CN1277844C - Novel human cyclin, its coding sequence and application - Google Patents
Novel human cyclin, its coding sequence and application Download PDFInfo
- Publication number
- CN1277844C CN1277844C CN02136554.7A CN02136554A CN1277844C CN 1277844 C CN1277844 C CN 1277844C CN 02136554 A CN02136554 A CN 02136554A CN 1277844 C CN1277844 C CN 1277844C
- Authority
- CN
- China
- Prior art keywords
- cyclin
- polypeptide
- polynucleotide
- people
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Lifetime
Links
Images
Abstract
The present invention relates to novel cyclin (cyclin X). The present invention provides polynucleotide for coding the molecules of the cyclin and a method for producing the molecules of the cyclin by a recombination technology. The present invention also discloses the application of the novel cyclin molecules and the coding sequence of the polynucleotide. The present invention also testifies that the cyclin X can regulate the growth of cells and control the cell period. The present invention also discloses the strategies of the molecules of the cyclin for the diagnosis and the treatment of diseases. The strategies can be particularly used for diagnosing and treating malignant tumors.
Description
Technical field
The invention belongs to biotechnology and medical field, specifically, the present invention relates to the polynucleotide of new coding human cyclin Cyclin X polypeptide, and the polypeptide of this polynucleotide encoding.The invention still further relates to the purposes and the preparation of these polynucleotide and polypeptide.Cyclin X polypeptide is a kind of new intracellular protein relevant with cell cycle regulation and cell cycle regulating, has the activity of regulating cell growth and cell cycle regulation.
Background technology
The endogenous regulation and control of cell cycle are mainly carried out network regulation by cyclin (Cyclin)-Cyclin deopendent protein kinase (CDK)-cyclin dependent kinase inhibitors (CKI) and are realized.Cyclin and CKI carry out positive and negative regulation and control to CDK respectively.Have been found that nearly at least 20 kinds of Cyclin at present, comprised function ratio clearer and more definite Cyclin A, B, C, D1-3, E, F, G, H, K, L, T1-2 etc.Also have several Cyclin, still indeterminate as the function of Cyclin I and Cyclin M, just under study for action.Discovered in recent years, the Cyclin family member not only can cell cycle regulation, and the Cyclin molecule that has also has important effect on regulatory gene is transcribed.Cyclin L, Cyclin K, Cyclin T1-2, Cyclin C and Cyclin H etc. are the Cyclin molecules that can regulate and control genetic transcription on rna level.Cyclin L, Cyclin K, Cyclin T1-2, Cyclin C and Cyclin H etc. are relevant with important transcriptional regulatory element RNA polymerase II.They can phosphorylation RNA polymerase II big subunit C-terminal tumor-necrosis factor glycoproteins, and Cyclin L is also relevant with the effect of transcribing shear factor SC-35 with Cyclin T1-2.
In view of the vital role of cyclin, this area presses for the new cyclin of exploitation.
Summary of the invention
The purpose of this invention is to provide a kind of new human cyclin Cyclin X protein with and fragment, analogue and derivative.
Another object of the present invention provides the polynucleotide of these polypeptide of coding.
Another object of the present invention provides the method for these polypeptide of production and the purposes of this polypeptide and encoding sequence.
In a first aspect of the present invention, novel isolated Cyclin X polypeptide is provided, this polypeptide is the people source, it comprises: polypeptide or its conservative property variation polypeptide or its active fragments or its reactive derivative with SEQ ID NO:2 aminoacid sequence.Preferably, this polypeptide is selected from down group: the polypeptide that (a) has SEQ ID NO:2 aminoacid sequence; (b) SEQ ID NO:2 aminoacid sequence is formed through replacement, disappearance or the interpolation of one or more amino-acid residues, and have regulate cell growth and cell cycle regulation function by (a) polypeptides derived.
In a second aspect of the present invention, the polynucleotide of isolating these polypeptide of coding are provided, these polynucleotide comprise a nucleotide sequence, and this nucleotide sequence is shown at least 70% homogeny with a kind of nucleotides sequence that is selected from down group: (a) polynucleotide of the above-mentioned people Cyclin X of coding; (b) with polynucleotide (a) complementary polynucleotide.Preferably, this polynucleotide encoding has the polypeptide of aminoacid sequence shown in the SEQ ID NO:2.More preferably, the sequence of these polynucleotide is be selected from down group a kind of: the sequence that (a) has 355-1914 position among the SEQ ID NO:1; (b) has the sequence of 1-2667 position among the SEQ ID NO:1.
In a third aspect of the present invention, the carrier that contains above-mentioned polynucleotide is provided, and has been transformed or host cell of transduceing or the host cell that is directly transformed or transduce by above-mentioned polynucleotide by this carrier.
In a fourth aspect of the present invention, provide preparation to have the method for the active polypeptide of people Cyclin X protein, this method comprises: (a) under the condition that is fit to expressing human Cyclin X protein, cultivate the above-mentioned host cell that is transformed or transduce; (b) from culture, isolate and have the active polypeptide of people Cyclin X protein.
In a fifth aspect of the present invention, provide and above-mentioned people Cyclin X polypeptid specificity bonded antibody.The nucleic acid molecule that can be used for detecting also is provided, and it contains a successive 10-2667 Nucleotide in the above-mentioned polynucleotide.
In a sixth aspect of the present invention, the compound of simulation, promotion, antagonism people Cyclin X polypeptide active is provided, and the compound that suppresses people Cyclin X polypeptide expression.The method of screening and/or prepare these compounds also is provided.Preferably, this compound is encoding sequence or its segmental antisense sequences of people Cyclin X polypeptide.
In a seventh aspect of the present invention, the method that whether has the Cyclin X protein in the test sample is provided, it comprises: the specific antibody of sample with the Cyclin X protein contacted, observe whether form antibody complex, formed antibody complex and just represented to exist in the sample Cyclin X protein.
In a eighth aspect of the present invention, a kind of disease relevant with people Cyclin X polypeptide unconventionality expression or method of disease susceptibility of detecting is provided, this method comprises: whether have sudden change in the nucleotide sequence of detection coding said polypeptide.
In a ninth aspect of the present invention, provide the purposes of polypeptide of the present invention and encoding sequence.Polypeptide for example of the present invention can be used to screen the agonist that promotes people Cyclin X polypeptide active, and perhaps screening suppresses people Cyclin
The antagonist of X polypeptide active or be used to the peptide finger print identification.The encoding sequence of people Cyclin X protein of the present invention or its fragment can be used as primer and be used for pcr amplification reaction, perhaps are used for hybridization as probe, perhaps are used to make gene chip or microarray.
In a tenth aspect of the present invention, a kind of pharmaceutical composition is provided, it contains people Cyclin X polypeptide of the present invention or its agonist, antagonist and the pharmaceutically acceptable carrier of safe and effective amount.These pharmaceutical compositions can be treated illnesss such as tumour, inflammation, neural system and cardiovascular diseases.
In a eleventh aspect of the present invention, provide the adjusting cell growth of Cyclin X and cell cycle regulation is active experimental results show that.
Others of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.
Description of drawings
Fig. 1 is people Cyclin X protein of the present invention and the proteic amino acid sequence homology comparison diagram of other Cyclin family members.The first row sequence a6e9 is people Cyclin X, and the below sequence is other Cyclin family member albumen.Amino acid conservative more than 60% marks with black matrix between a plurality of sequences, and amino acid conservative more than 40% marks with grey body.
Fig. 2 is that people Cyclin X protein aminoacid sequence conserved regions of the present invention is analyzed synoptic diagram.
Fig. 3 is the hydrophobicity graphic representation of the Kyte-doolitte hydrophobicity analysis of people Cyclin X protein of the present invention.
Fig. 4 is a people Cyclin X RT-PCR expression analysis of the present invention, and prompting Cyclin X is expressed in a lot of hematopoiesis and solid tumor cell and some human normal cell line.
Fig. 5 is the shown distribution of people Cyclin X Northern blot hybridization of the present invention.Results suggest Cyclin X is the molecule that a kind of tool particular organization distributes.
Fig. 6 is the prokaryotic expression electrophorogram in the high antigenicity of people Cyclin X C-terminal of the present invention district.
