sequence of the present invention identifies it also is valuable to karyomit(e).In brief, the proteic cDNA of hOLF50 prepares PCR primer (preferred 15-35bp) according to the present invention, sequence can be positioned on the karyomit(e).Then, these primers are used for the somatocyte hybrid cell that the PCR screening contains each bar human chromosome.Have only those hybrid cells that contain corresponding to the people's gene of primer can produce the fragment of amplification.
In case sequence is positioned to chromosome position accurately, the physical location of this sequence on karyomit(e) just can be associated with the gene map data.These data for example are found in, V.Mckusick, Mendelian Inheritance inMan (can by with the online acquisition of Johns Hopkins University Welch Medical Library).Can pass through linkage analysis then, determine gene and navigated to relation between the disease on the chromosomal region already.
In an example of the present invention, a kind of isolating polynucleotide are provided, its coding has the polypeptide of aminoacid sequence shown in SEQ ID NO:2 or 3.Polynucleotide of the present invention are isolated from people's hypothalamus cDNA library.Its sequence is shown in SEQ ID N0:1, and the polynucleotide sequence total length that it comprises is 2741 bases, and its open reading frame is positioned at the 286-1686 position, and the coding total length is 467 amino acid whose people hOLF50 albumen (SEQ IDNO:2).Can be diseases such as treating nerve degenerative diseases new treatment approach is provided, thereby have great application prospect.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:Cold SpringHarbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
The clone of embodiment 1:hOLF50 albumen cDNA
1. separate tissue (Tissue isolation)
Hypothalamus derives from 5 normal adult male sex donors, takes out inferior colliculus cerebral tissue in after death four hours, places the freezing preservation of liquid nitrogen immediately.
2.mRNA separation (mRNA isolation)
Take out tissue, grind, add the 50ml pipe that fills lysate, fully after the vibration, move in the glass homogenizer again with mortar.Move to 50ml after the homogenate and newly manage, and extracted total RNA (TRIzol Reagents, Gibco, NY, USA).Identify total RNA quality with the denaturing formaldehyde gel electrophoresis.Cellulose column with band Oligo d (T) separates mRNA among total RNA, quantitatively.
3.cDNA the structure in library (Construction of cDNA library)
With mRNA is template, and synthetic double chain cDNA, reverse transcription primer are seen SEQ ID NO.1.After mending flat end, add the joint that contains the EcoRI point of contact, joint sequence is seen SEQ ID NO.2 and 3 respectively.Behind the phosphorylation EcoRI end, use XhoI digestion with restriction enzyme 1.5 hours, carry out fragment again and separate.Cross the fragment of post screening length＞500bp, use the phenol-chloroform extracting, ethanol sedimentation, the sterilized water dissolving, be connected to Uni-ZAP XR carrier (Stratagene, CA9203, USA), with Zap-cDNA Gigapack III Gold Cloning Kit (Stratagene, CA9203 USA) packs, and the host bacterium is used XL 1-Blue MRF ' (Stratagene, CA9203, USA) bacterium.Coated plate is also measured titre.
4. order-checking and database are set up (Seqencing and Database Constructing)
Select the clone who has the external source fragment to insert in the library, amplification back extracting plasmid (Qiagen, Germany), with T3 and T7 universal primer as 3 ' end and 5 ' hold, adopt thing fluorescent mark (Big-Dye, Perkin-Elmer, method USA) of stopping, (Perkin-Elmer carries out the EST large scale sequencing on USA) at ABI 377 sequenators.Sequencing result is removed the carrier sequence with FACTURA software, is transferred to the processing of carrying out next step on SUN Ultra 450 Server.All sequence informations are used the GCG software package again, and (Wisconsin group, USA) BLAST in and the existing database of FASTA software search (Genebank+EMBL) are lower than 95% sequence with no homology or homology and are considered as new gene and set up database.
5. the full-length clone of gene (Cloning of Full-length cDNA)
On the new gene fragment order information basis that obtains, carry out the cDNA full-length clone, carry out in two stages:
(1) " electronic cloning " (Electronic Cloning)
Search the dbEST database with new gene fragment order as probe, with overlap＞50bp, homology is at (the Expressed Sequence Tag of the expressed sequence tag more than 98%, being called for short " EST ") sequence thinks same sequence (consensus sequence), take out and splice with AUTOASSEMBLER software, part EST can the extension probes sequence.Whether the sequence that is extended with the STRIDER software analysis has complete open reading frame (Open Reading Frame again, ORF), on Nucleotide and amino acid levels, whether homology is arranged with definite this sequence with BLAST search Genbank or SwissProt, to help how differentiate resulting full length gene integrity with other species.By the method for electronic cloning, can obtain the full length sequence of hOLF50 gene usually.
(2) the terminal rapid amplifying of cDNA (Rapid Amplification of cDNA Ends, RACE)
If do not obtain complete cDNA total length yet by " electronic cloning " method, then at 5 of existing sequence ' or 3 ' end design primer, (Clontech Lab, Inc carry out the long range PCR reaction in USA) in human hypothalamus Marathon-Ready cDNA library.Then to PCR product cloning, order-checking.The sequence that is extended with AUTOASSEMBLER and STRIDER software analysis has or not complete ORF, as not having, repeats said process until obtaining total length.
(3)RT-PCR
For 5 ' and 3 ' end known sequences, if the centre still has an intersegmental crack (gap) to obtain from existing public database or its data storehouse, can consider to adopt the method for RT-PCR.At sequence 5 ' end design primer, 3 ' end primer adopts Oligo-dT, increases in the total RNA of hypothalamus storehouse.Then product is cloned, checked order.Splice at last and obtain total length.