Embodiment
Cyclin X is that the contriver utilizes extensive random sequencing method at first to find and an isolating newcomer of Cyclin family from human bone marrow substrate cell.Cyclin X and Cyclin L, Cyclin K, Cyclin T1-2, Cyclin C and Cyclin H all show higher homology.The bioinformatic analysis result shows that Cyclin X gene and albumen thereof meet Cyclin family member's characteristics very much.NCBI genome BLAST analyzes demonstration, and the Cyclin X gene is positioned No. 1 the short arm of a chromosome end of people's gene group.Hybridization of the Northern marking and reverse transcription PCR analytical results show that the distribution of the mRNA of Cyclin X in normal human tissue and clone is very extensive.
That has carried out discovers, Cyclin has important effect in the regulation and control of cell cycle, in close relations with tumour, virus infection such as pathological phenomenons such as acquired immune deficiency syndrome (AIDS) and hepatitis.The Cyclin molecule higher with Cyclin X homology all is the transcriptional regulator relevant with rna plymerase ii, illustrates that Cyclin X also very might be a transcriptional regulator relevant with rna plymerase ii.Therefore, the relation of further inquiring into Cyclin X and tumour, virus infection such as acquired immune deficiency syndrome (AIDS) has more wide prospect, all might produce huge directive function for the regulatory mechanism, prevention and the treatment disease that disclose the cell cycle.
In the present invention, term " Cyclin X protein ", " Cyclin X polypeptide " or " cyclin Cyclin X " are used interchangeably, and all refer to have the albumen or the polypeptide of cyclin Cyclin X aminoacid sequence (SEQID NO:2).
As used herein, " isolating " is meant that material separates (if natural substance, primal environment promptly is a natural surroundings) from its primal environment.Do not have separation and purification as polynucleotide under the native state in the active somatic cell and polypeptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then for separation and purification.
As used herein, " isolating Cyclin X protein or polypeptide " is meant that Cyclin X polypeptide is substantially free of natural relative other albumen, lipid, carbohydrate or other material.Those skilled in the art can use the purified technology of protein purifying Cyclin X protein of standard.Basically pure polypeptide can produce single master tape on non-reduced polyacrylamide gel.
Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic polypeptide, preferred recombinant polypeptide.Polypeptide of the present invention can be the product of natural purifying, or the product of chemosynthesis, or uses recombinant technology to produce from protokaryon or eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell).The host used according to the recombinant production scheme, polypeptide of the present invention can be glycosylated, maybe can be nonglycosylated.Polypeptide of the present invention also can comprise or not comprise initial methionine residues.
The present invention also comprises fragment, derivative and the analogue of people Cyclin X protein.As used herein, term " fragment ", " derivative " are meant with " analogue " and keep identical biological function of natural human CyclinX albumen of the present invention or active polypeptide basically.Polypeptide fragment of the present invention, derivative or analogue can be that (i) has one or more conservative or substituted polypeptide of non-conservation amino-acid residue (preferred conservative amino acid residue), and the amino-acid residue of such replacement can be also can not encoded by genetic code, or (ii) in one or more amino-acid residues, has a polypeptide of substituted radical, or (iii) mature polypeptide and another compound (such as the compound that prolongs the polypeptide transformation period, polyoxyethylene glycol for example) merges formed polypeptide, or (iv) additional aminoacid sequence is fused to this peptide sequence and the polypeptide that forms (as leader sequence or secretion sequence or be used for the sequence or the proteinogen sequence of this polypeptide of purifying, or with the fusion rotein of the segmental formation of antigen I gG).According to the instruction of this paper, these fragments, derivative and analogue belong to the known scope of those skilled in the art.
In the present invention, term " people Cyclin X polypeptide " refers to have the active SEQID NO.2 of people Cyclin X protein polypeptide of sequence.This term also comprises having and variant form people Cyclin X protein identical function, SEQID NO.2 sequence.These variant forms comprise (but being not limited to): several (are generally 1-50, preferably 1-30, more preferably 1-20,1-10 best) amino acid whose disappearance, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally in 20, preferably being in 10, more preferably is in 5) amino acid.For example, in the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic function usually.This term also comprises the active fragments and the reactive derivative of people Cyclin X protein.
The variant form of this polypeptide comprises: homologous sequence, conservative property varient, allelic variant, natural mutation, induced mutation body, under high or low tight degree condition can with the coded albumen of the DNA of people Cyclin X DNA hybridization and the polypeptide or the albumen that utilize the antiserum(antisera) of anti-people Cyclin X polypeptide to obtain.The present invention also provides other polypeptide, as comprises people Cyclin X polypeptide or its segmental fusion rotein.Except the polypeptide of total length almost, the present invention has also comprised the soluble fragments of people Cyclin X polypeptide.Usually, this fragment have people Cyclin X peptide sequence at least about 10 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, best at least about 100 continuous amino acids.
Invention also provides the analogue of people Cyclin X protein or polypeptide.The difference of these analogues and natural human CyclinX polypeptide can be the difference on the aminoacid sequence, also can be the difference that does not influence on the modified forms of sequence, perhaps haves both at the same time.These polypeptide comprise natural or the inductive genetic variant.The induce variation body can obtain by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also can pass through site-directed mutagenesis method or the biological technology of other known moleculars.Analogue also comprises having the analogue that is different from the amino acid whose residue of natural L-(as D-amino acid), and has non-natural analogue that exist or synthetic amino acid (as β, gamma-amino acid).Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.
(the not changing primary structure usually) form of modification comprises: the chemically derived form such as the acetylize or carboxylated of the polypeptide that body is interior or external.Modification also comprises glycosylation, carries out glycosylation modified and polypeptide that produce in the procedure of processing as those in the synthetic and processing of polypeptide or further.This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) and finishes by polypeptide is exposed to.Modified forms also comprises have the phosphorylated amino acid residue sequence of (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the polypeptide that has been improved its anti-proteolysis performance or optimized solubility property by modifying.
In the present invention, " people Cyclin X protein conservative property variation polypeptide " refers to compare with the aminoacid sequence of SEQ ID NO:2, has 10 at the most, preferably at the most 8, more preferably at the most 5,3 amino acid is replaced by similar performance or close amino acid and is formed polypeptide at the most best.These conservative property variation polypeptide preferably carry out the amino acid replacement according to table 1 and produce.
Table 1
| Initial residue | Representational replacement | The preferred replacement |
| Ala(A) | Val；Leu；Ile | Val |
| Arg(R) | Lys；Gln；Asn | Lys |
| Asn(N) | Gln；His；Lys；Arg | Gln |
| Asp(D) | Glu | Glu |
| Cys(C) | Ser | Ser |
| Gln(Q) | Asn | Asn |
| Glu(E) | Asp | Asp |
| Gly(G) | Pro；Ala | Ala |
| His(H) | Asn；Gln；Lys；Arg | Arg |
| Ile(I) | Leu；Val；Met；Ala；Phe | Leu |
| Leu(L) | Ile；Val；Met；Ala；Phe | Ile |
| Lys(K) | Arg；Gln；Asn | Arg |
| Met(M) | Leu；Phe；Ile | Leu |
| Phe(F) | Leu；Val；Ile；Ala；Tyr | Leu |
| Pro(P) | Ala | Ala |
| Ser(S) | Thr | Thr |
| Thr(T) | Ser | Ser |
| Trp(W) | Tyr；Phe | Tyr |
| Tyr(Y) | Trp；Phe；Thr；Ser | Phe |
| Val(V) | Ile；Leu；Met；Phe；Ala | Leu |
Polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can with SEQ ID NO; The varient of the identical or degeneracy of the coding region sequence shown in 1.As used herein, " varient of degeneracy " is meant that in the present invention coding has the protein of SEQ ID NO:2, but with the differentiated nucleotide sequence of coding region sequence shown in the SEQ ID NO:1.
The polynucleotide of the mature polypeptide of coding SEQ ID NO:2 comprise: the encoding sequence of an encoding mature polypeptide; The encoding sequence of mature polypeptide and various additional code sequence; Encoding sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence.
Term " polynucleotide of coded polypeptide " can be the polynucleotide that comprise this polypeptide of encoding, and also can be the polynucleotide that also comprise additional code and/or non-coding sequence.
The invention still further relates to the varient of above-mentioned polynucleotide, its coding has the polypeptide of identical aminoacid sequence or fragment, analogue and the derivative of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing the function of its encoded polypeptides in fact.
The invention still further relates to and above-mentioned sequence hybridization and two sequences between have at least 50%, preferably at least 70%, the polynucleotide of at least 80% homogeny more preferably.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide of the present invention.In the present invention, " stringent condition " is meant: (1) than hybridization under low ionic strength and the comparatively high temps and wash-out, as 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time is added with denaturing agent, as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 90%, be more preferably 95% and just hybridize when above.And the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in the SEQ ID NO:2.