By being used in combination above-mentioned 3 kinds of methods, obtained candidate's the proteic complete encoding sequence of people hOLF50.Obtain on the total length basis of (comprising complete open reading frame at least) in splicing, further design primer HOFL50-F:5 ' GCTCTAGACCTGCATGCCAGGTCGTT 3 ' (SEQ ID NO:4) is a forward primer, Oligonucleolide primers HOFL50-R:5 ' CGGAATTCTCAACTCGTCGGAGCGGAT 3 is a reverse primer, total RNA with inferior colliculus cerebral tissue is a template, carry out the RT-PCR amplification, the PCR condition is 94 ℃, 4 minutes, thereupon with 94 ℃, 30 seconds, 54 ℃, 30 seconds and 72 ℃, carried out 35 circulations, and extended 5 minutes with 72 ℃ at last in 1 minute 30 seconds.Electrophoresis detection pcr amplification product, acquisition expanding fragment length are 1423bp (see Fig. 2, contain complete ORF, corresponding to 286-1689 position among the SEQ ID NO:1).Clone, be built into pcDNA3.1/Myc-His (-) A (available from Invitrogen company) of purchase then according to a conventional method with pcr amplification product, called after pcDNA-hOLF50 sequence verification sequence and reading frame are correct.
Sequence to the ORF upstream and downstream also checks order with similar approach simultaneously, has finally obtained the sequence shown in the SEQ IDNO:1.HOLF50 cDNA is 2741bp (Figure 1A and SEQ ID NO:1), contains complete open frame, and coding contains the full-length polypeptide (Fig. 2 B and SEQ ID NO:2 or 3) of 467 amino-acid residues.Analytical results has shown that hOLF50 albumen contains the signal peptide that 35 amino-acid residues are formed, and sophisticated peptide molecule is formed (SEQ ID NO:3) by 432 amino-acid residues.
Embodiment 2
The sequence information of hOLF50 gene and homology analysis
Full length cDNA sequence and the coded protein thereof of hOLF50 are carried out Nucleotide and protein homology retrieval and domain analyses with blast program in Non-redundantGenBank+EMBL+DDBJ+PDB and Non-redundant GenBank CDS translations+PDB+SwissProt+Superdate+PIR database.Found that:
(1) chromosomal localization: map=9q34.3 contains 6 exons (exon).
(2) protein function structural domain (Domain):
1-35: signal peptide
210-460:Olfactomedin spline structure territory
The 464-467:ER-Target motif
The Olfactomedin family member mainly is present in central nervous system, plays an important role in sense of smell, neurosecretion and neurodevelopment, and the family member who has been found that at present has olfactomedin, Noelin-1, latrophilin-1 and TIGR etc.
In addition, the similarity of hOLF50 and mouse AAC04320 gene is up to 97%, the homologous gene Pancortin-3 of mouse, and similarity is up to 97%, and these two genes are not all done any functional study, are the Unknown Function gene.Very ironically found homologous gene NOELIN-2 in sibship chicken far away, similarity is up to 95%, the function of NOELIN-2 be in August, 2000 just by Barembaum M, Moreno TA (NatCell Biol.2000 Apr; 2 (4): 219-25, Barembaum M, Moreno TA, LaBonne C, Sechrist J, Bronner-Fraser M.) etc. disclose, they find in the nervus centralis early development of chicken, secretory protein NOELIN-2 can promote neurocele (neural tube) to produce neural crest (neural crest) cell, and to early embryonic development, the growth of particularly early stage central nervous system has played keying action.
People hOLF50 of the present invention is used for further functional study except can be used as this family's a member, also can be used for producing fusion rotein with other albumen, such as producing fusion rotein with immunoglobulin (Ig).In addition, inventor hOLF50 can also merge with other members of this family or exchange fragment, to produce new albumen.For example proteic N end of inventor hOLF50 and the proteic N end of rat eIF2a are exchanged, to produce the albumen that new activity is higher or have new features.
At the antibody of inventor hOLF50, be used to screen other members of this family, perhaps be used for affinity purification associated protein (as other members of this family).
In addition, inventor hOLF50 nucleic acid (encoding sequence or antisense sequences) can be introduced into cell, with expression level that improves people hOLF50 or the overexpression that suppresses people hOLF50.People hOLF50 albumen of the present invention or its active polypeptide fragment can be applied to patient, with treatment or alleviate because of people hOLF50 disappearance, no function or unusual cause related disorders arranged.In addition, can also be with carrying out relevant diagnosis or prognosis judgement based on nucleotide sequence of the present invention or antibody.
Because people hOLF50 albumen of the present invention has the natural acid sequence that is derived from the people, therefore, compare with the albumen of the same clan that derives from other species (as rat), estimate to have higher active and/or lower side effect (for example in the intravital immunogenicity of people lower or do not have) being applied to man-hour.
Embodiment 3
The transient expression of HOLF
With liposome method the plasmid pcDNA-hOLF5 of preparation among the embodiment 1 is transfected in the COS-7 cell, cultivates after three days, get cells and supernatant and do Western blot detection.
Plasmid pcDNA-hOLF50 transient transfection COS-7 cell, detect cell conditioned medium and cell lysate with Western blot, with the positive contrast of h-GH (tethelin), the negative contrast of unloaded pcDNA3.1-A are set.
The result shows that the hOLF50 gene is a secreted protein gene (Fig. 3).
Embodiment 4
The distribution expression pattern of hOLF50
By ordinary method, use normal adult 12 tissue films (MTN) available from Clontech company, be template with the coding region fragment of hOLF50, preparation cDNA isotopic labeling probe carries out standard N orthern engram analysis.
The result shows, in narrow spectrum expression of hOLF50 gene and the brain (Fig. 4).
Embodiment 5
The eukaryotic expression of hOLF50
With liposome method plasmid pcDNA-HOLF5 is transfected in the COS-7 cell, cultivate after three days, using the substratum that contains G418 instead continues to cultivate, thereby screening positive clone (contains the cell that inserts the hOLF50 gene, has obtained to be used for the proteic CHO stable expression cell strain of mass production eucaryon product hOLF50 (totally 9 cell strains).