The invention still further relates to nucleic acid fragment with above-mentioned sequence hybridization.As used herein, the length of " nucleic acid fragment " contains 15 Nucleotide at least, better is at least 30 Nucleotide, is more preferably at least 50 Nucleotide, preferably more than at least 100 Nucleotide.Nucleic acid fragment can be used for the amplification technique (as PCR) of nucleic acid to determine and/or to separate the polynucleotide of coding Cyclin X protein.
Polypeptide among the present invention and polynucleotide preferably provide with isolating form, more preferably are purified to homogeneous.
People Cyclin X Nucleotide full length sequence of the present invention or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence.When sequence is longer, usually needs to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplifies is stitched together by proper order.
In case obtained relevant sequence, just can obtain relevant sequence in large quantity with recombination method.This normally is cloned into carrier with it, changes cell again over to, separates obtaining relevant sequence then from the host cell after the propagation by ordinary method.
In addition, also the method for available synthetic is synthesized relevant sequence, especially fragment length more in short-term.Usually, by first synthetic a plurality of small segments, and then connect and to obtain the very long fragment of sequence.
At present, can be fully obtain the dna sequence dna of code book invention albumen (or its fragment, or derivatives thereof) by chemosynthesis.This dna sequence dna can be introduced in various existing dna moleculars as known in the art (or as carrier) and the cell then.In addition, also can will suddenly change and introduce in the protein sequence of the present invention by chemosynthesis.
Use method (Saiki, the et al.Science1985 of round pcr DNA amplification/RNA; 230:1350-1354) be optimized for acquisition gene of the present invention.When particularly being difficult to obtain the cDNA of total length from the library, can preferably use RACE method (the terminal rapid amplifying method of RACE-cDNA), the primer that is used for PCR can suitably be selected according to sequence information of the present invention disclosed herein, and available ordinary method is synthetic.Available ordinary method is as the DNA/RNA fragment by gel electrophoresis separation and purifying amplification.
The present invention also relates to comprise the carrier of polynucleotide of the present invention, and the host cell that produces through genetically engineered with carrier of the present invention or Cyclin X protein encoding sequence, and the method that produces polypeptide of the present invention through recombinant technology.
Recombinant DNA technology (Science, 1984 by routine; 224:1431), can utilize polymerized nucleoside acid sequence of the present invention to can be used to express or produce the Cyclin X polypeptide of reorganization.In general following steps are arranged:
(1). with the polynucleotide (or varient) of coding of the present invention people Cyclin X polypeptide, or with the recombinant expression vector that contains these polynucleotide proper host cell that transforms or transduce;
(2). the host cell of in suitable medium, cultivating;
(3). separation, protein purification from substratum or cell.
Among the present invention, people Cyclin X polynucleotide sequence can be inserted in the recombinant expression vector.Term " recombinant expression vector " refers to that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carriers.The carrier of Shi Yonging includes but not limited in the present invention: and the expression vector based on T7 of in bacterium, expressing (Rosenberg, et al.Gene, 1987,56:125); The pMSXND expression vector of in mammalian cell, expressing (Lee and Nathans, J Bio Chem.263:3521,1988) and at the carrier that derives from baculovirus of expressed in insect cells.In a word, as long as can duplicate in host and stablize, any plasmid and carrier can be used.A key character of expression vector is to contain replication orgin, promotor, marker gene and translation controlling elements usually.
Method well-known to those having ordinary skill in the art can be used to make up and contains people Cyclin X DNA sequences encoding and suitable transcribing/the translate expression vector of control signal.These methods comprise (Sambroook, et al.Molecular Cloning, a LaboratoryManual, cold Spring Harbor Laboratory.New York, 1989) such as extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technologys of body.Described dna sequence dna can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; Lambda particles phage PL promotor; Eukaryotic promoter comprises LTRs and some other known may command gene expression promoter in protokaryon or eukaryotic cell or its virus of CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retrovirus.Expression vector also comprises ribosome bind site and the transcription terminator that translation initiation is used.
In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance.
Comprise the carrier of above-mentioned suitable dna sequence dna and suitable promotor or control sequence, can be used to transform appropriate host cell, so that it can marking protein.
Host cell can be a prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, streptomyces; The bacterial cell of Salmonella typhimurium; Fungal cell such as yeast; Vegetable cell; The insect cell of fruit bat S2 or Sf9; The zooblast of CHO, COS, 293 cells or Bowes melanoma cells etc.
When polynucleotide of the present invention are expressed in higher eucaryotic cells, be enhanced if will make to transcribe when in carrier, inserting enhancer sequence.Enhanser is the cis acting factor of DNA, and nearly 10 to 300 base pairs act on promotor transcribing with enhancing gene usually.Can for example be included in the SV40 enhanser of 100 to 270 base pairs of replication origin side in late period one, at the polyoma enhanser of replication origin side in late period one and adenovirus enhanser etc.
Persons skilled in the art all know how to select appropriate carriers, promotor, enhanser and host cell.
Can carry out with routine techniques well known to those skilled in the art with the recombinant DNA transformed host cell.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results
2Method is handled, and used step is well-known in this area.Another kind method is to use MgCl
2If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, conventional mechanical method such as microinjection, electroporation, liposome packing etc.
The transformant that obtains can be cultivated with ordinary method, expresses the polypeptide of coded by said gene of the present invention.According to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.
The extracellular can be expressed or be secreted into to recombinant polypeptide in the above methods in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.The example of these methods includes, but are not limited to: conventional renaturation handles, with protein precipitant handle (salt analysis method), centrifugal, the broken bacterium of infiltration, superly handle, the combination of super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.
The people Cyclin X protein or the polypeptide of reorganization are of use in many ways.These purposes include, but is not limited to: directly as the disease due to pharmacological agent Cyclin X protein hypofunction or the forfeiture be used to screen and promote or antibody, polypeptide or other part of antagonism Cyclin X protein function.The peptide molecule that can suppress or stimulate people Cyclin X protein function that can be used for seeking therapeutic value with the recombinant human Cyclin X protein screening peptide library of expressing.
On the other hand, the present invention also comprises people Cyclin X DNA or the polypeptide of its fragment coding has specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody.Here, " specificity " is meant that antibody capable is incorporated into people Cyclin X gene product or fragment.Preferably, refer to that those can combine with people Cyclin X gene product or fragment but nonrecognition and be incorporated into the antibody of other irrelevant antigen molecule.Among the present invention antibody comprise those can in conjunction with and suppress the molecule of people Cyclin X protein, comprise that also those do not influence the antibody of people Cyclin X protein function.The present invention also comprise those can with modify or without the people Cyclin X gene product bonded antibody of modified forms.
The present invention not only comprises complete mono-clonal or polyclonal antibody, but also comprises having immunocompetent antibody fragment, as Fab ' or (Fab)
2Fragment; Heavy chain of antibody; Light chain of antibody; Genetically engineered strand Fv molecule (people such as Ladner, U.S. Patent No. 4,946,778); Or chimeric antibody, as have the murine antibody binding specificity but still keep antibody from people's antibody moiety.
Antibody of the present invention can be prepared by the known various technology of those skilled in that art.For example, the people Cyclin X gene product of purifying or its have antigenic fragment, can be applied to animal to induce the generation of polyclonal antibody.Similarly, expressing human Cyclin X protein or its have antigenic segmental cell and can be used to immune animal and produce antibody.Antibody of the present invention also can be monoclonal antibody.This type of monoclonal antibody can utilize hybridoma technology prepare (see people such as Kohler,
Nature256; 495,1975; People such as Kohler,
Eur.J.Immunol.6:511,1976; People such as Kohler,
Eur.J.Immunol.6:292,1976; People such as Hammerling,
In Monoclonal Antibodies And T Cell Hybridomas, Elsevier, N.Y., 1981).Antibody of the present invention comprises the antibody that can block people Cyclin X protein function and the antibody that does not influence people Cyclin X protein function.Each antibody-like of the present invention can utilize the fragment or the functional zone of people Cyclin X gene product, obtains by the routine immunization technology.These fragments or functional zone can utilize recombinant methods or utilize Peptide synthesizer synthetic.Can come immune animal and produce with the gene product of producing in the prokaryotic cell prokaryocyte (for example E.Coli) with the unmodified form bonded antibody of people Cyclin X gene product; With posttranslational modification form bonded antibody (as the albumen or the polypeptide of glycosylation or phosphorylation), can come immune animal and obtain with the gene product that produces in the eukaryotic cell (for example yeast or insect cell).
The antibody of anti-people Cyclin X protein can be used in the immunohistochemistry technology, detects the people Cyclin X protein in the biopsy specimen.In addition, with the also available labelled with radioisotope of people Cyclin X protein bonded monoclonal antibody, inject in the body and can follow the tracks of its position and distribution.This radiolabeled antibody can be used as a kind of atraumatic diagnostic method and is used for the location of tumour cell and has judged whether transfer.
Antibody among the present invention can be used for treating or prevention and the relevant disease of people Cyclin X protein.The antibody that gives suitable dosage can stimulate or block the generation or the activity of people Cyclin X protein.
Antibody also can be used for being designed to the immunotoxin at a certain privileged sites in the body.As the monoclonal antibody of people Cyclin X protein high-affinity can with bacterium or plant poison (as diphtheria toxin, ricin, abrine etc.) covalent attachment.A kind of usual method is with sulfydryl linking agent such as SPDP, attacks the amino of antibody, by the exchange of disulfide linkage, toxin is incorporated on the antibody, and this hybrid antibody can be used for killing the cell (for example lymph-node cell etc.) of people CyclinX protein positive.
The production of polyclonal antibody can choose Cyclin X protein or polypeptide immune animal, as rabbit, mouse, rat etc.Multiple adjuvant can be used for the enhancing immunity reaction, includes but not limited to freund's adjuvant etc.
Utilize albumen of the present invention,, can filter out with the Cyclin X protein interactional material takes place, as part, inhibitor, agonist or antagonist etc. by various conventional screening methods.
Albumen of the present invention and antibody thereof, inhibitor, agonist, antagonist or acceptor etc. when using (administration) in treatment, can provide different effects.Usually, can these materials are formulated in nontoxic, inert and the pharmaceutically acceptable aqueous carrier medium, wherein pH is about 5-8 usually, and preferably pH is about 6-8, although the pH value can be with being changed to some extent by preparation Substance Properties and illness to be treated.The pharmaceutical composition for preparing can carry out administration by conventional route, comprising (but being not limited to): intramuscular, intraperitoneal, intravenously, subcutaneous, intracutaneous or topical.
Polypeptide of the present invention or its agonist or antagonist can be directly used in disease treatment, for example, are used for tumour, inflammation, the treatment of neural system and cardiovascular diseases aspect.When use is of the present invention, also can use the other treatment agent simultaneously, as IFN-α, IFN-β, TNF-α, TNF-β etc.
The present invention also provides a kind of pharmaceutical composition, and it contains Cyclin X polypeptide of the present invention or its agonist, antagonist and the pharmaceutically acceptable carrier or the vehicle of safe and effective amount.This class carrier comprises (but being not limited to): salt solution, damping fluid, glucose, water, glycerine, ethanol and combination thereof.Pharmaceutical preparation should be complementary with administering mode.Pharmaceutical composition of the present invention can be made into the injection form, for example is prepared by ordinary method with the physiological saline or the aqueous solution that contains glucose and other assistant agents.Pharmaceutical composition such as tablet and capsule can be prepared by ordinary method.Pharmaceutical composition such as injection, solution, tablet and capsule should be made under aseptic condition.The dosage of activeconstituents is the treatment significant quantity, for example every day about 1 microgram/kg body weight-Yue 5 mg/kg body weight.In addition, polypeptide of the present invention also can use with the other treatment agent.
When making pharmaceutical composition, be that the Cyclin X protein of safe and effective amount or its antagonist, agonist are applied to Mammals, wherein this safe and effective amount is usually at least about 10 micrograms/kg body weight, and in most of the cases be no more than about 8 mg/kg body weight, preferably this dosage is about 10 micrograms/kg body weight-Yue 1 mg/kg body weight.Certainly, concrete dosage also should be considered factors such as route of administration, patient health situation, and these all are within the skilled practitioners skill.
The polynucleotide of people Cyclin X protein also can be used for multiple therapeutic purpose.Gene therapy technology can be used for treating because cell proliferation, growth or the metabolic disturbance due to the expression of the Cyclin X protein of the nothing expression of Cyclin X protein or unusual/non-activity.The Cyclin X protein that the gene therapy vector (as virus vector) of reorganization can be designed to express variation is to suppress endogenic Cyclin X protein activity.Deriving from viral expression vector such as retrovirus, adenovirus, adeno-associated virus (AAV), hsv, parvovirus etc. can be used for the Cyclin X gene is transferred in the cell.The method that structure carries the recombinant viral vector of Cyclin X gene is found in existing document (Sambrook, et al.).Recombinant human Cyclin X gene can be packaged in the liposome in addition, and then is transferred in the cell.
Suppress the oligonucleotide (comprising sense-rna and DNA) of people Cyclin XmRNA and ribozyme also within the scope of the invention.Ribozyme is the enzyme sample RNA molecule that a kind of energy specificity is decomposed specific RNA, and its mechanism of action is to carry out the endonuclease effect after ribozyme molecule and the hybridization of complementary target RNA-specific.The RNA of antisense and DNA and ribozyme can obtain with existing any RNA or DNA synthetic technology, as the technology widespread use of solid phase phosphoamide chemical synthesis synthetic oligonucleotide.Antisense rna molecule can be transcribed acquisition by the dna sequence dna of this RNA that encodes in external or body.This dna sequence dna has been incorporated into the downstream of rna polymerase promoter of carrier.In order to increase the stability of nucleic acid molecule, available several different methods is modified it, and as increasing the sequence length of both sides, the connection between the ribonucleoside is used phosphoric acid thioester bond or peptide bond but not phosphodiester bond.
Polynucleotide imports tissue or intracellular method comprises: directly be injected into polynucleotide in the in-vivo tissue; Or external by carrier (as virus, phage or plasmid etc.) earlier with the polynucleotide transfered cell in, again cell is transplanted in the body etc.
Can be incorporated into the rondom polypeptide storehouse that solid formation forms by the various amino acid that may make up by screening with people Cyclin X protein bonded peptide molecule obtains.During screening, must carry out mark to people Cyclin X protein molecule.
The invention still further relates to the diagnostic testing process of quantitative and detection and localization people Cyclin X protein level.These tests are known in the art, and comprise that FISH measures and radioimmunoassay.The people Cyclin X protein level that is detected in the test can be with laying down a definition the importance of people Cyclin X protein in various diseases and be used to the disease of diagnosing the Cyclin X protein to work.
A kind of method that whether has the Cyclin X protein in the test sample that detects is to utilize the specific antibody of Cyclin X protein to detect, and it comprises: sample is contacted with Cyclin X protein specific antibody; Observe whether form antibody complex, formed antibody complex and just represented to exist in the sample Cyclin X protein.
The polynucleotide of Cyclin X protein can be used for the diagnosis and the treatment of Cyclin X protein relative disease.Aspect diagnosis, the unconventionality expression of the expression that the polynucleotide of Cyclin X protein can be used for detecting Cyclin X protein Cyclin X protein whether or under morbid state.Can be used for the hybridization of biopsy specimen to judge the abnormal expression of Cyclin X protein as Cyclin XDNA sequence.Hybridization technique comprises the Southern blotting, Northern blotting, in situ hybridization etc.These technological methods all are disclosed mature technologies, and relevant test kit all can obtain from commercial channels.Part or all of polynucleotide of the present invention can be used as probe stationary on microarray (microarray) or DNA chip (being called " gene chip " again), is used for analyzing the differential expression analysis and the gene diagnosis of tissue gene.Carry out the transcription product that RNA-polymerase chain reaction (RT-PCR) amplification in vitro also can detect the Cyclin X protein with the special primer of Cyclin X protein.
The sudden change that detects the Cyclin X gene also can be used for the disease of diagnosing the Cyclin X protein relevant.The form of CyclinX protein mutation comprises that the point mutation compared with normal wild type Cyclin X dna sequence dna, transposition, disappearance, reorganization and other are any unusual etc.Available existing technology such as Southern blotting, dna sequence analysis, PCR and in situ hybridization detect sudden change.In addition, sudden change might influence proteic expression, therefore can judge indirectly that with Northern blotting, Western blotting gene has or not sudden change.
Sequence of the present invention identifies it also is valuable to karyomit(e).In brief, the proteic cDNA of CyclinX prepares PCR primer (preferred 15-35bp) according to the present invention, sequence can be positioned on the karyomit(e).Then, these primers are used for the somatocyte hybrid cell that the PCR screening contains each bar human chromosome.Have only those hybrid cells that contain corresponding to the people's gene of primer can produce the fragment of amplification.