Western blot detected result shows the Chinese hamster ovary celI strain great expression hOLF50 (the about 60KDa of molecular weight) of these conversions as shown in Figure 5.
The prokaryotic expression of hOLF50
Synthetic following primer
Forward primer: HOLF50-GSTF-F (EcoRI:G AATTC) correspondence position is the 391-409 position among the SEQ IDNO:1
5′GGAATTC?ACCAACCCTGAGGAGAGCT?3′(SEQ?ID?NO：6)
Reverse primer: HOLF50-FR300-R (Not I:G CGGCCGC) correspondence position is the 1290-1273 position among the SEQ IDNO:1
5′AAATATGCGGCCGC?CGAGTGGCCACCCCAGGC?3′(SEQ?ID?NO：7)
The cDNA that forms with the hypothalamus mRNA of plasmid pcDNA-HOLF5 or reverse transcription is a template, obtain amplified production (the 391-1290 position among corresponding Figure 1A and the SEQ ID NO:1,300 amino acid of N end of coding hOLF50 gene), after cutting, EcoRI and Not I enzyme be built into prokaryotic expression carrier pGEX-5x-1, transform and import the BL21 bacterium, induced about 3 to 5 hours centrifugal receipts bacterium, ultrasonic degradation cell with IPTG.Separate the fusion rotein (the about 60Kda of molecular weight) that obtains the GST-hOLF50N end fragment.
The result as shown in Figure 6.Band+person induces for IPTG is arranged, thereby gives expression to positive control and hOLF50 protein fragments, does not express and do not add IPTG person.
Embodiment 7
HOLF50 is to the promoter action of nerve growth
Test method:
The culture supernatant (containing 5% calf serum) of the cell strain CHO of the expression hOLF50 of embodiment 5 preparation is added in the PC-12 cell culture medium, cultivate according to a conventional method.
The result:
Can see that PC-12 cell (rat is had a liking for the chromium oncocyte, a kind of model cell of neural system research) grew the projection of cynapse sample in about 7 days, and blank (not adding any material) and negative (adding contrast Chinese hamster ovary celI culture supernatant) contrast all there is not this phenomenon.This shows that albumen hOLF50 of the present invention has the function (Fig. 7) that promotes nerve growth and form spinous process.
Embodiment 8
The preparation of anti-people hOLF50 antibody
1. the preparation of immune mouse and splenocyte: it is standby that the hOLF50 albumen that obtains among embodiment 5 and the embodiment 6 is separated the back with chromatography, also can separate with the SDS-PAGE gel electrophoresis, electrophoretic band is cut off from gel, and with isopyknic complete Freund ' s adjuvant emulsion.Get the female mouse of 6-8 week Balb/C in age, the albumen with 50-100 μ g/0.2ml emulsification carries out peritoneal injection to mouse.After 14 days, with the same antigen of non-complete Freund ' s adjuvant emulsion to mouse with the dosage of 50-100 μ g/0.2ml again booster immunization once be used for after 3-5 days merging.Wherein, E Zheng chief editor, " tissue culture and molecular cell learn a skill ", Beijing Publishing House, the 210th page are seen in the splenocyte preparation.
2. by " tissue culture and molecular cell learn a skill " (the same), the method in the 630th page, preparation feeder cell.
3. by " tissue culture and molecular cell learn a skill " (the same), the method in the 213rd page is carried out cytogamy.
4. detection of antibodies: after cytogamy 10-15 days, need to check by the hole, in case find vigorous hybrid cell colony growth, just use hOLF50 albumen and do the preliminary screening of antibody activity, method commonly used has: immunofluorescent test, emission immunity test (RIA), enzyme linked immunosorbent assay (ELISA).After checking out the hole of antibody activity, clone cultivation at once, and isolate antibody.
Discuss:
From the angle of pharmacological agent, secretory protein has occupied the overwhelming majority of protein drug treatment, for example some tissue-specific plasminogen activating factors, erythropoietin, proteohormone and digestive ferment etc.These protein drugs are significant in many fields such as hormone regulation, pain relief, blood coagulation, immune response, cancer generation, vasculogenesis.
HOLF50 albumen is the new secretory protein that the inventor screens, and very meaningfully it is only narrow spectrum in people's cerebral tissue great expression, and more is expressed in hippocampus (Hippocampus).In central nervous system is grown and kept, play an important role, having the potential exploitation to be worth aspect nerve degenerative diseases treatment and the learning and memory.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table
＜110〉Research Center of Shanghai Human Genome
＜120〉nervous system development associated protein and encoding sequence thereof and purposes
<130>034758
<160>7
<170>PatentIn?version?3.1
<210>1
<211>2741
<212>DNA
＜213〉homo sapiens (Homo sapiens)
<220>
<221>CDS
<222>(286)..(1686)
<223>
<400>1
gcgcggggga?gccattagga?ggcgaggaga?gaggagggcg?cagctcccgc?ccagcccagc?????60
cctgcccagc?cctgcccgga?ggcagacgcg?ccggaaccgg?gacgcgataa?atatgcagag????120
cggaggcttc?gcgcagcaga?gcccgcgcgc?cgcccgctcc?gggtgctgaa?tccaggcgtg????180
gggacacgag?ccaggcgccg?ccgccggagc?cagcggagcc?ggggccagag?ccggagcgcg????240
tccgcgtcca?cgcagccgcc?ggccggccag?cacccagggc?cctgc?atg?cca?ggt?cgt????297
Met?Pro?Gly?Arg
1
tgg?agg?tgg?cag?cga?gac?atg?cac?ccg?gcc?cgg?aag?ctc?ctc?agc?ctc??????345
Trp?Arg?Trp?Gln?Arg?Asp?Met?His?Pro?Ala?Arg?Lys?Leu?Leu?Ser?Leu
5???????????????????10??????????????????15??????????????????20
ctc?ttc?ctc?atc?ctg?atg?ggc?act?gaa?ctc?act?caa?gtg?ctg?ccc?acc??????393
Leu?Phe?Leu?Ile?Leu?Met?Gly?Thr?Glu?Leu?Thr?Gln?Val?Leu?Pro?Thr
25??????????????????30??????????????????35
aac?cct?gag?gag?agc?tgg?cag?gtg?tac?agc?tct?gcc?cag?gac?agc?gag??????441
Asn?Pro?Glu?Glu?Ser?Trp?Gln?Val?Tyr?Ser?Ser?Ala?Gln?Asp?Ser?Glu
40??????????????????45??????????????????50
ggc?agg?tgt?atc?tgc?aca?gtg?gtc?gcc?cca?cag?cag?acc?atg?tgt?tca??????489
Gly?Arg?Cys?Ile?Cys?Thr?Val?Val?Ala?Pro?Gln?Gln?Thr?Met?Cys?Ser
55??????????????????60??????????????????65
cgg?gat?gcc?cgc?aca?aaa?cag?ctg?agg?cag?cta?ctg?gag?aag?gtg?cag??????537
Arg?Asp?Ala?Arg?Thr?Lys?Gln?Leu?Arg?Gln?Leu?Leu?Glu?Lys?Val?Gln
70??????????????????75??????????????????80
aac?atg?tct?caa?tcc?ata?gag?gtc?ttg?gac?agg?cgg?acc?cag?aga?gac??????585
Asn?Met?Ser?Gln?Ser?Ile?Glu?Val?Leu?Asp?Arg?Arg?Thr?Gln?Arg?Asp
85??????????????????90??????????????????95??????????????????100
ttg?cag?tac?gtg?gag?aag?atg?gag?aac?caa?atg?aaa?gga?ctg?gag?tcc??????633
Leu?Gln?Tyr?Val?Glu?Lys?Met?Glu?Asn?Gln?Met?Lys?Gly?Leu?Glu?Ser
105?????????????????110?????????????????115
aag?ttc?aaa?cag?gtg?gag?gag?agt?cat?aag?caa?cac?ctg?gcc?agg?cag??????681
Lys?Phe?Lys?Gln?Val?Glu?Glu?Ser?His?Lys?Gln?His?Leu?Ala?Arg?Gln
120?????????????????125?????????????????130
ttt?aag?gcg?ata?aaa?gcg?aaa?atg?gat?gaa?crt?agg?cct?ttg?ata?cct??????729
Phe?Lys?Ala?Ile?Lys?Ala?Lys?Met?Asp?Glu?Leu?Arg?Pro?Leu?Ile?Pro
135?????????????????140?????????????????145
gtg?ttg?gaa?gag?tac?aag?gcc?gat?gcc?aaa?ttg?gta?ttg?cag?ttt?aaa??????777
Val?Leu?Glu?Glu?Tyr?Lys?Ala?Asp?Ala?Lys?Leu?Val?Leu?Gln?Phe?Lys
150?????????????????155?????????????????160
gag?gag?gtc?cag?aat?ctg?acg?tca?gtg?ctt?aac?gag?ctg?caa?gag?gaa??????825
Glu?Glu?Val?Gln?Asn?Leu?Thr?Ser?Val?Leu?Asn?Glu?Leu?Gln?Glu?Glu
165?????????????????170?????????????????175?????????????????180
att?ggc?gcc?tat?gac?tac?gat?gaa?ctt?cag?agc?aga?gtg?tcc?aat?ctt??????873
Ile?Gly?Ala?Tyr?Asp?Tyr?Asp?Glu?Leu?Gln?Ser?Arg?Val?Ser?Asn?Leu
185?????????????????190?????????????????195
gaa?gaa?agg?ctc?cgt?gca?tgc?atg?caa?aaa?cta?gct?tgc?ggg?aag?ttg??????921
Glu?Glu?Arg?Leu?Arg?Ala?Cys?Met?Gln?Lys?Leu?Ala?Cys?Gly?Lys?Leu
200?????????????????205?????????????????210
acg?ggc?atc?agt?gac?ccc?gtg?act?gtc?aag?acc?tcc?ggc?tcg?agg?ttc??????969
Thr?Gly?Ile?Ser?Asp?Pro?Val?Thr?Val?Lys?Thr?Ser?Gly?Ser?Arg?Phe
215?????????????????220?????????????????225
gga?tcc?tgg?atg?aca?gac?cct?ctc?gcc?cct?gaa?ggc?gat?aac?cgg?gtg?????1017