In case sequence is positioned to chromosome position accurately, the physical location of this sequence on karyomit(e) just can be associated with the gene map data.These data for example are found in, V.Mckusick, MendelianInheritance in Man (can by with the online acquisition of Johns Hopkins University Welch Medical Library).Can pass through linkage analysis then, determine gene and navigated to relation between the disease on the chromosomal region already.
In an example of the present invention, a kind of isolating polynucleotide are provided, its coding has the polypeptide of aminoacid sequence shown in the SEQ IDNO:2.Polynucleotide of the present invention are isolated from the human bone marrow substrate cell cell cdna library.Its sequence is shown in SEQ ID NO:1, and the polynucleotide sequence total length that it comprises is 2667 bases, and its open reading frame is positioned at the 355-1997 position, and the coding total length is 520 amino acid whose people Cyclin X proteins (SEQ ID NO:2).This Cyclin X protein belongs to the Cyclin family molecule, and with CyclinL, Cyclin K, Cyclin T1-2, Cyclin C and Cyclin H aminoacid sequence height homology, consistence can be up to more than 50% in Ig spline structure territory, and similarity then can reach 60%.RT-PCR analysis revealed Cyclin X has expression in a lot of tumour cells.The Northern engram analysis shows that Cyclin X mRNA organizes the distribution that has in various degree at people's spleen, Tiroidina, prostate gland, testis, ovary, small intestine, colon, peripheral blood lymphocyte, brain, placenta, lung, liver, skeletal muscle, kidney and pancreas etc.Expression level at liver, ovary, heart and pancreas is relative higher, and relatively low at spleen, colon, peripheral blood lymphocyte, lung and skeletal muscle tissue expression level.Tetrazolium bromide (MTT) experimental result shows that Cyclin X crosses expression or low expression can be regulated the cell growth.Propidium iodide (PI) dyeing is after the result that flow cytometer detects shows that Cyclin X crosses expression or low expression can cell cycle regulation.The research prompting of having carried out, key factor RNA polymerase II and shear factor SC-35 during Cyclin X may regulate and control with rna transcription, and Cyclin dependant kinase (CDK) family member PITSLRE is relevant.Infer that Cyclin X by acting on intracellular Cyclin dependant kinase (CDK) conduction conditioning signal, regulates and control multiple physiology and pathology activity, it is antitumor to have a potential, anti-inflammatory effect.Therefore, Cyclin X protein or its relevant antagonist, agonist etc. can be diseases such as treatment tumour, virus infection, inflammation, neural system and cardiovascular diseases new immunodiagnosis and targeted therapy approach are provided, thereby have great application prospect.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, common " molecular cloning experiment guide " (New York:ColdSpring Harbor Laboratory Press according to people such as normal condition such as Sambrook, 1989) condition described in, or the condition of advising according to manufacturer.
Embodiment 1: the clone of people Cyclin X cDNA
Extract the total RNA of human bone marrow substrate cell with Trizol reagent (Life Technologies).Then, from total RNA, separate poly (A) mRNA.Poly (A) mRNA after reverse transcription forms cDNA, is cloned test kit (Life Technologies) with SuperScriptII cDNA fragment orientation is inserted on the multiple clone site of carrier, transform DH5 α bacterium and form the cDNA plasmid library.Measure the sequence of random choose clone's 5 ' end with dideoxy method.CDNA sequence and the existing public dna sequence data storehouse measured are compared, found that a cDNA clone's dna sequence dna is new expressed sequence tag (EST) cDNA.By synthetic a series of primers the contained dna sequence dna of new clone is carried out two-way mensuration.Computer Analysis shows that cloning contained cDNA is a new est sequence.Utilize information biology electronic cloning method, infer the full-length cDNA of this EST.Utilize the PCR reaction from human leukemia Raji cell cDNA, to clone its full-length cDNA by synthetic a series of primers.By synthetic a series of primers the contained dna sequence dna of new clone is carried out two-way mensuration, prove that it is full-length cDNA (shown in SEQ ID NO:1), the new protein (shown in 5EQ ID NO:2) of encoding.This protein is named as human cyclin Cyclin X, its encoding gene called after human cyclin Cyclin X gene.
Sequence SEQ ID NO:1 total length is 2667bp, comprises 5 ' the end non-coding region of 334bp and 3 ' the end non-coding region of 750bp, and coding contains 520 amino acid whose polypeptide.Calculating not in theory, the molecular weight of glycosylated ripe molecule is about 58.15kD.Cyclin X comprises 2 Cyclin family conserved domains.Hydropathy analysis (Fig. 3) is for finding signal peptide and stride the film district that prompting Cyclin X protein is a soluble proteins in the cell.
BLAST analyzes (Fig. 1) and shows that Cyclin X is different with known, reach 65% with human cyclin CyclinL consistence, similarity reaches 77%, and in Cyclin structural domain inner amino acid array height homology (Fig. 3), belongs to cyclin Cyclin family molecule.
The Cyclin X protein structurally has the constitutional features of Cyclin family, comprises having three Cyclin structural domains, and (Fig. 2) such as tangible nucleus signal for locatings arranged.In addition, the Cyclin X protein also comprises a N-glycosylation site (224-227 residue), two cAMP-and cGMP-deopendent protein kinase phosphorylation site (403-406,484-487 residue), eight protein kinase C phosphorylation sites (226-228,338-340,351-353,355-357,400-402,446-448,466-468,504-506 residue) and two Tyrosylprotein kinase phosphorylation sites (385-391,447-454 residue).
Embodiment 2: carry out the cell expressing analysis of people Cyclin X with the RT-PCR method
Extract total RNA of the various clones such as HL-60 be in logarithmic phase with Trizol reagent, get 5 μ g cell total rnas and 1 μ g Oligo-dT
12-
18Mix, carry out reverse transcription.The reverse transcription system is 20 μ l, and reaction adds 80 μ l ddH after finishing
2O dilutes.The used primer of pcr amplification Cyclin X is as follows: adopted primer 5 ' CAGGCTGTACTCCGGGGTGCTCATCA (SEQ ID NO:3) is arranged, antisense primer 5 ' CACGTGTCACCGGTCCCTCAGTTCCATTTC (SEQ ID NO:4), simultaneously with β-actin as positive control.The PCR reaction volume is 50 μ l, wherein contain reverse transcription template 10 μ l, 0.5mM primer, 0.2nM dNTP and 1U rTaq archaeal dna polymerase (Takara Inc.), the amplification parameter be 95 ℃ 15 seconds, 57 ℃ 30 seconds, 72 ℃ 30 seconds, capable 1.5% agarose gel electrophoresis of PCR product is tentatively confirmed after 28 circulations.The dna sequence analysis result shows that the DNA sequences encoding of this PCR product and the 471-2088 shown in the SEQ ID NO:1 are identical.
RT-PCR result (Fig. 4) shows: Cyclin X mRNA has expression in most of solid tumor cells and hematopoiesis tumour cell.
Embodiment 3: the Northern engram analysis of people Cyclin X
Carry out the Northern trace by following ordinary method: filter membrane to be checked places the hybridization solution of 10ml through 68 ℃ of preheatings, in hybrid heater (Bellco) in 68 ℃ of prehybridizations 30 minutes; The cDNA probe that mark is good was in 95～100 ℃ of sex change 2～5 minutes, and (cDNA probe final concentration is 2～10ng/ml or 1～2 * 10 to put rapid cooling back adding hybridization solution on ice
6Cpm/ml), fully mixing was hybridized 2 hours in 68 ℃.After hybridization finishes, filter membrane with 2 * SSC, the drip washing of 0.05%SDS room temperature for several times, the washing lotion several is changed in continuing vibration flushing 30～40 minutes therebetween.Use 0.1 * SSC, 0.1%SDS in 50 ℃ of vibration flushings 20～40 minutes subsequently.Last filter membrane wrapped up with plastic fresh-keeping membrane, in-70 ℃ of exposure X line films 24～48 hours.
Northern blot hybridization result (Fig. 5) shows: Cyclin X has in various degree distribution in people's spleen, Tiroidina, prostate gland, testis, ovary, small intestine, colon, peripheral blood lymphocyte, brain, placenta, lung, liver, skeletal muscle, kidney and pancreatic tissue.The position is about the 5.3kb place, and this shows that the Cyclin X protein is a kind of albumen of particular expression.
Embodiment 4: the C-terminal fragment of people Cyclin X is recombinant expressed
In this embodiment, be template with the total length plasmid DNA among the embodiment 1,5 ' and 3 ' the PCR Oligonucleolide primers held following with sequence increases, and obtains the high antigenicity of people's Cyclin X C-terminal district DNA as inserting fragment.
5 ' the end Oligonucleolide primers sequence of using in the PCR reaction is:
5’-TAGGATCCAGGCTGTACTCCGGGGTGCTCATCA-3’(SEQ ID NO：5)
This primer contains the restriction enzyme site of BamH I restriction enzyme, is the part encoding sequence of people Cyclin X after this restriction enzyme site;
3 ' end primer sequence is:
5’-GAGAATTCTGCGTCTTGGGGCCTCTTCTATCT-3’(SEQ ID NO：6)
This primer contains the part encoding sequence of restriction enzyme site, translation termination and the people Cyclin X of EcoR I restriction enzyme.
With the PCR product purification that obtains after recombinate according to a conventional method with expression vector plasmid pGEM-2T (Pharmacia company) again behind BamH I and the EcoR I double digestion and be converted into the competence e. coli bl21, the picking positive colony is identified back purifying and order-checking (377 type sequenators of ABI company, BigDye Terminator test kit, PE company).Choose the people Cycl in X cDNA BamH I that contains correct sequence and the pGEX-2T of EcoR I endonuclease bamhi, form carrier pGEX-2T-people Cyclin X, then transformed into escherichia coli BL21.Positive colony is identified the capable 1.5% agarose gel electrophoresis analysis of product with Bam H I and EcoR I double digestion.Confirm through order-checking, inserted designed Cyclin X encoding sequence.
Choosing the positive BL21 clone who expresses Cyclin X is inoculated in the 200ml LB bacteria culture medium, 37 ℃ of 250rpm shaking culture 12-15hr, the LB substratum that is diluted in preheating at 1: 10 continues shaking culture 1.5hr, add behind the 100mM IPTG to 0.2mM 32 ℃ and induce 4-5hr, 5,000g removes supernatant in 4 ℃ of centrifugal 10min, puts and uses 50ml 1 * PBS (0.14M NaCl on ice, 2.7mM KCl, 10.1mM Na
2HPO
4, 1.8mMKH
2PO
4PH7.3) resuspended, add 20%TritonX-100 to 1% jog 30min again after ultrasonic (B.Braun Labsonic U) fragmentation, then 12,000g is in 4 ℃ of centrifugal 10min, supernatant is crossed 1ml 50% glutathione S epharose 4B chromatography column, behind 1 * PBS thorough washing, add 500ul gsh elution buffer (10mM gsh, 50mM Tris-HCl, pH 8.0) room temperature leaves standstill after 30 minutes and collects elutriant, repeats wash-out 2-3 time, obtains the gst fusion protein in the high antigenicity of people Cyclin X C-terminal district.(Fig. 6)
In addition, use corresponding to the primer of full length coding region and replace above-mentioned primer, repeat above-mentioned test, obtain total length Cyclin X-GST fusion rotein.The molecular weight of fusion rotein conforms to predictor.
Embodiment 5: anti-people Cyclin X production of antibodies
The gst fusion protein in the high antigenicity of the Cyclin X C-terminal district of the reorganization of acquisition among the embodiment 4 is used for immune animal to produce antibody, and concrete grammar is as follows.Recombinant molecule is standby after separating with chromatography.Also available SDS-PAGE gel electrophoresis separates, electrophoretic band downcut from gel, and with isopyknic complete Freund ' s adjuvant emulsion.Albumen with 50-100 μ g/0.2ml emulsification carries out peritoneal injection to mouse.After 14 days,, mouse is carried out peritoneal injection with booster immunization with the dosage of 50-100 μ g/0.2ml with the same antigen of non-complete Freund ' s adjuvant emulsion.Carried out booster immunization one time every 14 days, carry out at least three times.The sero-fast specific reaction that obtains is active to be assessed in the ability of external precipitation people Cyclin X gene translation product with it.Found that antibody can combine with albumen of the present invention specifically.
Embodiment 6: the activity that people Cyclin X regulates cell growth and cell cycle regulation detects
The plasmid DNA that will contain total length Cyclin X is with LipofectAMINE reagent (Invitrogen) transfection people liver cancer SMMC 7721 cells and human breast carcinoma MCF-7 cell.60h carries out MTT experiment and the flow cytometer detection of propidium iodide (PI) dyeing back after the transfection.
The result showed that expression or the low Cyclin of expression X can regulate cell growth and cell cycle regulation.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table
＜110〉Immunology Inst., No.2 Military Medical Univ.
＜120〉novel human cyclin, its encoding sequence and purposes
<130>024974
<160>6
<170>PatentIn version 3.1
<210>1
<211>2667
<212>DNA
＜213〉homo sapiens (Homo sapiens)
<220>
<221>CDS
<222>(355)..(1914)
<223>
<400>1
ccggggtctc tgtgcgaacg tgggcatctt ggaagagtcc cagccccgct cggggcgcac 60
aggcaggcgc tctcagcacg gcacccgcgc ctccgctagg gacagacatg cttccgggtc 120
ggccggcacc gcggagtccc ctgggtaacg agcccgcccc acccgcgcca ggttccggcg 180
tcggcgttag gcgcgttgct gacgggcagg ttatgtagcc aattgcggct aggcggcgtc 240
gcgctggtcg cgggccgaac caatggcacg cgacggggcg gggcggtggc ggccgtggag 300
cttcgcgagg agccgccctg agggaagaag ccgaagggga gtcggcggca caaa atg 357
Met
1
gcg gcg gcg gcg gcg gcg gct ggt gct gca ggg tcg gca gct ccc gcg 405
Ala Ala Ala Ala Ala Ala Ala Gly Ala Ala Gly Ser Ala Ala Pro Ala
5 10 15
gca gcg gcc ggc gcc ccg gga tct ggg ggc gca ccc tca ggg tcg cag 453
Ala Ala Ala Gly Ala Pro Gly Ser Gly Gly Ala Pro Ser Gly Ser Gin
20 25 30
ggg gtg ctg atc ggg gac agg ctg tac tcc ggg gtg ctc atc acc ttg 501
Gly Val Leu Ile Gly Asp Arg Leu Tyr Ser Gly Val Leu Ile Thr Leu
35 40 45
gag aac tgc ctc ctg cct gac gac aag ctc cgt ttc acg ccg tcc atg 549
Glu Asn Cys Leu Leu Pro Asp Asp Lys Leu Arg Phe Thr Pro Ser Met
50 55 60 65
tcg agc ggc ctc gac acc gac aca gag acc gac ctc cgc gtg gtg ggc 597
Ser Ser Gly Leu Asp Thr Asp Thr Glu Thr Asp Leu Arg Val Val Gly
70 75 80
tgc gag ctc atc cag gcg gcc ggt atc ctg ctc cgc ctg ccg cag gtg 645
Cys Glu Leu Ile Gln Ala Ala Gly Ile Leu Leu Arg Leu Pro Gln Val
85 90 95
gcc atg gct acc ggg cag gtg ttg ttc cag cgg ttc ttt tat acc aag 693
Ala Met Ala Thr Gly Gln Val Leu Phe Gln Arg Phe Phe Tyr Thr Lys
100 105 110
tcc ttc gtg aag cac tcc atg gag cat gtg tca atg gcc tgt gtc cac 741
Ser Phe Val Lys His Ser Met Glu His Val Ser Met Ala Cys Val His
115 120 125
ctg gct tcc aag ata gaa gag gcc cca aga cgc ata cgg gac gtc atc 789
Leu Ala Ser Lys Ile Glu Glu Ala Pro ArgArg Ile Arg Asp Val Ile