Gly?Ser?Trp?Met?Thr?Asp?Pro?Leu?Ala?Pro?Glu?Gly?Asp?Asn?Arg?Val
230?????????????????235?????????????????240
tgg?tac?atg?gac?ggc?tat?cac?aac?aac?cgc?ttc?gta?cgt?gag?tac?aag?????1065
Trp?Tyr?Met?Asp?Gly?Tyr?His?Asn?Asn?Arg?Phe?Val?Arg?Glu?Tyr?Lys
245?????????????????250?????????????????255?????????????????260
tcc?atg?gtt?gac?ttc?atg?aac?acg?gac?aat?ttc?acc?tcc?cac?cgt?ctc?????1113
Ser?Met?Val?Asp?Phe?Met?Asn?Thr?Asp?Asn?Phe?Thr?Ser?His?Arg?Leu
265?????????????????270?????????????????275
ccc?cac?ccc?tgg?tcg?ggc?acg?ggg?cag?gtg?gtc?tac?aac?ggt?tct?atc?????1161
Pro?His?Pro?Trp?Ser?Gly?Thr?Gly?Gln?Val?Val?Tyr?Asn?Gly?Ser?Ile
280?????????????????285?????????????????290
tac?ttc?aac?aag?ttc?cag?agc?cac?atc?atc?atc?agg?ttt?gac?ctg?aag?????1209
Tyr?Phe?Asn?Lys?Phe?Gln?Ser?His?Ile?Ile?Ile?Arg?Phe?Asp?Leu?Lys
295?????????????????300?????????????????305
aca?gag?acc?atc?ctc?aag?acc?cgc?agc?ctg?gac?tat?gcc?ggt?tac?aac?????1257
Thr?Glu?Thr?Ile?Leu?Lys?Thr?Arg?Ser?Leu?Asp?Tyr?Ala?Gly?Tyr?Asn
310?????????????????315?????????????????320
aac?atg?tac?cac?tac?gcc?tgg?ggt?ggc?cac?tcg?gac?atc?gac?ctc?atg?????1305
Asn?Met?Tyr?His?Tyr?Ala?Trp?Gly?Gly?His?Ser?Asp?Ile?Asp?Leu?Met
325?????????????????330?????????????????335?????????????????340
gtg?gac?gag?agc?ggg?ctg?tgg?gcc?gtg?tac?gcc?acc?aac?cag?aac?gct?????1353
Val?Asp?Glu?Ser?Gly?Leu?Trp?Ala?Val?Tyr?Ala?Thr?Asn?Gln?Asn?Ala
345?????????????????350?????????????????355
ggc?aac?atc?gtg?gtc?agt?agg?ctg?gac?ccc?gtg?tcc?ctg?cag?acc?ctg?????1401
Gly?Asn?Ile?Val?Val?Ser?Arg?Leu?Asp?Pro?Val?Ser?Leu?Gln?Thr?Leu
360?????????????????365?????????????????370
cag?acc?tgg?aac?acg?agc?tac?ccc?aag?cgc?agc?gcc?ggg?gag?gcc?ttc?????1449
Gln?Thr?Trp?Asn?Thr?Ser?Tyr?Pro?Lys?Arg?Ser?Ala?Gly?Glu?Ala?Phe
375?????????????????380?????????????????385
atc?atc?tgc?ggc?acg?ctg?tac?gtc?acc?aac?ggc?tac?tca?ggg?ggt?acc?????1497
Ile?Ile?Cys?Gly?Thr?Leu?Tyr?Val?Thr?Asn?Gly?Tyr?Ser?Gly?Gly?Thr
390?????????????????395?????????????????400
aag?gtc?cac?tat?gca?tac?cag?acc?aat?gcc?tcc?acc?tat?gaa?tac?atc?????1545
Lys?Val?His?Tyr?Ala?Tyr?Gln?Thr?Asn?Ala?Ser?Thr?Tyr?Glu?Tyr?Ile
405?????????????????410?????????????????415?????????????????420
gac?atc?cca?ttc?cag?aac?aaa?tac?tcc?cac?atc?tcc?atg?ctg?gac?tac?????1593
Asp?Ile?Pro?Phe?Gln?Asn?Lys?Tyr?Ser?His?Ile?Ser?Met?Leu?Asp?Tyr
425?????????????????430?????????????????435
aac?ccc?aag?gac?cgg?gcc?ctg?tat?gcc?tgg?aac?aac?ggc?cac?cag?atc?????1641
Asn?Pro?Lys?Asp?Arg?Ala?Leu?Tyr?Ala?Trp?Asn?Asn?Gly?His?Gln?Ile
440?????????????????445?????????????????450
ctc?tac?aac?gtg?acc?ctc?ttc?cac?gtc?atc?cgc?tcc?gac?gag?ttg?????????1686
Leu?Tyr?Asn?Val?Thr?Leu?Phe?His?Val?Ile?Arg?Ser?Asp?Glu?Leu
455?????????????????460?????????????????465
tagctccctc?ctcctggaag?ccaagggccc?acgtcctcac?cacaaaggga?ctcctgtgaa???1746
actgctgcca?aaaagatacc?aataacacta?acaataccga?tcttgaaaaa?tcatcagcag???1806
tgcggattct?gacatcgagg?gatggcatta?cctccgtgtt?tctccctttc?gagccggcgg???1866
gccacagacg?tcggaagaaa?ctcccgtatt?tgcagctgga?actgcagccc?acggcgcccc???1926
ggttttcctc?cccgccctgt?ccctctctgg?tcaaacaaca?tactaaagag?gcgaggcaat???1986
gactgttggc?cagttctcac?cggggaaaaa?cccactgtta?ggatggcatg?aacatttcct???2046
tagatcgtgg?tcagctccga?ggaatgtggc?gtccaggctc?tttgagagcc?atgggctgca???2106
cccggccgta?ggctagtgta?actcgcatcc?cattgcagtg?ccgtttcttg?actgtgttgc???2166
tgtctcttag?attaaccgtg?ctgaggctcc?acatagctcc?tggacctgtg?tctagtacat???2226
actgaagcga?tggtcagagt?gtgtagagtg?aagttgctgt?gcccacattg?tttgaactcg???2286
cgtaccccgt?agatacattg?tgcaacgttc?ttctgttatt?cccttgaggt?ggtaacttcg???2346
tatgttcagt?ttatgcgatg?attgttgtaa?atgcaatgcc?gtagtttgga?ttaataagtg???2406
gatggttttt?gtttctaaaa?agaaaaaaaa?aatcagtgtt?cacccttata?gagacatagt???2466
caagttcatg?ttgataataa?tcaaaggaat?tactctcttc?ttgttaaatt?agctaaatca???2526
tgtaaccgca?gataggaagg?gctcacctgg?ggaaactctg?gtttccgatg?ggacaggaaa???2586