130 135 140 145
aat gtg ttt cac cgc ctt cga cag ctg aga gac aaa aag aag ccc gtg 837
Asn Val Phe His Arg Leu Arg Gln Leu Arg Asp Lys Lys Lys Pro Val
150 155 160
cct cta cta ctg gat caa gat tat gtt aat tta aag aac caa att ata 885
Pro Leu Leu Leu Asp Gln Asp Tyr Val Asn Leu Lys Asn Gln Ile Ile
165 170 175
aag gcg gaa aga cga gtt ctc aaa gag ttg ggt ttc tgc gtc cat gtg 933
Lys Ala Glu Arg Arg Val Leu Lys Glu Leu Gly Phe Cys Val His Val
180 185 190
aag cat cct cat aag ata atc gtt atg tac ctt cag gtg tta gag tgt 981
Lys His Pro His Lys Ile Ile Val Met Tyr Leu Gln Val Leu Glu Cys
195 200 205
gag cgt aac caa cac ctg gtc cag acc tca tgg aat tac atg aac gac 1029
Glu Arg Asn Gln His Leu Val Gln Thr Ser Trp Asn Tyr Met Asn Asp
210 215 220 225
agc ctt cgc acc gac gtc ttc gtg cgg ttc cag cca gag agc atc gcc 1077
Ser Leu Arg Thr Asp Val Phe Val Arg Phe Gln Pro Glu Ser Ile Ala
230 235 240
tgt gcc tgc att tat ctt gct gcc cgg acg ctg gag atc cct ttg ccc 1125
Cys Ala Cys Ile Tyr Leu Ala Ala Arg Thr Leu Glu Ile Pro Leu Pro
245 250 255
aat cgt ccc cat tgg ttt ctt ttg ttt gga gca act gaa gaa gaa att 1173
Asn Arg Pro His Trp Phe Leu Leu Phe Gly Ala Thr Glu Glu Glu Ile
260 265 270
cag gaa atc tgc tta aag atc ttg cag ctt tat gct cgg aaa aag gtt 1221
Gln Glu Ile Cys Leu Lys Ile Leu Gln Leu Tyr Ala Arg Lys Lys Val
275 280 285
gat ctc aca cac ctg gag ggt gaa gtg gaa aaa aga aag cac gct atc 1269
Asp Leu Thr His Leu Glu Gly Glu Val Glu Lys Arg Lys His Ala Ile
290 295 300 305
gaa gag gca aag gcc caa gcc cgg ggc ctg ttg cct ggg ggc aca cag 1317
Glu Glu Ala Lys Ala Gln Ala Arg Gly Leu Leu Pro Gly Gly Thr Gln
310 315 320
gtg ctg gat ggt acc tcg ggg ttc tct cct gcc ccc aag ctg gtg gaa 1365
Val Leu Asp Gly Thr Ser Gly Phe Ser Pro Ala Pro Lys Leu Val Glu
325 330 335
tcc ccc aaa gaa ggt aaa ggg agc aag cct tcc cca ctg tct gtg aag 1413
Ser Pro Lys Glu Gly Lys Gly Ser Lys Pro Ser Pro Leu Ser Val Lys
340 345 350
aac acc aag agg agg ctg gag ggc gcc aag aaa gcc aag gcg gac agc 1461
Asn Thr Lys Arg Arg Leu Glu Gly Ala Lys Lys Ala Lys Ala Asp Ser
355 360 365
ccc gtg aac ggc ttg cca aag ggg cga gag agt cgg agt cgg agc cgg 1509
Pro Val Asn Gly Leu Pro Lys Gly Arg Glu Ser Arg Ser Arg Ser Arg
370 375 380 385
agc cgt gag cag agc tac tcg agg tcc cca tcc cga tca gcg tct cct 1557
Ser Arg Glu Gln Ser Tyr Ser Arg Ser Pro Ser Arg Ser Ala Ser Pro
390 395 400
aag agg agg aaa agt gac agc ggc tcc aca tct ggt ggg tcc aag tcg l605
Lys Arg Arg Lys Ser Asp Ser Gly Ser Thr Ser Gly Gly Ser Lys Ser
405 410 415
cag agc cgc tcc cgg agc agg agt gac tcc cca ccg aga cag gcc ccc 1653
Gln Ser Arg Ser Arg Ser Arg Ser Asp Ser Pro Pro Arg Gln Ala Pro
420 425 430
cgc agc gct ccc tac aaa ggc tct gag att cgg ggc tcc cgg aag tcc 1701
Arg Ser Ala Pro Tyr Lys Gly Ser Glu Ile Arg Gly Ser Arg Lys Ser
435 440 445
aag gac tgc aag tac ccc cag aag cca cac aag tct cgg agc cgg agt 1749
Lys Asp Cys Lys Tyr Pro Gln Lys Pro His Lys Ser Arg Ser Arg Ser
450 455 460 465
tct tcc cgt tct cga agc agg tca cgg gag cgg gcg gat aat ccg gga 1797
Ser Ser Arg Ser Arg Ser Arg Ser Arg Glu Arg Ala Asp Asn Pro Gly
470 475 480
aaa tac aag aag aaa agt cat tac tac aga gat cag cga cga gag cgc 1845
Lys Tyr Lys Lys Lys Ser His Tyr Tyr Arg Asp Gln Arg Arg Glu Arg
485 490 495
tcg agg tcg tat gaa cgc aca ggc cgt cgc tat gag cgg gac cac cct 1893
Ser Arg Ser Tyr Glu Arg Thr Gly Arg Arg Tyr Glu Arg Asp His Pro
500 505 510
ggg cac agc agg cat cgg agg tgaggcgggg ttgcagtgac tggtggccgc 1944
Gly His Ser Arg His Arg Arg
515 520
aagcccttcc ctggggagta cctgatggct gccctttgac ccccggtggc tgccctttga 2004
cccccgggtg tgctctcagc gcaagtggtc ctagaacagg attctttttg gaaatgtctg 2064
tcgactggac cttggtggat ttggaaatgg aactgaggga ccggtgacac gtgcttcaga 2124
ccggtctggg gtgcggcgca cacctgggcc cgtgcagggc tcagctcggc agcagctctg 2184
agggcagctc aatgaaaaag tgaatgcaca cgcccttgtt ggcgtggcct ggcatggcct 2244
ggtgctatcg gaagccgctc tccactcccc gactgatact caattacgtg aagccaagaa 2304
agatgatttt tgagaacctt tggctatatt aggttgtact ctatgtcaca tattttggca 2364
gcgttttcac aggagaaagt ggccttaact gccccttatt ctctctccac gttgtaaata 2424
aacatgtgtt taatacaagt taaagctatg tatgaaaact cagaacttga atcccgtcag 2484
cttaaaactt gtgtagggaa tcctgacttt taaaatgtga gggtatttgg atctgtgttg 2544
aaagtcgtat atttttatct gtgcggtgct gagtgcaggc caccagctcc taaatagagg 2604
ttccctatat gcgcgtatga catggtgaat aaacacaact ctctccactc aggaaaaaaa 2664
aaa 2667
<210>2
<211>520
<212>PRT
＜213〉homo sapiens (Homo sapiens)
<400>2
Met Ala Ala Ala Ala Ala Ala Ala Gly Ala Ala Gly Ser Ala Ala Pro
1 5 10 15
Ala Ala Ala Ala Gly Ala Pro Gly Ser Gly Gly Ala Pro Ser Gly Ser
20 25 30
Gln Gly Val Leu Ile Gly Asp Arg Leu Tyr Ser Gly Val Leu Ile Thr
35 40 45
Leu Glu Asn Cys Leu Leu Pro Asp Asp Lys Leu Arg Phe Thr Pro Ser
50 55 60
Met Ser Ser Gly Leu Asp Thr Asp Thr Glu Thr Asp Leu Arg Val Val
65 70 75 80
Gly Cys Glu Leu Ile Gln Ala Ala Gly Ile Leu Leu Arg Leu Pro Gln
85 90 95
Val Ala Met Ala Thr Gly Gln Val Leu Phe Gln Arg Phe Phe Tyr Thr
100 105 110
Lys Ser Phe Val Lys His Ser Met Glu His Val Ser Met Ala Cys Val
115 120 125
His Leu Ala Ser Lys Ile Glu Glu Ala Pro Arg Arg Ile Arg Asp Val
130 135 140
Ile Asn Val Phe His Arg Leu Arg Gln Leu Arg Asp Lys Lys Lys Pro
145 150 155 160
Val Pro Leu Leu Leu Asp Gln Asp Tyr Val Asn Leu Lys Asn Gln Ile
165 170 175
Ile Lys Ala Glu Arg Arg Val Leu Lys Glu Leu Gly Phe Cys Val His
180 185 190
Val Lys His Pro His Lys Ile Ile Val Met Tyr Leu Gln Val Leu Glu
195 200 205
Cys Glu Arg Asn Gln His Leu Val Gln Thr Ser Trp Asn Tyr Met Asn
210 215 220
Asp Ser Leu Arg Thr Asp Val Phe Val Arg Phe Gln Pro Glu Ser Ile
225 230 235 240
Ala Cys Ala Cys Ile Tyr Leu Ala Ala Arg Thr Leu Glu Ile Pro Leu
245 250 255
Pro Asn Arg Pro His Trp Phe Leu Leu Phe Gly Ala Thr Glu Glu Glu
260 265 270
Ile Gln Glu Ile Cys Leu Lys Ile Leu Gln Leu Tyr Ala Arg Lys Lys
275 280 285
Val Asp Leu Thr His Leu Glu Gly Glu Val Glu Lys Arg Lys His Ala
290 295 300
Ile Glu Glu Ala Lys Ala Gln Ala Arg Gly Leu Leu Pro Gly Gly Thr
305 310 315 320
Gln Val Leu Asp Gly Thr Ser Gly Phe Ser Pro Ala Pro Lys Leu Val
325 330 335
Glu Ser Pro Lys Glu Gly Lys Gly Ser Lys Pro Ser Pro Leu Ser Val
340 345 350
Lys Asn Thr Lys Arg Arg Leu Glu Gly Ala Lys Lys Ala Lys Ala Asp
355 360 365
Ser Pro Val Asn Gly Leu Pro Lys Gly Arg Glu Ser Arg Ser Arg Ser
370 375 380
Arg Ser Arg Glu Gln Ser Tyr Ser Arg Ser Pro Ser Arg Ser Ala Ser
385 390 395 400
Pro Lys Arg Arg Lys Ser Asp Ser Gly Ser Thr Ser Gly Gly Ser Lys
405 410 415
Ser Gln Ser Arg Ser Arg Ser Arg Ser Asp Ser Pro Pro Arg Gln Ala
420 425 430
Pro Arg Ser Ala Pro Tyr Lys Gly Ser Glu Ile Arg Gly Ser Arg Lys
435 440 445
Ser Lys Asp Cys Lys Tyr Pro Gln Lys Pro His Lys Ser Arg Ser Arg
450 455 460
Ser Ser Ser Arg Ser Arg Ser Arg Ser Arg Glu Arg Ala Asp Asn Pro
465 470 475 480
Gly Lys Tyr Lys Lys Lys Ser His Tyr Tyr Arg Asp Gln Arg Arg Glu
485 490 495
Arg Ser Arg Ser Tyr Glu Arg Thr Gly Arg Arg Tyr Glu Arg Asp His
500 505 510
Pro Gly His Ser Arg His Arg Arg
515 520
<210>3
<211>26
<212>DNA
＜213〉primer
<400>3
caggctgtac tccggggtgc tcatca 26
<210>4
<211>30
<212>DNA
＜213〉primer
<400>4
cacgtgtcac cggtccctca gttccatttc 30
<210>5
<211>33
<212>DNA
＜213〉primer
<400>5
taggatccag gctgtactcc ggggtgctca tca 33
<210>6
<211>32
<212>DNA
＜213〉primer
<400>6
gagaattctg cgtcttgggg cctcttctat ct 32
Claims (10)
1. isolating people Cyclin X polypeptide is characterized in that this polypeptide is selected from down group:
(a) polypeptide of SEQ ID NO:2 aminoacid sequence;
(b) SEQ ID NO:2 aminoacid sequence is formed through replacement, disappearance or the interpolation of 1-10 amino-acid residue, and have regulate that cell is grown and the cell cycle regulation function by (a) polypeptides derived.
2. polypeptide as claimed in claim 1 is characterized in that, described polypeptide is the polypeptide of SEQ ID NO:2 aminoacid sequence.
3. isolating polynucleotide is characterized in that, this nucleotide sequence is selected from down group:
(a) polynucleotide of polypeptide as claimed in claim 1 or 2 of encoding;
(b) with the complete complementary polynucleotide of polynucleotide (a).
4. polynucleotide as claimed in claim 3 is characterized in that, the polypeptide of aminoacid sequence shown in this polynucleotide encoding SEQ ID NO:2.
5. polynucleotide as claimed in claim 3 is characterized in that, the sequence of these polynucleotide is selected from down a kind of of group:
(a) nucleotide sequence of 355-1914 position among the SEQ ID NO:1;
(b) nucleotide sequence of 1-2667 position among the SEQ ID NO:1.
6. a carrier is characterized in that, it contains the described polynucleotide of claim 3.
7. a genetically engineered host cell is characterized in that, it contains the described carrier of claim 6.
8. one kind prepares the described isolating people Cyclin X polypeptide method of claim 1, it is characterized in that this method comprises:
(a) under the condition that is fit to expressing human Cyclin X polypeptide, cultivate the described host cell of claim 7;
(b) from culture, isolate the described people Cyclin of claim 1 X polypeptide.
9. energy and the described people Cyclin of claim 1 X polypeptid specificity bonded antibody.
10. a pharmaceutical composition is characterized in that, it contains the described polypeptide of claim 1 and the pharmaceutically acceptable carrier of safe and effective amount.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN02136554.7A CN1277844C (en) | 2002-08-19 | 2002-08-19 | Novel human cyclin, its coding sequence and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN02136554.7A CN1277844C (en) | 2002-08-19 | 2002-08-19 | Novel human cyclin, its coding sequence and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1477115A CN1477115A (en) | 2004-02-25 |
| CN1277844C true CN1277844C (en) | 2006-10-04 |
Family
ID=34146533
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN02136554.7A Expired - Lifetime CN1277844C (en) | 2002-08-19 | 2002-08-19 | Novel human cyclin, its coding sequence and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1277844C (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113444158B (en) * | 2020-03-27 | 2022-11-18 | 中国科学院微生物研究所 | Important role of B-type cyclin Cbc1 and coding gene thereof in pathogenicity of cryptococcus neoformans |
| CN113698466B (en) * | 2021-07-30 | 2023-07-14 | 山东农业大学 | Application of CCND1 in preparation of avian retrovirus production enhancer |
-
2002
- 2002-08-19 CN CN02136554.7A patent/CN1277844C/en not_active Expired - Lifetime
Also Published As
| Publication number | Publication date |
|---|---|
| CN1477115A (en) | 2004-02-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1286973C (en) | Histone methyl transferase and its preparing method | |
| CN1212334C (en) | Human siali acid conjugated immunoglobulin-like agglutinant, its coding sequence and use | |
| CN1277844C (en) | Novel human cyclin, its coding sequence and application | |
| CN1170850C (en) | Human angiogenin-like protein and coding sequence and application thereof | |
| CN1308346C (en) | Novel human phosphotidylethanolamine binding protein, its coding sequence and application | |
| CN1244595C (en) | Tumor suppressor protein and its application | |
| CN1163506C (en) | New human cell factor and its code sequence and use | |
| CN1289524C (en) | Human telomerase active inhibitor protein and use thereof | |
| CN1234728C (en) | Novel human lymphokine, its coding sequence and use | |
| CN1194012C (en) | Sperm formation relative protein and its coding sequence and use | |
| CN1300170C (en) | Novel DnaJ/Hsp40 molecule DC-DJIII, its coding sequence and application | |
| CN1160370C (en) | A novel human cell cysle control related protein and a sequence encoding the same | |
| CN1290861C (en) | New type human bone marrow substrate cell source 1 type phosphoric acid enzyme inhibition factor, its coded sequence and use | |
| CN1170844C (en) | Human macrobiosis-ensuring protein and its coding sequence and application | |
| CN1273485C (en) | Immunoglobulin sample receptor originated from human dendritic cell, its coding sequence and application | |
| CN1152957C (en) | Human 6-phosphoglucosamine isomerase, its code sequence and application | |
| CN1151251C (en) | New human-phosphoguanosine reductase, its coding sequence and application | |
| CN1710069A (en) | Adenylosuccinate synthetase sample molecule and its coding sequence and use | |
| CN1304568C (en) | Novel human complement C1r-like serine proteinase analogue, and its encoding sequence and use | |
| CN1155613C (en) | Human tumor associated gene in 1-zone 3-band 3-subband of short arm of human chromosome No.17 and its coding protein | |
| CN1209372C (en) | Human tumor relative gene CT120 in human 17p 13.3 area and coding protein thereof | |
| CN1500807A (en) | Method for diagnosing and curing alopecia utilizing the Rhor gene of human and rat and the encoding products | |
| CN1169832C (en) | Identification and function research of gene p28-II | |
| CN1213069C (en) | Growth promoting factor and its prepn and use | |
| CN1534043A (en) | Ubiquition type molecule of human bone marrow substrate cell source and its coding sequence and use |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CX01 | Expiry of patent term | ||
| CX01 | Expiry of patent term |
Granted publication date: 20061004 |