gtcatacggg?caacagtatg?cggaaagtac?gtttttttaa?gtaaaaaaca?aaggcaaact???2646
ttgtactatc?cagttatcta?aggaacaata?aaaacattag?gagaaaaaaa?aaaaaaaaaa???2706
aaaaaaaaaa?aaaaaaaaaa?aaaaaaaaaa?aaaaa??????????????????????????????2741
<210>2
<211>467
<212>PRT
＜213〉homo sapiens (Homo sapiens)
<400>2
Met?Pro?Gly?Arg?Trp?Arg?Trp?Gln?Arg?Asp?Met?His?Pro?Ala?Arg?Lys
1???????????????5???????????????????10??????????????????15
Leu?Leu?Ser?Leu?Leu?Phe?Leu?Ile?Leu?Met?Gly?Thr?Glu?Leu?Thr?Gln
20??????????????????25??????????????????30
Val?Leu?Pro?Thr?Asn?Pro?Glu?Glu?Ser?Trp?Gln?Val?Tyr?Ser?Ser?Ala
35??????????????????40??????????????????45
Gln?Asp?Ser?Glu?Gly?Arg?Cys?Ile?Cys?Thr?Val?Val?Ala?Pro?Gln?Gln
50??????????????????55??????????????????60
Thr?Met?Cys?Ser?Arg?Asp?Ala?Arg?Thr?Lys?Gln?Leu?Arg?Gln?Leu?Leu
65??????????????????70??????????????????75??????????????????80
Glu?Lys?Val?Gln?Asn?Met?Ser?Gln?Ser?Ile?Glu?Val?Leu?Asp?Arg?Arg
85??????????????????90??????????????????95
Thr?Gln?Arg?Asp?Leu?Gln?Tyr?Val?Glu?Lys?Met?Glu?Asn?Gln?Met?Lys
100?????????????????105?????????????????110
Gly?Leu?Glu?Ser?Lys?Phe?Lys?Gln?Val?Glu?Glu?Ser?His?Lys?Gln?His
115?????????????????120?????????????????125
Leu?Ala?Arg?Gln?Phe?Lys?Ala?Ile?Lys?Ala?Lys?Met?Asp?Glu?Leu?Arg
130?????????????????135?????????????????140
Pro?Leu?Ile?Pro?Val?Leu?Glu?Glu?Tyr?Lys?Ala?Asp?Ala?Lys?Leu?Val
145?????????????????150?????????????????155?????????????????160
Leu?Gln?Phe?Lys?Glu?Glu?Val?Gln?Asn?Leu?Thr?Ser?Val?Leu?Asn?Glu
165?????????????????170?????????????????175
Leu?Gln?Glu?Glu?Ile?Gly?Ala?Tyr?Asp?Tyr?Asp?Glu?Leu?Gln?Ser?Arg
180?????????????????185?????????????????190
Val?Ser?Asn?Leu?Glu?Glu?Arg?Leu?Arg?Ala?Cys?Met?Gln?Lys?Leu?Ala
195?????????????????200?????????????????205
Cys?Gly?Lys?Leu?Thr?Gly?Ile?Ser?Asp?Pro?Val?Thr?Val?Lys?Thr?Ser
210?????????????????215?????????????????220
Gly?Ser?Arg?Phe?Gly?Ser?Trp?Met?Thr?Asp?Pro?Leu?Ala?Pro?Glu?Gly
225?????????????????230?????????????????235?????????????????240
Asp?Asn?Arg?Val?Trp?Tyr?Met?Asp?Gly?Tyr?His?Asn?Asn?Arg?Phe?Val
245?????????????????250?????????????????255
Arg?Glu?Tyr?Lys?Ser?Met?Val?Asp?Phe?Met?Asn?Thr?Asp?Asn?Phe?Thr
260?????????????????265?????????????????270
Ser?His?Arg?Leu?Pro?His?Pro?Trp?Ser?Gly?Thr?Gly?Gln?Val?Val?Tyr
275?????????????????280?????????????????285
Asn?Gly?Ser?Ile?Tyr?Phe?Asn?Lys?Phe?Gln?Ser?His?Ile?Ile?Ile?Arg
290?????????????????295?????????????????300
Phe?Asp?Leu?Lys?Thr?Glu?Thr?Ile?Leu?Lys?Thr?Arg?Ser?Leu?Asp?Tyr
305?????????????????310?????????????????315?????????????????320
Ala?Gly?Tyr?Asn?Asn?Met?Tyr?His?Tyr?Ala?Trp?Gly?Gly?His?Ser?Asp
325?????????????????330?????????????????335
Ile?Asp?Leu?Met?Val?Asp?Glu?Ser?Gly?Leu?Trp?Ala?Val?Tyr?Ala?Thr
340?????????????????345?????????????????350
Asn?Gln?Asn?Ala?Gly?Asn?Ile?Val?Val?Ser?Arg?Leu?Asp?Pro?Val?Ser
355?????????????????360?????????????????365
Leu?Gln?Thr?Leu?Gln?Thr?Trp?Asn?Thr?Ser?Tyr?Pro?Lys?Arg?Ser?Ala
370?????????????????375?????????????????380
Gly?Glu?Ala?Phe?Ile?Ile?Cys?Gly?Thr?Leu?Tyr?Val?Thr?Asn?Gly?Tyr
385?????????????????390?????????????????395?????????????????400
Ser?Gly?Gly?Thr?Lys?Val?His?Tyr?Ala?Tyr?Gln?Thr?Asn?Ala?Ser?Thr
405?????????????????410?????????????????415
Tyr?Glu?Tyr?Ile?Asp?Ile?Pro?Phe?Gln?Asn?Lys?Tyr?Ser?His?Ile?Ser
420?????????????????425?????????????????430
Met?Leu?Asp?Tyr?Asn?Pro?Lys?Asp?Arg?Ala?Leu?Tyr?Ala?Trp?Asn?Asn
435?????????????????440?????????????????445
Gly?His?Gln?Ile?Leu?Tyr?Asn?Val?Thr?Leu?Phe?His?Val?Ile?Arg?Ser
450?????????????????455?????????????????460
Asp?Glu?Leu
465
<210>3
<211>432
<212>PRT
＜213〉homo sapiens (Homo sapiens)
<400>3
Thr?Asn?Pro?Glu?Glu?Ser?Trp?Gln?Val?Tyr?Ser?Ser?Ala?Gln?Asp?Ser
1???????????????5???????????????????10??????????????????15
Glu?Gly?Arg?Cys?Ile?Cys?Thr?Val?Val?Ala?Pro?Gln?Gln?Thr?Met?Cys
20??????????????????25??????????????????30
Ser?Arg?Asp?Ala?Arg?Thr?Lys?Gln?Leu?Arg?Gln?Leu?Leu?Glu?Lys?Val
35??????????????????40??????????????????45
Gln?Asn?Met?Ser?Gln?Ser?Ile?Glu?Val?Leu?Asp?Arg?Arg?Thr?Gln?Arg
50??????????????????55??????????????????60
Asp?Leu?Gln?Tyr?Val?Glu?Lys?Met?Glu?Asn?Gln?Met?Lys?Gly?Leu?Glu
65??????????????????70??????????????????75??????????????????80
Ser?Lys?Phe?Lys?Gln?Val?Glu?Glu?Ser?His?Lys?Gln?His?Leu?Ala?Arg
85??????????????????90??????????????????95
Gln?Phe?Lys?Ala?Ile?LysAla?Lys?Met?Asp?Glu?Leu?Arg?Pro?Leu?Ile
100????????????????105?????????????????110
Pro?Val?Leu?Glu?Glu?Tyr?Lys?Ala?Asp?Ala?Lys?Leu?Val?Leu?Gln?Phe
115?????????????????120?????????????????125
Lys?Glu?Glu?Val?Gln?Asn?Leu?Thr?Ser?Val?Leu?Asn?Glu?Leu?Gln?Glu
130?????????????????135?????????????????140
Glu?Ile?Gly?Ala?Tyr?Asp?Tyr?Asp?Glu?Leu?Gln?Ser?Arg?Val?Ser?Asn
145?????????????????150?????????????????155?????????????????160
Leu?Glu?Glu?Arg?Leu?Arg?Ala?Cys?Met?Gln?Lys?Leu?Ala?Cys?Gly?Lys
165?????????????????170?????????????????175
Leu?Thr?Gly?Ile?Ser?Asp?Pro?Val?Thr?Val?Lys?Thr?Ser?Gly?Ser?Arg
180?????????????????185?????????????????190
Phe?Gly?Ser?Trp?Met?Thr?Asp?Pro?Leu?Ala?Pro?Glu?Gly?Asp?Asn?Arg
195?????????????????200?????????????????205
Val?Trp?Tyr?Met?Asp?Gly?Tyr?His?Asn?Asn?Arg?Phe?Val?Arg?Glu?Tyr
210?????????????????215?????????????????220
Lys?Ser?Met?Val?Asp?Phe?Met?Asn?Thr?Asp?Asn?Phe?Thr?Ser?His?Arg
225?????????????????230?????????????????235?????????????????240
Leu?Pro?His?Pro?Trp?Ser?Gly?Thr?Gly?Gln?Val?Val?Tyr?Asn?Gly?Ser
245?????????????????250?????????????????255
Ile?Tyr?Phe?Asn?Lys?Phe?Gln?Ser?His?Ile?Ile?Ile?Arg?Phe?Asp?Leu
260?????????????????265?????????????????270
Lys?Thr?Glu?Thr?Ile?Leu?Lys?Thr?Arg?Ser?Leu?Asp?Tyr?Ala?Gly?Tyr
275?????????????????280?????????????????285
Asn?Asn?Met?Tyr?His?Tyr?Ala?Trp?Gly?Gly?His?Ser?Asp?Ile?Asp?Leu
290?????????????????295?????????????????300
Met?Val?Asp?Glu?Ser?Gly?Leu?Trp?Ala?Val?Tyr?Ala?Thr?Asn?Gln?Asn
305?????????????????310?????????????????315?????????????????320
Ala?Gly?Asn?Ile?Val?Val?Ser?Arg?Leu?Asp?Pro?Val?Ser?Leu?Gln?Thr
325?????????????????330?????????????????335
Leu?Gln?Thr?Trp?Asn?Thr?Ser?Tyr?Pro?Lys?Arg?Ser?Ala?Gly?Glu?Ala
340?????????????????345?????????????????350
Phe?Ile?Ile?Cys?Gly?Thr?Leu?Tyr?Val?Thr?Asn?Gly?Tyr?Ser?Gly?Gly
355?????????????????360?????????????????365
Thr?Lys?Val?His?Tyr?Ala?Tyr?Gln?Thr?Asn?Ala?Ser?Thr?Tyr?Glu?Tyr
370?????????????????375?????????????????380
Ile?Asp?Ile?Pro?Phe?Gln?Asn?Lys?Tyr?Ser?His?Ile?Ser?Met?Leu?Asp
385?????????????????390?????????????????395?????????????????400
Tyr?Asn?Pro?Lys?Asp?Arg?Ala?Leu?Tyr?Ala?Trp?Asn?Asn?Gly?His?Gln
405?????????????????410?????????????????415
Ile?Leu?Tyr?Asn?Val?Thr?Leu?Phe?His?Val?Ile?Arg?Ser?Asp?Glu?Leu
420?????????????????425?????????????????430
<210>4
<211>26
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>4
gctctagacc?tgcatgccag?gtcgtt?????????????????????????????????????????26
<210>5
<211>27
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>5
cggaattctc?aactcgtcgg?agcggat????????????????????????????????????????27
<210>6
<211>26
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>6
ggaattcacc?aaccctgagg?agagct??????????????????????????????????????????26
<210>7
<211>32
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>7
aaatatgcgg?ccgccgagtg?gccaccccag?gc???????????????????????????????????32
Claims (10)
1. an isolated polypeptide is characterized in that, this polypeptide is selected from down group:
(a) has the polypeptide of SEQ ID NO:2 or 3 aminoacid sequences;
(b) replacement, disappearance or the interpolation through one or more amino-acid residues of SEQ ID NO:2 or 3 aminoacid sequences formed, and have the function that promotes the PC-12 cell to form cynapse by (a) polypeptides derived.
2. polypeptide as claimed in claim 1 is characterized in that, this polypeptide is the polypeptide with SEQ ID NO:2 or 3 aminoacid sequences.
3. isolating polynucleotide is characterized in that, it comprises a nucleotide sequence, and this nucleotide sequence is selected from down group:
(a) polynucleotide of polypeptide according to claim 1 of encoding;
(b) with polynucleotide (a) complementary polynucleotide.
4. polynucleotide as claimed in claim 3 is characterized in that this polynucleotide encoding has the polypeptide of aminoacid sequence shown in SEQ ID NO:2 or 3.
5. polynucleotide as claimed in claim 3 is characterized in that, the sequence of these polynucleotide is selected from down a kind of of group:
(a) has the nucleotide sequence of 286-1686 position among the SEQ ID NO:1;
(b) has the nucleotide sequence of 391-1686 position among the SEQ ID NO:1;
(c) has the nucleotide sequence of 1-2741 position among the SEQ ID NO:1.
6. a carrier is characterized in that, it contains the described polynucleotide of claim 3.
7. a genetically engineered host cell is characterized in that, it contains the described carrier of claim 6.
8. the preparation method of a peptide species is characterized in that, this method comprises:
(a) under conditions suitable for the expression, cultivate the described host cell of claim 7;
(b) from culture, isolate people hOLF50 albumen.
9. energy and the described people hOLF50 of claim 1 protein-specific bonded antibody.
10. the purposes of the described polypeptide of claim 1 is characterized in that, is used to promote the growth of neurocyte.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200310108758 CN1618805A (en) | 2003-11-21 | 2003-11-21 | Nerve system development related protein and its coding sequence and use |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200310108758 CN1618805A (en) | 2003-11-21 | 2003-11-21 | Nerve system development related protein and its coding sequence and use |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1618805A true CN1618805A (en) | 2005-05-25 |
Family
ID=34758706
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200310108758 Pending CN1618805A (en) | 2003-11-21 | 2003-11-21 | Nerve system development related protein and its coding sequence and use |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1618805A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114250238A (en) * | 2021-11-26 | 2022-03-29 | 北京航空航天大学 | Gene-encoded neuron development regulation polypeptide and application thereof |
-
2003
- 2003-11-21 CN CN 200310108758 patent/CN1618805A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114250238A (en) * | 2021-11-26 | 2022-03-29 | 北京航空航天大学 | Gene-encoded neuron development regulation polypeptide and application thereof |
| CN114250238B (en) * | 2021-11-26 | 2023-08-25 | 北京航空航天大学 | Gene-encoded neuron development regulatory polypeptide and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1170850C (en) | Human angiogenin-like protein and coding sequence and application thereof | |
| CN1286973C (en) | Histone methyl transferase and its preparing method | |
| CN1160370C (en) | A novel human cell cysle control related protein and a sequence encoding the same | |
| CN1303102C (en) | Method for diagnosing and curing alopecia utilizing the Rhor gene of human and rat and the encoding products | |
| CN1234728C (en) | Novel human lymphokine, its coding sequence and use | |
| CN1244595C (en) | Tumor suppressor protein and its application | |
| CN1618805A (en) | Nerve system development related protein and its coding sequence and use | |
| CN1194012C (en) | Sperm formation relative protein and its coding sequence and use | |
| CN1169954C (en) | Human protein able to suppress growth of cancer cells and its coding sequence | |
| CN1170848C (en) | Novel human hepatoma associated protein and coding sequence thereof | |
| CN1277844C (en) | Novel human cyclin, its coding sequence and application | |
| CN1249082C (en) | Apoptosis promoting gene BNIPL, coding albumen and uses thereof | |
| CN1289524C (en) | Human telomerase active inhibitor protein and use thereof | |
| CN1170844C (en) | Human macrobiosis-ensuring protein and its coding sequence and application | |
| CN1241941C (en) | Protein for promoting nerve differentiation and resisting cell death, and its coding gene | |
| CN1213069C (en) | Growth promoting factor and its prepn and use | |
| CN1209372C (en) | Human tumor relative gene CT120 in human 17p 13.3 area and coding protein thereof | |
| CN1169958C (en) | Human protein able to suppress growth of cancer cells and its coding sequence | |
| CN1166686C (en) | New human protein with the function of inhibiting cancer cell growth and its coding sequence | |
| CN1177862C (en) | Human NIP2 associated protein and coding sequence and application thereof | |
| CN1243017C (en) | Tumor suppressor, coded protein and application thereof | |
| CN1290861C (en) | New type human bone marrow substrate cell source 1 type phosphoric acid enzyme inhibition factor, its coded sequence and use | |
| CN1194010C (en) | New human protein with the function of inhibiting cancer cell growth and its coding sequence | |
| CN1169957C (en) | Human protein able to suppress growth of cancer cells and its coding squence | |
| CN1190446C (en) | New human protein with function of improving mouse NIH/3T3 cell transformation and its encoding sequence |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |