CN1670197A

CN1670197A - Arginase of Japanese blood fluke, its coding nucleic acid and application

Info

Publication number: CN1670197A
Application number: CNA2005100241973A
Authority: CN
Inventors: 余新炳; 吴忠道; 李孜; 彭寨玉; 胡旭初
Original assignee: Sun Yat Sen University
Current assignee: Sun Yat Sen University
Priority date: 2005-03-03
Filing date: 2005-03-03
Publication date: 2005-09-21

Abstract

The invention discloses new genes for encoding Schistosoma japonicum arginase, polypeptides encoded by the genes, and antibody of the polypeptides. The invention also discloses the depressor of the polypeptides for screening the Schistosoma japonicum arginase, the use of polynucleotides as primer or as probe, in particular the use of the polypeptide and polynucleotide as diagnosis reagent kit, vaccine and pharmaceutical composition.

Description

Arginase of Japanese blood fluke, its coding nucleic acid and application thereof

Technical field

The invention belongs to biological technical field, specifically, the invention describes a kind of new polypeptide---arginase of Japanese blood fluke, and the polynucleotide sequence of this polypeptide of encoding.The invention still further relates to the application of these polynucleotide and polypeptide.

Background technology

Schistosomicide remains one of current serious public health problem, and vaccine can be used for prevention and treatment schistosomicide, studies and finds suitable schistosomicide disease vaccine to become the focus of present research.Domestic at six vaccine candidate molecule-Sj 28 GST of schistosomiasis mansoni, paramyosin, triosephosphate isomerase, integral membrane proteins, irradiation attenuation antigen-5 and the fatty acid binding protein recommended corresponding to WHO; and observe after the research of Sj32, cathepsin B, tropomyosin, yolk ferritin, LDH, Sj16 and CyPA etc., their protectiveness effect is unsatisfactory.Therefore, the successful development of vaccine needs new schistosomicide vaccine candidate gene, particularly influences bilharzial growing and molecule that schistosomicide is worked in the attack that influences host immune system.Arginase just belongs to this quasi-molecule.

(system ARG) is called L-arginine amidino groups lytic enzyme (L-Arginineamidinohydrolase) to arginase, once is called L-arginine urea lytic enzyme (L-Arginine ureo-hydrogenase) for EC3.5.3.1, Arginase.There are four members in ARG family: arginase, agmatinase, Formiminoglutamase and proclavaminate amidine lytic enzyme ^[45]Mammiferous ARG has two kinds of isozymes at least, and I type (AI) and II type (AII) can both generate urea and ornithine by the hydrolysis arginine.AI by the urea cycle urea synthesis, plays an important role in the nitrogen of draining body internal protein metabolism generation and the intravital pH value of balance in Mammals and people liver, and it is high expression level in liver cell; AII has not same-action different organisms and different tissues, and its Subcellular Localization is also different, is positioned at plastosome in Mammals and human body, expresses at kidney, brain, small intestine, mammary gland and scavenger cell, and almost is beyond expression in the liver.AII participates in the metabolism of polyamines and the generation of L-glutamic acid, proline(Pro) and γ-An Jidingsuan (GABA); And can promote that jointly arginine changes Methionin into ornithine carbamyl transferase; Synthetic relevant with NO.But report is also arranged, and AI and AII can regulate the synthetic of polyamines.The ornithine that ARG catalysis produces is synthetic L-glutamic acid, proline(Pro) and polyamines under ornithine decarboxylase (ODC) effect.Polyamines is the small molecules of positively charged, plays an important role in cell comprises the propagation of normal cell and tumour cell and breaks up, and may be to influence its conformation by combining with nucleic acid in the nucleus, thereby influence the function of nucleic acid; High polyamines is the entozoic parasitic growth of host and breaks up necessary.Glutamate is an important intermediate product in protein metabolism and the energy metabolism, and the ARG activity increases in the host that African trypanosoma infects, and causes the ornithine level to raise, and the trypanothione and the polyamine level that are equivalent to gsh in the trypanosome body all raise.Proline(Pro) and Methionin all are the important source material of synthetic collagen, composition reticular tissue; Glutamate is important inhibitory nerve mediator in central nervous system, can be transformed into GABA, so AII distributes in brain, the mediator that can affect the nerves synthetic.

NO is the effector molecule of tumour immunity, causal organism immunity, is again the adjusting molecule of panimmunity cell.Body mainly occurs in the transcriptional level of NO synthetase II (NOS-II) to the regulation and control of NO concentration, the L-arginine is unique substrate of the synthetic NO of NOS, because the NOS-II substrate identical with ARG catalysis, ARG can be by reducing the arginic amount of substrate-L-of NOS-II, reduce the synthetic of the interior NO of body, thereby escape NO to the pathogenic agent toxic action of (comprising parasite), also can limit the pathologic effect that high NO is produced in the body; And the activity of ornithine decarboxylase is by the NO negative regulation.In vivo, the ARG high conservative, the ARG activity of pathogenic agent can be competed substrate with host's ARG and NOS-II, thereby disturbs the activity of host ARG and NOS-II, discover that the ARG that Helicobacter pylori produces can suppress the generation of NO in the cells infected.Infected by microbes both can activate the interior ARG of generation of M Φ also can activate M Φ generation NOS-II ^[At inflammation part, Th1 cytokines (IL-1, IFN-γ and TNF-α) and Th2 cytokines (IL-4, IL-13, TGF-β etc.) activate the expression of NOS-II and ARG respectively; And the Th1 cytokines plays restraining effect to the expression of ARG, and the Th2 cytokines plays restraining effect to the expression of NOS-II.Therefore, the balance of Th1/Th2 cytokines also is the mechanism that the space-time of NO generation was regulated and limited to body immune system in the body.In the body that infects Sm, NO may be relevant to killing and wounding of lung phase child worm with the early stage host of infection, but be not enough to eliminate it; After the liver worm's ovum deposition, NOS-II is by abduction delivering, and this moment, NO was relevant with the pathologic reaction that worm's ovum causes, the inhibitor of NOS-II-monomethyl L-arginine and N (OMEGA)-hydroxyl-L-arginine can reduce liver injury.Sm infects and impels host's peritoneal macrophage to activate cytokines such as producing IL-4, and ARG in the scavenger cell rather than NOS-II express to be increased, and proline(Pro) is synthetic to be increased, and promotes collagen deposition, thereby causes the granulomatous formation of worm's ovum; The synthetic of polyamines increased, and the polyamines in the recycle system increases, and worm's ovum deposition level is proportionate in polyamine level and the liver, therefore can be by detecting worm's ovum deposition and The liver damage level in the polyamine level Indirect evaluation liver.AII and NOS-II competition substrate, the former can suppress the activity of NOS-II, the generation of downward modulation NO: the intravital NO of host is reduced the lethal effect that infects virgin worm of early stage lung phase, can make scavenger cell reactionless on the other hand to the stimulation of IFN-γ and TNF-α.Promote that polyamines synthetic enzyme is lowly to express or do not express in the Sm body, it mainly takes in polyamines in host, and red corpuscle is the storage vault of polyamines, and Sm a large amount of red corpuscle of in host's blood vessel, eating, therefore high polyamines helps Sm existence in the circulation.

ARG mainly is positioned cytoplasm in the cell, and part attaches to nucleus, microsome and plastosome.ARG subunit size is 30-40kDa, and quaternary structure does not wait to eight aggressiveness from single subunit, and the about 105kDa of the pure goods molecular weight of people's extractum hepatis propylhomoserin enzyme is the oligomer structure of dimer or tripolymer formation.Human body AII solubleness is big, heat-resisting (60 ℃ stable), and optimal pH is the tetramer that the subunit of 3000Da is formed by molecular weight between 10.0-10.6.Anti-extractum hepatis propylhomoserin enzyme serum does not play cross reaction to mammary gland AII.AI has similarity with AII on enzymic activity: similar Km is arranged; All needing divalent heavy metal ions is cofactor, though cobalt, nickel, cadmium and vanadium etc. are to ARG energy enhanced activity, with Mn ²⁺Effect the strongest, may with Mn ²⁺Be beneficial to the polymeric formation of ARG, structural stability is relevant; The molecular weight size is more or less the same.ARG is subjected to the competitive inhibition of Methionin, and AI is subjected to the inhibition of product ornithine, but is not subjected to the inhibition of another product urea, and AII neither is subjected to ornithine also not to be subjected to the inhibition of urea, so the effect of AII is to be used for synthetic ornithine rather than to produce urea.Thereby thiocyanation compound, salicylate and ten disulfo acid are received and can be made protein denaturation make ARG inactivation, Ag ⁺And Hg ²⁺Can play direct repression to ARG, fluorochemical, borate and citric acid may form mixture with the activator metal ion of ARG and become the active noncompetitive inhibitor of ARG.

The AI of rat is existing unique xln in the arginase so far.Have only a kind of ARG in microorganism, be called diseased spermine enzyme (EC3.5.3.11), the approach that makes arginine form urea is: first arginine decarboxylation forms agmatine, and the agmatine hydrolysis produces carnitine and urea again.Arginase sequence and function in the yeast are known.Clone and check order in the cDNA sequence of beautiful rhabditida [American National biotechnology information center (NCBI) nucleotide sequence accession number is NM_076547] and leishmania (NCBI nucleotide sequence accession number has AY386701 and AF038409) arginine gene.Find after the functional study to leishmania ARG: it also has only a kind of ARG, and not resembling Mammals has AI and AII amphitypy; ARG plays an important role in leishmanial existence with in growing, and provides polyamines synthetic precursor because ARG can be it.The cDNA sequence (the NCBI accession number is AF402615) of arginase of Japanese blood fluke has been logined in my laboratory for the first time in 1998, except that leishmania and beautiful rhabditida, the complete sequence of other parasitic arginase does not have report, so far, Schistosoma mansoni only has one and arginase homologous EST login.By the analysis of Blastx and conservative functional domain, the author finds that the nucleotide sequence of coding arginase does not wherein have complete CDS, and initial ATG is a coding arginase aminoacid sequence intermediary methionine residue, and 5 ' end is still imperfect.

The inventor has separated coding arginase of Japanese blood fluke DNA through extensive and deep research from Schistosoma japonicum, and expression and purification arginase of Japanese blood fluke, and further disclosed application based on these polynucleotide and polypeptide.

Summary of the invention

An object of the present invention is to provide isolating new polypeptide---arginase of Japanese blood fluke with and fragment, analogue and derivative.

Another object of the present invention provides the polynucleotide of this polypeptide of coding.

Another object of the present invention provides at polypeptide of the present invention---the antibody of arginase of Japanese blood fluke.

Another object of the present invention has provided the polynucleotide that suppress expression of polypeptides of the present invention.

Another object of the present invention provides the inhibitor that polypeptide of the present invention is applied to screen arginase of Japanese blood fluke; Perhaps be used for the peptide finger print identification.

Another object of the present invention provides nucleic acid molecule of the present invention and is used for nucleic acid amplification reaction as primer, perhaps is used for hybridization as probe, perhaps is used to make the application of gene chip or microarray.

Another object of the present invention provides a kind of test kit that detects Schistosoma japonicum, and it contains primer, antibody or the polypeptide of specific detection arginase of Japanese blood fluke itself.

Another object of the present invention provides a kind of vaccine that is used to prevent schistosomiasis japanica, and it contains arginase of Japanese blood fluke or the carrier for expression of eukaryon of the polynucleotide of this enzyme of encoding.

In a first aspect of the present invention, the present invention relates to a kind of isolated polypeptide, this polypeptide is the Schistosoma japonicum source, it comprises: polypeptide or its examples of conservative variations, bioactive fragment or derivative with SEQ ID No.2 aminoacid sequence.Preferably, this polypeptide is the polypeptide with SEQ ID NO:2 aminoacid sequence.More preferably, this polypeptide does not contain signal peptide sequence.

In a second aspect of the present invention, the invention still further relates to a kind of isolating polynucleotide, it comprises a kind of nucleotide sequence or its variant that is selected from down group:

(a) coding has the polynucleotide of the polypeptide of SEQ ID No.2 aminoacid sequence;

(b) with polynucleotide (a) complementary polynucleotide;

More preferably, the sequence of these polynucleotide is be selected from down group a kind of: the sequence that (a) has 12-1106 position among the SEQ ID NO:1; (b) has the sequence of 1-1273 position among the SEQ ID NO:1.

In a third aspect of the present invention, the invention still further relates to a kind of can with polypeptid specificity bonded antibody of the present invention.

In a fourth aspect of the present invention, the polynucleotide that suppress expression of polypeptides of the present invention are provided.

In a fifth aspect of the present invention, provide the purposes of polypeptide of the present invention and encoding sequence.For example, utilize polypeptide to be applied to screen the inhibitor of arginase of Japanese blood fluke, the inhibitor that is filtered out is formed the pharmaceutical composition of treatment schistosomiasis japanica with safe and effective dosage and pharmaceutically acceptable excipient; Perhaps be used for the peptide finger print identification.Utilize encoding sequence or its fragment to be used for nucleic acid amplification reaction, perhaps be used for hybridization, perhaps be used to make the application of gene chip or microarray as probe as primer.

In a sixth aspect of the present invention, a kind of test kit that detects Schistosoma japonicum is provided, it contains primer, antibody or the polypeptide of specific detection arginase of Japanese blood fluke itself.

In a seventh aspect of the present invention, a kind of vaccine that is used to prevent Schistosoma japonicum is provided, it contains arginase or the carrier for expression of eukaryon of the polynucleotide of this enzyme of encoding.

Others of the present invention for example, utilize the present invention can relate to a kind of carrier that contains polynucleotide of the present invention, particularly expression vector because disclosing of the technology of this paper is conspicuous to those skilled in the art; The host cell that this carrier of a kind of usefulness is genetically engineered comprises the host cell of conversion, transduction or transfection; A kind of method for preparing polypeptide of the present invention of cultivating described host cell and reclaiming expression product that comprises.

The following term of using in this specification sheets and claims has following implication unless stated otherwise:

" nucleotide sequence " is meant oligonucleotide, Nucleotide or polynucleotide and fragment or part, also can refer to genome or synthetic DNA or RNA, and they can be strand or two strands, represent sense strand or antisense strand.Similarly, term " aminoacid sequence " is meant oligopeptides, peptide, polypeptide or protein sequence and fragment or part.When " aminoacid sequence " among the present invention related to a kind of aminoacid sequence of naturally occurring protein molecule, this " polypeptide " or " protein " did not mean that aminoacid sequence are restricted to the complete natural amino acid relevant with described protein molecule.

Protein or polynucleotide " variant " are meant a kind of polynucleotide sequence that has the aminoacid sequence of one or more amino acid or Nucleotide change or encode it.Described change can comprise disappearance, insertion or the replacement of amino acid in aminoacid sequence or the nucleotide sequence or Nucleotide.Variant can have " conservative property " and change, and wherein the amino acid of Ti Huaning has structure or the chemical property similar with original acid, as replacing Isoleucine with leucine.Variant also can have non-conservation and change, as replacing glycine with tryptophane.

" biological activity " is meant the protein of structure, regulation and control or biochemical function with natural molecule.Similarly, term " immunologic competence " be meant natural, reorganization or synthetic protein and fragment thereof in suitable animal or cell, induce specific immune response and with specific antibody bonded ability.

" inhibition " is meant when combining with arginase of Japanese blood fluke, a kind of molecule that seals or regulate the biologic activity of arginase of Japanese blood fluke.Inhibition can comprise protein, nucleic acid, carbohydrate or any other can be in conjunction with the molecule of arginase of Japanese blood fluke.

" adjusting " is meant that the function of arginase of Japanese blood fluke changes, and comprises the change of any other biological property, function or the immune property of the change of the rising of protein active or reduction, binding characteristic and arginase of Japanese blood fluke.

" pure basically " is meant and is substantially free of natural relative other albumen, lipid, carbohydrate or other material.Those skilled in the art can use the purified technology of protein purifying arginase of Japanese blood fluke of standard.Basically pure arginase of Japanese blood fluke can produce single master tape on the irreducibility polyacrylamide gel.The purity available amino end acid sequence of arginase of Japanese blood fluke polypeptide is analyzed.

" complementary " or " complementation " is meant under salt concn that allows and temperature condition by the natural combination of the polynucleotide of base pairing.For example, sequence " C-T-G-A " can combine with complementary sequence " G-A-C-T ".Complementation between two single chain molecules can be part or whole.Complementary degree between the nucleic acid chains has a significant effect for efficient of hybridizing between the nucleic acid chains and intensity.

" homology " is meant the complementary degree, can be portion homologous or complete homology." portion homologous " is meant a kind of part complementary sequence, and it can partly suppress the hybridization of complete complementary sequence and target nucleic acid at least.The inhibition of this hybridization can detect by hybridizing (Southern trace or Northern trace etc.) under the condition that reduces in the severity degree.Basically homologous sequence or hybridization probe can compete and suppress complete homologous sequence and target sequence the condition that reduces of severity degree under combine.This does not mean the conditions permit non-specific binding that the severity degree reduces because the conditional request two sequences that the severity degree reduces mutual be combined into specificity or selectivity interacts.

" antisense " is meant and specific DNA or RNA sequence complementary nucleotide sequence." antisense strand " is meant and " sense strand " complementary nucleic acid chains.

" derivative " is meant HFP or encodes its chemical modification object of nucleic acid.This chemical modification object can be with alkyl, acyl group or the amino hydrogen atom of replacing.The nucleic acid derivative codified keeps the polypeptide of the main biological characteristics of natural molecule.

" antibody " is meant complete antibody molecule and fragment thereof, as Fab, F (ab ') ₂And Fv, its energy specificity is in conjunction with the antigenic determinant of arginase of Japanese blood fluke.

" isolating " speech refers to material is shifted out among its original environment (for example, if spontaneous its natural surroundings that just refers to).Such as it is exactly not to be separated that spontaneous polynucleotide or polypeptide are present in the Live Animals, but same polynucleotide or polypeptide with some or all in natural system with it the material of coexistence separately be exactly isolating.Such polynucleotide may be the parts of a certain carrier, the part that also possible such polynucleotide or polypeptide are a certain composition.Since carrier or composition are not the compositions of its natural surroundings, they remain isolating.

As used herein, " isolating " are meant that material separates (if natural substance, primal environment promptly is a natural surroundings) from its primal environment.Do not have separation and purification as polynucleotide under the native state in the active somatic cell and polypeptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then for separation and purification.

As used herein, " isolating arginase of Japanese blood fluke " is meant that arginase of Japanese blood fluke is substantially free of natural relative other albumen, lipid, carbohydrate or other material.Those skilled in the art can use the purified technology of protein purifying arginase of Japanese blood fluke of standard.Basically pure polypeptide can produce single master tape on non-reduced polyacrylamide gel.The purity of arginase of Japanese blood fluke polypeptide can be used amino acid sequence analysis.

In a first aspect of the present invention, the invention provides a kind of new polypeptide---arginase of Japanese blood fluke, it is made up of the aminoacid sequence shown in the SEQ ID NO:2 basically.Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic polypeptide, preferred recombinant polypeptide.Polypeptide of the present invention can be the product of natural purifying, or the product of chemosynthesis, or uses recombinant technology to produce from protokaryon or eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell).The host used according to the recombinant production scheme, polypeptide of the present invention can be glycosylated, maybe can be nonglycosylated.Polypeptide of the present invention also can comprise or not comprise initial methionine residues.

The present invention also comprises fragment, derivative and the analogue of arginase of Japanese blood fluke.As used herein, term " fragment ", " derivative " are meant with " analogue " and keep identical biological function of arginase of Japanese blood fluke of the present invention or active polypeptide basically.The fragment of polypeptide of the present invention, derivative or analogue can be: (I) a kind of like this, wherein one or more amino-acid residues are replaced by conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the amino acid that replaces can be also can not encoded by genetic codon; Perhaps (II) is a kind of like this, and certain group on wherein one or more amino-acid residues is replaced by other group and comprises substituting group; Perhaps (III) is a kind of like this, and wherein mature polypeptide and another kind of compound (such as the compound that prolongs the polypeptide transformation period, for example polyoxyethylene glycol) merge; Perhaps (IV) is a kind of like this, wherein additional aminoacid sequence is integrated into mature polypeptide and the peptide sequence that forms (as leader sequence or secretion sequence or be used for the sequence or the proteinogen sequence of this polypeptide of purifying) by the elaboration of this paper, such fragment, derivative and analogue are considered within those skilled in the art's ken.

In a second aspect of the present invention, the invention provides isolating polynucleotide, substantially the polynucleotide that have a polypeptide of SEQ ID NO:2 aminoacid sequence by coding are formed.Polynucleotide sequence of the present invention comprises the nucleotide sequence of SEQ ID NO:1.Polynucleotide of the present invention are to find from Japanese blood is tied to form the full-length cDNA library of worm.The polynucleotide sequence total length that it comprises is 1273 bases, its open reading frame (12-1106) 364 amino acid of having encoded.Find relatively that according to amino acid sequence homologous the arginase of the II type of this polypeptide and mouse has 63% homology, it is exactly arginase of Japanese blood fluke that deducibility goes out this albumen.

Polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:1 or the varient of degeneracy.As used herein, " varient of degeneracy " are meant that in the present invention coding has protein or the polypeptide of SEQ ID NO:2, but with the differentiated nucleotide sequence of coding region sequence shown in the SEQ ID NO:1.

The polynucleotide of the mature polypeptide of coding SEQ ID NO:2 comprise: the encoding sequence that has only mature polypeptide; The encoding sequence of mature polypeptide and various additional code sequence; Encoding sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence.

Term " polynucleotide of coded polypeptide " is meant polynucleotide that comprise this polypeptide of encoding and the polynucleotide that comprise additional code and/or non-coding sequence.

The invention still further relates to the varient of foregoing description polynucleotide, its coding has the polypeptide of identical aminoacid sequence or segment, analogue and the derivative of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing the function of its encoded polypeptides in fact.

The invention still further relates to polynucleotide with sequence hybridization described above.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide of the present invention.In the present invention, " stringent condition " is meant: (1) than hybridization under low ionic strength and the comparatively high temps and wash-out, as 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time adds and to use denaturing agent, as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 95%, be more preferably 97% and just hybridize when above.And the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in the SEQ IDNO:2.

The invention still further relates to nucleic acid fragment with sequence hybridization described above.As used herein, " nucleic acid fragment " length contain 10 Nucleotide at least, better be 20-30 Nucleotide at least, be more preferably 50-60 Nucleotide at least, preferably more than at least 100 Nucleotide.Nucleic acid fragment also can be used for the amplification technique (as PCR) of nucleic acid to determine and/or to separate the polynucleotide of coding arginase of Japanese blood fluke.

Polypeptide among the present invention and polynucleotide preferably provide with isolating form, more preferably are purified to homogeneous.

The special polynucleotide sequence of coding arginase of Japanese blood fluke of the present invention can obtain with several different methods.For example, separate polynucleotide with hybridization technique well known in the art.These technology including, but not limited to: 1) with probe and genome or the hybridization of cDNA library to detect the homologous polynucleotide sequence, 2) antibody screening of expression library is to detect the polynucleotide passage of the clone with common structure feature, 3) the isolating polynucleotide passage of expressed sequence tag (EST) technology.

Sequence dna fragment of the present invention also can obtain with following method: 1) separate double chain DNA sequence from genomic dna; 2) the chemical synthesising DNA sequence is to obtain the double-stranded DNA of described polypeptide.

In the above-mentioned method of mentioning, isolation of genomic DNA is least commonly used.The direct chemical of dna sequence dna is synthetic to be the method for often selecting for use.The more frequent method of selecting for use is the separation of cDNA sequence.The standard method that separates interested cDNA is from the donorcells separating mRNA of this gene of high expression level and carries out reverse transcription, forms plasmid or phage full-length cDNA library.Extract the existing multiple proven technique of method of mRNA, test kit also can obtain (Qiagene) from commercial channels.And the construction cDNA library also is usual method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory.New York, 1989).When being used in combination the polymeric enzyme reaction technology, even few expression product also can be cloned.

Available ordinary method is screened gene of the present invention from these cDNA libraries.These methods include, but is not limited to: (1) DNA-DNA or DNA-RNA hybridization; (2) appearance of marker gene function or forfeiture; (3) level of the transcript of mensuration arginase of Japanese blood fluke; (4), detect the protein product of genetic expression by immunological technique or mensuration biologic activity.Aforesaid method can singly be used, but also several different methods combined utilization.

In (1) kind method, hybridizing used probe is and any a part of homology of polynucleotide of the present invention that at least 10 Nucleotide of its length better are at least 30 Nucleotide, are more preferably at least 50 Nucleotide, preferably at least 100 Nucleotide.In addition, within 2000 Nucleotide, preferable is within 1000 Nucleotide to the length of probe usually.Probe used herein is the dna sequence dna of chemosynthesis on the basis of gene order information of the present invention normally.Gene of the present invention itself or fragment are certainly as probe.The mark of dna probe can be used radio isotope, fluorescein or enzyme (as alkaline phosphatase) etc.

In (4) kind method, detect the protein product of arginase of Japanese blood fluke genetic expression and can use immunological technique such as Western blotting, radioimmunoprecipitation, enzyme-linked immunosorbent assay (ELISA) etc.

The method of using round pcr DNA amplification/RNA is optimized for and obtains gene of the present invention.When particularly being difficult to from the library, obtain the cDNA of total length, can preferably use RACE method (the terminal rapid amplifying method of RACE-cDNA), the primer that is used for PCR can suitably be selected according to polynucleotide sequence information of the present invention disclosed herein, and available ordinary method is synthetic.Available ordinary method is as the DNA/RNA fragment by gel electrophoresis separation and purifying amplification.

The gene of the present invention that obtains as mentioned above, perhaps the polynucleotide sequence of various dna fragmentations etc. can be used ordinary method such as double deoxidating chain termination measuring.This class polynucleotide sequence is measured also available commercial sequencing kit etc.In order to obtain the cDNA sequence of total length, order-checking need be carried out repeatedly.Sometimes need to measure a plurality of clones' cDNA sequence, just can be spliced into the cDNA sequence of total length.

The present invention also relates to comprise the carrier of polynucleotide of the present invention, and with carrier of the present invention or directly with the host cell of arginase of Japanese blood fluke encoding sequence through the genetically engineered generation, and the method that produces polypeptide of the present invention through recombinant technology.

Among the present invention, the polynucleotide sequence of coding arginase of Japanese blood fluke can be inserted in the carrier, contains the recombinant vectors of polynucleotide of the present invention with formation.Term " carrier " refers to that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carrier.The carrier of Shi Yonging includes but not limited in the present invention: the expression vector based on the T7 promotor of expressing in bacterium; The pMSXND expression vector of in mammalian cell, expressing and at the carrier that derives from baculovirus of expressed in insect cells.In a word, as long as can duplicate in host and stablize, any plasmid and carrier may be used to make up recombinant expression vector.A key character of expression vector is to contain replication origin, promotor, marker gene and translational control element usually.

Method well-known to those having ordinary skill in the art can be used to make up the dna sequence dna that contains the arginase of Japanese blood fluke of encoding and the expression vector of suitable transcribing/translational control element.These methods comprise extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technology of body etc.Described dna sequence dna can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; The P of lambda particles phage _LPromotor; Eukaryotic promoter comprises LTRs and some other known may command gene expression promoter in prokaryotic cell prokaryocyte or eukaryotic cell or its virus of CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retrovirus.Expression vector also comprises ribosome bind site that translation initiation is used and transcription terminator etc.Inserting enhancer sequence in carrier will make its transcribing in higher eucaryotic cells be enhanced.Enhanser is the cis acting factor that DNA expresses, and nearly 10 to 300 base pairs act on promotor transcribing with enhancing gene usually.Can for example be included in the SV40 enhanser of 100 to 270 base pairs of replication origin side in late period one, at the polyoma enhanser of replication origin side in late period one and adenovirus enhanser etc.

In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance etc.

Persons skilled in the art all know how to select appropriate carriers/transcriptional regulatory element (as promotor, enhanser etc.) and selected marker.

Among the present invention, the polynucleotide of coding arginase of Japanese blood fluke or the recombinant vectors that contains these polynucleotide can transform or transduce into host cell, contain the genetically engineered host cell of these polynucleotide or recombinant vectors with formation.Term " host cell " refers to prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, streptomyces; Bacterial cell such as Salmonella typhimurium; Fungal cell such as yeast; Vegetable cell; Insect cell such as fruit bat S2 or Sf9; Zooblast such as CHO, COS or Bowes melanoma cells etc.

Can carry out with routine techniques well known to those skilled in the art with dna sequence dna of the present invention or the recombinant vectors transformed host cell that contains described dna sequence dna.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results ₂Method is handled, and used step is well-known in this area.Alternative is to use MgCl ₂If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, perhaps conventional mechanical method such as microinjection, electroporation, liposome packing etc.

By the recombinant DNA technology of routine, utilize polynucleotide sequence of the present invention to can be used to express or produce the arginase of Japanese blood fluke of reorganization.In general following steps are arranged:

(1). with the polynucleotide (or varient) of coding arginase of Japanese blood fluke of the present invention, or transform or the transduction proper host cell with the recombinant expression vector that contains these polynucleotide;

(2). in suitable medium, cultivate host cell;

(3). separation, protein purification from substratum or cell.

In step (2), according to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.

In step (3), recombinant polypeptide can wrap and be expressed or be secreted into the extracellular in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.These methods include, but are not limited to: conventional renaturation is handled, protein precipitant is handled (salt analysis method), centrifugal, the broken bacterium of infiltration, the combination of ultrasonication, super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.

In a third aspect of the present invention, the invention provides and use polypeptide, and fragment, derivative as antigen to produce the method for antibody.These antibody can be polyclonal antibody or monoclonal antibody.The present invention also provides the antibody at the arginase of Japanese blood fluke antigenic determinant.These antibody include, but is not limited to: the fragment that polyclonal antibody, monoclonal antibody, chimeric antibody, single-chain antibody, Fab fragment and Fab expression library produce.

The method of the available arginase of Japanese blood fluke direct injection of the production of polyclonal antibody immune animal (as rabbit, mouse, rat etc.) obtains, and multiple adjuvant can be used for the enhancing immunity reaction, includes but not limited to freund's adjuvant etc.The technology of the monoclonal antibody of preparation arginase of Japanese blood fluke includes but not limited to hybridoma technology, three knurl technology, people B-quadroma technology, EBV-hybridoma technology etc.Can be with existing technology production with the variable region bonded chimeric antibody in human constant region and inhuman source.And the technology of existing manufacture order chain antibody also can be used for producing the single-chain antibody of anti schistosoma arginase.

The antibody of anti schistosoma arginase can be used in the immunohistochemistry technology, and distribution and the secretion of arginase of Japanese blood fluke in polypide that detects in the biopsy specimen drained.

With the also available labelled with radioisotope of arginase of Japanese blood fluke bonded monoclonal antibody, inject in the body and can follow the tracks of its position and distribution.Antibody among the present invention can be used for preventing or blocking the pathological change that arginase of Japanese blood fluke causes.

In a fourth aspect of the present invention, suppress the oligonucleotide (comprising sense-rna, antisense DNA, RNA interfering) of arginase of Japanese blood fluke mRNA and ribozyme also within the scope of the invention.Ribozyme is the enzyme sample RNA molecule that a kind of energy specificity is decomposed specific RNA, and its mechanism of action is to carry out the endonuclease effect after ribozyme molecule and the hybridization of complementary target RNA-specific.The RNA of antisense and DNA and ribozyme can obtain with existing any RNA or DNA synthetic technology, as the technology widespread use of solid phase phosphoamide chemical synthesis synthetic oligonucleotide.Antisense rna molecule can be transcribed acquisition by the dna sequence dna of this RNA that encodes in external or body.This dna sequence dna has been incorporated into the downstream of rna polymerase promoter of carrier.In order to increase the stability of nucleic acid molecule, available several different methods is modified it, and as increasing the sequence length of both sides, the connection between the ribonucleoside is used phosphoric acid thioester bond or peptide bond but not phosphodiester bond.RNA interfering (iRNA) thus be a class in vivo degrade specifically target gene mRNA make a bit of double stranded rna molecule of this gene silencing, its sequence generally is one section later complementary sequence of mRNA5 ' downstream 70bp.By this section sequence and reverse sequence thereof being cloned in the same carrier for expression of eukaryon simultaneously transfection Japan's Tubifex body or histocyte, the RNA formation dsRNA that this plasmid transcribes out, the iRNA of energy degrade specifically target gene.The mRNA silent technology can be used for treating because the nothing of Schistosoma japonicum Triptide sulfurtransferase is expressed or cell proliferation, growth or the metabolic disturbance of unusual/non-activity due to expressing, thereby confirms gene (proteinic physiological function).

In a fifth aspect of the present invention, the inhibitor of polypeptide of the present invention and this polypeptide can be directly used in the diagnosis and the treatment of schistosomicide.

Specifically with regard to new arginase of Japanese blood fluke of the present invention, this albumen is the important enzyme of Schistosoma japonicum protein metabolism, can generate urea and ornithine by the hydrolysis arginine, participate in ornithine cycle, in the nitrogen of draining body internal protein metabolism generation and the intravital pH value of balance, play an important role; Also participate in the metabolism of polyamines and the generation of L-glutamic acid, proline(Pro) and γ-An Jidingsuan (GABA); And can promote that jointly arginine changes Methionin into ornithine carbamyl transferase; Synthetic relevant with NO; And can secrete and be excreted to externally, can enter host's body, bring out immunne response, can be used as a potential target antigen, be used for the immunodiagnosis of schistosomiasis japanica.

The present invention also provides SCREENED COMPOUND to check the method for the active medicament of arginase of Japanese blood fluke with evaluation, arginase is ubiquitous in Schistosoma japonicum, at the early stage of protein metabolism with all play a role late period, its inhibitor can effectively disturb the Schistosoma japonicum protein metabolism, cause its metabolism disorder and death, therefore, it can be used as an important drug targets.The antagonist of arginase of Japanese blood fluke comprises antibody, compound, acceptor disappearance thing and the analogue etc. that filter out.The antagonist of arginase of Japanese blood fluke can combine and eliminate its function with arginase of Japanese blood fluke, or suppressing arginase produces, or combines with the avtive spot of arginase and to make this polypeptide can not bring into play biological function.

In screening during as the compound of inhibitor, arginase of Japanese blood fluke can be added during bioanalysis measures, by measuring compound interactional influence between arginase of Japanese blood fluke and its substrate is determined whether compound is inhibitor.Can be incorporated into the rondom polypeptide storehouse that solid formation forms by the various amino acid that may make up by screening with arginase of Japanese blood fluke bonded peptide molecule obtains.During screening, generally tackle the arginase of Japanese blood fluke molecule and carry out mark.

The invention still further relates to the diagnostic testing process of quantitative and detection and localization arginase of Japanese blood fluke level.These tests are known in the art, comprise the mensuration and the immunologic assay of specific enzyme activity.The arginase of Japanese blood fluke level that is detected in the test can be used as an index of schistosomiasis japanica gradient of infection (worm negative).

Polypeptide of the present invention also can be used as the peptide spectrum analysis, for example, the polypeptide available physical, chemistry or enzyme carry out the specificity cutting, and carries out the two-dimentional or three-dimensional gel electrophoresis analysis of one dimension, be more preferably and carry out mass spectroscopy.

The polynucleotide of coding arginase of Japanese blood fluke also can be used for multiple therapeutic purpose.The gene therapy vector of reorganization can be designed for the arginase of Japanese blood fluke of expressing variation, to suppress endogenic arginase of Japanese blood fluke activity.For example, a kind of arginase of Japanese blood fluke of variation can be the arginase of Japanese blood fluke that shortens, lacked catalytic center, though can combine with the substrate in downstream, lacks the arginase activity.Perhaps according to one section little antisense nucleic acid of polynucleotide sequence design of this gene, the translation process after disturbing this gene transcription process and transcribing can play the effect of Schistosoma japonicum protein metabolism and other physiological function equally.The active plasmid of this inhibition endogenous recombinant arginase can enter in the liver and gall road with suitable formulation and mode, is eaten by Schistosoma japonicum, enters in its synplasm and works.

The polynucleotide of coding arginase of Japanese blood fluke can be used for the diagnosis of schistosomiasis japanica.The polynucleotide of coding arginase of Japanese blood fluke can be used for detecting the existence of Schistosoma japonicum and the expression level of arginase.As designing primer according to this polynucleotide sequence, from the worm's ovum of stool sample, extract the nucleic acid-templated gene amplification of carrying out with polymerase chain reaction (PCR), whether meet the infection that preset value is determined Schistosoma japonicum according to the size of polynucleotide passage of amplification.This technology height sensitivity is special, can overcome incidental omission of conventional morphologic detection method and flase drop.The method of gene test not only can detect the infection that whether has Schistosoma japonicum, and can also carry out somatotype to Schistosoma japonicum, determines its subspecies or strain.The dna sequence dna of coding arginase of Japanese blood fluke also can be used for biopsy specimen is hybridized to judge the expression situation of arginase of Japanese blood fluke.Hybridization technique comprises the Southern blotting, Northern blotting, in situ hybridization etc.These technological methods all are disclosed mature technologies, and relevant test kit all can obtain from commercial channels.Part or all of polynucleotide of the present invention can be used as probe stationary on microarray (Microarray) or DNA chip (being called " gene chip " again), is used for analyzing the differential expression analysis and the gene diagnosis of tissue gene.Carry out the transcription product that RNA-polymerase chain reaction (RT-PCR) amplification in vitro also can detect arginase of Japanese blood fluke with the special primer of arginase of Japanese blood fluke.

Sequence of the present invention identifies it also is valuable to karyomit(e).This sequence can be specifically at certain bar Japan stain with blood the colour solid particular location and and can with its hybridization.At present, need to identify the concrete site of each gene on the karyomit(e).Now, have only chromosomal marker thing seldom to can be used for the marker chromosomes position based on actual sequence data (repetition polymorphism).According to the present invention, for these sequences are associated with disease related gene, its important the first step is positioned these dna sequence dnas on the karyomit(e) exactly.

In brief, prepare PCR primer (preferred 15-35bp), sequence can be positioned on the karyomit(e) according to cDNA.Then, these primers are used for the PCR screening and contain the somatocyte hybrid cell that each bar Japan stains colour solid with blood.Have only those hybrid cells that contain corresponding to the people's gene of primer can produce the fragment of amplification.

The PCR localization method of somatocyte hybrid cell is that DNA is navigated to concrete chromosomal quick method.Use Oligonucleolide primers of the present invention,, can utilize one group to realize inferior location from specific chromosomal fragment or a large amount of genomic clone by similar approach.Other the similar strategy that can be used for chromosomal localization comprises in situ hybridization, uses the karyomit(e) prescreen and the hybridization preliminary election of the airflow classification of mark, thereby makes up the special cDNA storehouse of karyomit(e).

The cDNA clone is carried out fluorescence in situ hybridization (FISH) with Metaphase Chromosome, can in a step, accurately carry out chromosomal localization.In case sequence is positioned to chromosome position accurately, the physical location of this sequence on karyomit(e) just can be associated with the gene map data.

In a sixth aspect of the present invention, the diagnosis of schistosomiasis japanica is except the Pathogen Biology inspection except routine, and main mode is to use the immunological diagnostic reagent box.Mainly contain two classes: enzyme linked immunological kit (ELISA) and tachysynthesis colloidal gold kit (ICT).The diagnosis of schistosomiasis japanica can be judged existing disease infection by the circulating antigen that detects in serum or the urine, also can come rapid screening by the specific antibody that detects in serum or the saliva.Because Schistosoma japonicum mainly is to colonize in outside the tissue, the antigenic component overwhelming majority that is produced has only the infectiosity height along with bile enters enteron aisle, and polypide is serious to bile duct obstruction, when causing the epithelial duct serious damage, its secretion movement just can enter in liver and the peripheral blood.The circulating antigen major part that enters in the peripheral blood is neutralized by antibody, has only the circulating antigen of small-amount free to be detected.Therefore, can reflect existing disease infection though detect the method for circulating antigen, susceptibility is lower.It is at present, clinical that what be used for auxiliary diagnosis mainly is antibody assay kit.The method that detects antibody is divided into two kinds, and the one, catch to such an extent that antibody combines as detection reagent with the antigen on being coated on Sptting plate or reaction film with mark two is anti-, a kind of is that the antigen of usefulness mark is as detection reagent.Two is anti-as detection reagent, generally can only detect a kind of antibody, and non-specific binding is than higher; Labelled antigen can detect multiple antibody as detection reagent, and specificity is higher.

The present invention can utilize the arginase of Japanese blood fluke of purifying to prepare the ELISA detection kit, also can utilize the arginase of Japanese blood fluke of purifying to prepare the colloidal gold immunochromatographiassay assay reagent box.

In a seventh aspect of the present invention, utilize arginase of the present invention (ARG) gene can carry out the making of vaccine, this vaccine contains arginase of Japanese blood fluke or the carrier for expression of eukaryon of the polynucleotide of this enzyme of encoding.For example, dna vaccination is cloned into eukaryon expression plasmid pEGFP-N1 with the cDNA of ARG gene; The extracting plasmid; Behind eukaryon recombinant plasmid dna immunization mouse, get the abdominal cavity cell smear, fluorescent microscope is observed fluorescence down, and to detect the expression of recombinant antigen, if detect fluorescence, this recombinant plasmid can reach target protein at body surface, promptly can be used for dna vaccination.Protein vaccine is cloned into prokaryotic expression plasmid pET30a (+) with the cDNA of ARG gene, behind the protokaryon abduction delivering, with Ni-TED affinity chromatography column purification, obtain (His) 6 fusion roteins of purifying, the Bradford method detects proteinic concentration, promptly can be used as protein vaccine.Polypeptide vaccine, ARG is important metabolic enzyme, it is conservative relatively between each species, information biology is found, have an epi-position to be positioned at zymophore, if stimulate antibody that body produces just can with this position combination, may influence enzymic activity and produce fatal side effect, therefore, the development of peptide vaccine becomes necessary.

Description of drawings

Fig. 1 is the polyacrylamide gel electrophoresis figure (SDS-PAGE) of isolating arginase of Japanese blood fluke, and 45kDa is proteinic molecular weight, and the arrow indication is isolated protein band.

Fig. 2 is the colloidal gold immunochromatographimethod mode chart

Label

1 testing wire, 2 nature controlling lines, 3 glass fiber sheets

Embodiment

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.

Embodiment 1: the clone of arginase of Japanese blood fluke

Pass through bioinformatics technique, the nucleotide sequence (the NCBI accession number is AF402615) of the coding arginase that author's discovery has been landed is not that complete coding is read frame, the initial ATG arginase aminoacid sequence intermediary methionine residue of only encoding, 5 ' end lacks one section sequence.2 nested primers of arginase 5 ' terminal sequence design according to having landed are P1:5 ' TACCAACTGTTCTACACGGTCAGC 3 ' and P2:5 ' ATCACCATGAGCATCAACCCATAT 3 '.

Utilization " SMART " cDNA library construction test kit makes up the total length library.General upstream, library 5 ' end primer is S1:5 ' CTCCGAGATCTGGACGAGC 3 ', and it is S3:5 ' CTCGGGAAGCGCGCCATTGTGTTGGT 3 ' that the sequencing fragment primer is inserted in the library.

After getting library liquid and being diluted to 1: 100, with phage host bacterium XLl-Blue preadsorption after 15 minutes, join in the agar of top, be taped against then on the flat board that contains LB and 10mMMgSO4, after 6-18 hour (seeing plaque merges mutually), adding SM liquid wash-out spends the night, drew elutriant 4000g centrifugal 5 minutes, draw supernatant and add 20%PEG8000, deposit D NA is after half an hour, centrifugal 15 minutes of 12000g with the dissolving of Mini Q water boil, promptly can be used as 5 ' single nest-type PRC amplification arginase 5 ' segmental template that end lacks behind the survey double-stranded DNA content.Earlier carrying out pcr amplification with primer S1 and P2, is that template is carried out pcr amplification with primer S1 and primer P1 with this PCR product then.PCR reaction system (25 μ l total reaction): 10 * buffer (containing Mg2+), 2.5 μ l, 10mM dNTP0.5 μ l, each 0.5 μ l of primer P2 (P1) and primer S1, library DNA template 10.0 μ l (1: 10 dilution back of PCR product 1ul for the first time), Taq enzyme 0.25 μ l, moisturizing to 25.0 μ l.Adopt StepdownPCR, reaction parameter is: 96 ℃ of pre-sex change 3min, and 94 ℃ of sex change 1min, 72 ℃ of annealing temperature 1min, 72 ℃ are extended 2min10 circulation, and later annealing temperature is respectively 67 degree, 62 degree, 57 degree each 10 circulations, totally 40 circulations.Sequencing: the PCR product is identified the molecular weight size through agarose gel electrophoresis, and the purpose fragment is reclaimed, and the recovery product is served Hai Shenyou company and utilized S3 to carry out sequencing as sequencing primer.5 ' single nest-type PRC obtains the band of an about 500bp, reclaims this band order-checking, obtains the sequence of a 490bp, and useful length is 410bp.This sequence and former arginase gene have 218 bases overlapping, show it is desired purpose fragment, after connecting, both obtain total sequence (shown in SEQ ID NO:1) of a 1273bp, wherein, the 0RF of this sequence maximum contains 1095bp from 12bp to 1106bp, 364 amino acid (shown in SEQ ID NO:2) of encoding.We are with the protein called after arginase of Japanese blood fluke of this clones coding.

Embodiment 2:cDNA clone's homology retrieval

With the sequence and the encoded protein sequence thereof of arginase of Japanese blood fluke of the present invention, with Blast program (BasiclocalAlignment search tool) [Altschul, SF et al.J.Mol.Biol.1990; 215:403-10], carry out the homology retrieval at databases such as Genbank, Swissport.The gene the highest with peptides homologous of the present invention is the II type arginase of a kind of known mouse, number is NP_033835 in the access of Genbank.Blastx result shows that both homogenies are 44%, and the score value is 265.

Embodiment 3: with the gene of RT-PCR method clones coding arginase of Japanese blood fluke

Press Trizol Reagent specification sheets and extract the total RNA of Schistosoma japonicum adult, use following primer, carry out RT-PCR (single stage method) by Promega AccessRT-PCR specification sheets:

Primer1：5’-GACAAGCAAAAATGTTGAAATCCG-3’ (SEQ?ID?NO：3)

Primer2：5’-TTTTTTTTTTCAAATATAATAATA-3’ (SEQ?ID?NO：4)

Primer1 is the forward sequence that begins of 1bp that is positioned at the 5 ' end of SEQ ID NO:1;

Primer2 be SEQ ID NO:1 in 3 ' end reverse sequence.

The condition of amplified reaction: in the reaction volume of 50 μ l, contain 50mmol/L KCl, 10mmol/LTris-Cl, (pH8.5), 1.5mmol/L MgCl ₂, 200 μ mol/L dNTP, 10pmol primer, the Taq archaeal dna polymerase of 1U (Clontech company product).Go up by 25 cycles of following conditioned response at PE9600 type DNA thermal cycler (Perkin-Elmer company): 94 ℃ of 30sec; 55 ℃ of 30sec; 72 ℃ of 2min.When RT-PCR, establish the blank negative contrast of positive contrast of β-actin and template simultaneously.Amplified production is connected to (Invitrogen company product) on the pCR carrier with the test kit purifying of QIAGEN company with TA clone test kit.The dna sequence analysis result shows that the dna sequence dna of PCR product and the 1-1273bp shown in the SEQ ID NO:1 are identical.

Embodiment 4:Northern blotting is analyzed the arginase of Japanese blood fluke expression of gene:

Extract total RNA[Anal.Biochem 1987,162,156-159 with single stage method].This method comprises acid guanidine thiocyanate phenol-chloroform extracting.Promptly use 4M guanidinium isothiocyanate-25mM Trisodium Citrate, 0.2M sodium acetate (pH4.0) carries out homogenate to tissue, adds the phenol of 1 times of volume and the chloroform-primary isoamyl alcohol (49: 1) of 1/5 volume, and is centrifugal after mixing.The sucking-off aqueous phase layer adds Virahol (0.8 volume) and with the centrifugal RNA precipitation that obtains of mixture.With RNA precipitation 70% washing with alcohol that obtains, dry and soluble in water.With 20 μ g RNA, on 1.2% sepharose that contains 20mM 3-(N-morpholino) propanesulfonic acid (pH7.0)-5mM sodium acetate-1mM EDTA-2.2M formaldehyde, carry out electrophoresis.Be transferred on the nitrocellulose filter then.With α- ³²P dATP prepares by random priming ³²The dna probe of P-mark.Used dna probe is the arginase of Japanese blood fluke coding region sequence (12bp to 1175bp) of pcr amplification shown in Figure 1.Probe (about 2 * 10 with the 32P-mark ⁶Cpm/ml) spend the night in 42 ℃ of hybridization in a solution with the nitrocellulose filter that has shifted RNA, this solution comprises 50% methane amide-25mM KH ₂PO ₄(pH7.4)-5 * SSC-5 * Denhardt ' s solution and 200 μ g/ml salmon sperm DNAs.After the hybridization, filter membrane is washed 30min in 55 ℃ in 1 * SSC-0.1%SDS.Then, analyze with quantitative with Phosphor Imager.

Embodiment 5: vivoexpression, separation and the purifying of recombination Japanese schistosomicide arginase

According to SEQ ID NO:1 and coding region sequence shown in Figure 1, design a pair of specificity amplification primer, sequence is as follows:

Primer3：5’-CC GAATTCAAAATGTTGAAATCCGTTGCAA-3’ (Seq?ID?No：5)

Primer4：5’-AG GTCGACTCACTTTATCTGTATACGTT-3’ (Seq?ID?No：6)

5 ' end of these two sections primers contains EcoRI and Sal I restriction enzyme site respectively, be respectively the encoding sequence of target gene 5 ' end and 3 ' end thereafter, NdeI and BamHI restriction enzyme site are corresponding to expression vector plasmid pET-30a (+) (Novagen company product, Cat.No.69865.3) the selectivity restriction enzyme site on.With the Sj cercaria cDNA library of containing the total length goal gene is template, carries out the PCR reaction.The PCR reaction conditions is: contain library DNA 20pg, primer Primer-5 and Primer-6 among the cumulative volume 50 μ l and be respectively 10pmol, Advantage polymerase Mix (Clontech company product) 1 μ l.Loop parameter: 94 ℃ of 20s, 60 ℃ of 30s, 68 ℃ of 2min, totally 25 circulations.Respectively amplified production and plasmid pET-30a (+) are carried out double digestion with EcoRI and Sal I, reclaim big fragment respectively, and connect with the T4 ligase enzyme.Connect product and transform, after the dull and stereotyped overnight incubation of the LB that contains kantlex (final concentration 50 μ g/ml), use the colony polymerase chain reaction (PCR) method screening positive clone, and check order with the big enterobacterial BL21 of Calcium Chloride Method (DE3) plySs (Novagen company product).Select the correct positive colony of sequence, in the LB liquid nutrient medium that contains kantlex (final concentration 30 μ g/ml), host bacterium BL21 (pET-ARG) is cultured to logarithmic phase at 37 ℃, adds IPTG to final concentration 0.5mmol/L, and 28 ℃ are continued to cultivate 12 hours.Centrifugal collection thalline, through the broken bacterium of ultrasonic wave, centrifugal collection supernatant with carrying out chromatography with 6 Histidines (6His-Tag) bonded affinity column His.Bind Quick Cartridge (Novagen company product), has obtained the target protein arginase of Japanese blood fluke of purifying.Through the SDS-PAGE electrophoresis, obtain a single band (Fig. 1) at the 46kDa place.This band is transferred on the pvdf membrane carries out the n terminal amino acid sequential analysis with the Edams hydrolysis method, 15 amino acid of N-end hold 15 amino-acid residues identical with the N-shown in the SEQ ID NO:2 as a result.

The physicochemical property of embodiment 6 arginase of Japanese blood fluke

With the arginase of Japanese blood fluke of affinitive layer purification, after Throbinenterokinase enzyme excision carrier sequence,, record its molecular weight and be about 46kDa through SDS-PAGE electrophoresis and standard molecule discharge curve; This albumen contains 54 of acidic amino acid residues, and 39 of alkaline amino acid residues utilize Amerham isoelectric focusing electrophoresis instrument, and through the isoelectric focusing electrophoresis of pH3-10 and pH4-7 gradient fixing glue, recording its iso-electric point is 5.14.Protein molecular is spherical in aqueous environment, soluble in water, and its transformation period is 30 hours in the Mammals plastosome, greater than 20 hours, surpasses 10 hours in intestinal bacteria, proteinic Stability Analysis of Structures in yeast cell.

Embodiment 7 anti schistosoma arginase production of antibodies

With adding the complete Freund's adjuvant immunizing rabbit, add the incomplete Freund's adjuvant booster immunization once with this albumen again after 15 days through the 4mg of affinitive layer purification arginase of Japanese blood fluke.Employing is done the titre that ELISA measures antibody in the rabbit anteserum through the titer plate of 15 μ g/ml arginase of Japanese blood fluke bag quilts.From the rabbit anteserum of antibody positive, separate total IgG with albumin A-Sepharose.Polypeptide is incorporated on the Sepharose4B post of cyanogen bromide-activated, from total IgG, separates anti-peptide antibody with affinity chromatography.Immuno-precipitation proof antibody purified can combine with arginase of Japanese blood fluke specifically.This antibody is polyclonal antibody, tires more than 1: 32 with recombinant antigen two the expansion in the test of agar immunity, tires more than 1: 16 with the reaction of polypide crude antigen.This antibody can detect the Schistosoma japonicum patient's of severe infection arginase circulating antigen.

Embodiment 8: polynucleotide passage of the present invention is as the application of hybridization probe

Picking out suitable oligonucleotide fragment from polynucleotide of the present invention is of use in many ways as hybridization probe, as can whether containing polynucleotide sequence of the present invention and detect the homologous polynucleotide sequence to identify it with the healthy tissues of different sources or the genome or the hybridization of cDNA library of pathological tissue with this probe, whether further also available this probe in detecting polynucleotide sequence of the present invention or the expression of its homologous polynucleotide sequence in healthy tissues or pathological tissue cell be unusual.Select oligonucleotide fragment as hybridization probe from polynucleotide SEQ ID NO:1 of the present invention, the several aspects that should follow following principle and need to consider: the probe size preferable range is a 18-50 Nucleotide; GC content is 30%-70%, and surpassing then, non-specific hybridization increases; Probe interior should not have complementary region; What meet above condition can be used as the primary election probe, further do the computer sequential analysis then, comprise this primary election probe is carried out homology relatively with its source sequence area (being SEQ ID NO:1) and other known genome sequence and complementary district thereof respectively, if with the homology in non-target molecule zone greater than 85% or there are 15 continuous bases of surpassing identical, then this primary election probe is general just should not use; In addition, again according to the probe fragment that designed or its complementary segmental replacement mutant nucleotide sequence as second probe.

Probe 1 (probe1) belongs to first kind probe, and complete homology of gene fragment or the complementation (40Nt) of SEQ ID NO:1:

5’-ggaatggaagccgtcattaaagaagcattacaagctgtga-3’ (Seq?ID?No：7)

Probe 2 (probe2) belongs to the second class probe, is equivalent to gene fragment or its complementary segmental replacement mutant nucleotide sequence (40Nt) of SEQ ID NO:1:

5’-ggaatggaagccgtcattaacgaagcattacaagctgtga-3’ (Seq?ID?No：8)

Nucleic acid probe adopts the filter hybridization method usually, comprises dot blotting, Southern blotting, Northern blotting and copy method etc., and they all are that polynucleotide sample to be measured is fixed on use essentially identical step crossover in back on the filter membrane.

Other unlisted common agents and the compound method thereof relevant with following concrete experimental procedure please refer to document: DNAPROBES G.H.Keller; M.M.Manak; Stockton Press, 1989 (USA) and molecular cloning laboratory manual books more commonly used are as works such as " molecular cloning experiment guide " (second edition in 1998) [U.S.] Sa nurse Brooker, Science Press.

Step: 1) fresh or fresh Schistosoma japonicum of thawing is used cooled homogenate damping fluid (0.25mol/L sucrose; 25mmol/L Tris-HCl, pH7.5; 25mmol/LnaCl; 25mmol/L MgCl ₂) precipitation that suspends (approximately 10ml/g), 4 ℃ with electric homogenizer homogenate tissue suspension at full speed, until tissue by broken fully.DNA with in the phenol extraction process tissue uses ethanol sedimentation then.In the time of must removing RNA and pollute, RNA enzyme A can be added in the dna solution, final concentration is 100ug/ml, 37 ℃ of insulations digestion in 30 minutes RNA, and then extracting DNA again.The preparation of sample film:

2) get 4 * 2 suitably nitrocellulose filters (NC film) of size, mark point sample position and sample number thereon gently with pencil, each probe needs two NC films, so that wash film with high strength condition and strength condition respectively in the experimental procedure of back.Draw and each 15 microlitre of contrast, put on the sample film, dry at room temperature.Placing to soak into has 0.1mol/LNaOH, and last 5 minute of filter paper (twice) of 1.5mol/LNaCl, drying to place to soak into has 0.5mol/L Tris-HCl (pH7.0), last 5 minute of filter paper (twice) of 3mol/LNaCl, dries.Be sandwiched in the clean filter paper, wrap, 60-80 ℃ of vacuum-drying 2 hours with aluminium foil.

3) probe phosphokinase mark ³²Cross Sephadex G-50 post behind the P, monitor isotopic weight, merge and be required preparation behind the collection liquid of first peak with liquid glimmer instrument ³²P-Probe (second peak for free γ- ³²P-dATP).

4) prehybridization: the sample film is placed plastics bag, adding 3-10mg prehybridization solution (10 * Denhardt ' s; 6 * SSC, 0.1mg/ml CT DNA (calf thymus DNA).), seal sack after, 68 ℃ of water-baths were shaken 2 hours.

5) hybridization: plastics bag is cut off one jiao, adds the probe prepare, seal sack after, 42 ℃ of water-baths are shaken and are spent the night.

6) wash film:

High strength is washed film:

Take out and hybridized good sample film; 2 * SSC among the 0.1%SDS, washes 15 minutes (2 times) for 40 ℃; 0.1 * SSC among the 0.1%SDS, washes 15 minutes (2 times) for 40 ℃; 0.1 * SSC among the 0.1%SDS, washes 30 minutes (2 times) for 55 ℃, room temperature is dried.

Low strength is washed film:

Take out and hybridized good sample film; 2 * SSC among the 0.1%SDS, washes 15 minutes (2 times) for 37 ℃; 0.1 * SSC among the 0.1%SDS, washes 15 minutes (2 times) for 37 ℃; 0.1 * SSC among the 0.1%SDS, washes 15 minutes (2 times) for 40 ℃, room temperature is dried.

7) X-light autography:

-70 ℃, X-light autography (the compressing tablet time decides according to hybridization spot radioactivity is strong and weak).

Experimental result:

Adopt low strength to wash the hybrid experiment that the film condition is carried out, more than four strong and weak not obviously differences of probe hybridization spot radioactivity; And adopting low strength to wash the hybrid experiment that the film condition is carried out, the hybridization spot radioactive intensity of probe 1 obviously is better than the radioactive intensity of other three probe hybridization spots.Thereby available probe 1 is qualitative and analyze existence and the differential expression of polynucleotide of the present invention in different tissues quantitatively.

Embodiment 9: the preparation diagnostic kit

The diagnosis of schistosomiasis japanica is except the Pathogen Biology inspection except routine, and main mode is to use the immunological diagnostic reagent box.Mainly contain two classes: enzyme linked immunological kit (ELISA) and tachysynthesis colloidal gold kit (ICT).The diagnosis of schistosomiasis japanica can be judged existing disease infection by the circulating antigen that detects in serum or the urine, also can come rapid screening by the specific antibody that detects in serum or the saliva.Because Schistosoma japonicum colonizes in the blood of human body, the secretion of its generation is drained antigen and is easy to stimulate body to produce a large amount of antibody, and antigen is closed, and therefore, can reflect that now disease is infected though detect the method for circulating antigen, and susceptibility is lower.It is at present, clinical that what be used for auxiliary diagnosis mainly is antibody assay kit.The method that detects antibody is divided into two kinds, and the one, catch to such an extent that antibody combines as detection reagent with the antigen on being coated on Sptting plate or reaction film with mark two is anti-, a kind of is that the antigen of usefulness mark is as detection reagent.Two is anti-as detection reagent, generally can only detect a kind of antibody, and non-specific binding is than higher; Labelled antigen can detect multiple antibody as detection reagent, and specificity is higher.

The preparation of ELISA detection kit: the arginase of Japanese blood fluke of purifying is cushioned liquid with the carbonate bag, and ((pH9.6) is made into 0.1mg/ml, every hole as the 96 hole enzyme marks adds 50ul, 4 ℃ are spent the night, after outwelling coating buffer, with the unnecessary protein binding site of PBS-Tween20 solution 100ul sealing hole wall that contains 10% skim-milk, after spending the night, 4 ℃ of sealings outwell confining liquid.Add test serum 50ul in the enzyme plate reacting hole, jog is after 5 minutes, leaves standstill in 37 ℃ of wet boxes 30～60 minutes, shakes repeatedly with the PBS-Tween20 washings and washs each 3 minutes 3 times; Add the goat anti-human igg (1: 1000 diluent 50ul) of horseradish peroxidase or alkali phosphatase enzyme mark again, repeat above-mentioned combination and washing process, add substrate and chromogenic reagent then, when the appearance colour developing is obvious, add 2% sulphuric acid soln termination reaction.Visual inspection or with microplate reader assaying reaction result.

The preparation of colloidal gold immunochromatographiassay assay reagent box: there are three kinds of the bar of soaking formula (dipstick), card form and boxlikes in common immunochromatography system.Boxlike immunochromatography system has identical ultimate principle and structure shown in Figure 2: by chromatographic system (chromatographic film links to each other with one or two absorption layer) solid-phase immunity reactive system (antigen or antibody are wire and are coated on the chromatographic film certain location as testing wire or nature controlling line), sample and colloid gold label reagent add from an end, under the capillary action of film, move to the other end along the film surface, and be absorbed by the absorption layer.Immune association reaction takes place with the capture agent that is combined on the film in composition to be measured in the sample and gold-immunochromatographyreagent reagent for assay in the chromatography process, and rests on bag by on the line (comprising testing wire 1 and nature controlling line 2), demonstrates the response line of a redness.In sample, do not contain composition to be measured, then do not develop the color at testing wire 1 place, then apparent red as the nature controlling line 2 of positive control.Soaking bar formula detection kit successively adds the test strip lower end in the colloidal gold solution of analyte sample fluid and mark; In card form and the boxlike detection kit, the Radioactive colloidal gold of mark is with on the exsiccant solid form preservation glass fiber sheets 3 at one end, card form only needs solution to be measured and damping fluid directly are added drop-wise on the glass fiber sheets, the card that closes, viewing window judged result that can capping behind the several minutes; Boxlike is packed detector bar in the small plastic box, puts the corresponding circular well of an end of Radioactive colloidal gold, and sample and damping fluid add from well, behind the several minutes from rectangular viewing window judged result.

In this detection kit, chromatographic film is the cellulose mixture film of aperture 8 μ m, the arginase of Japanese blood fluke of purifying is coated on the far-end of absorption layer as detection line, Schistosoma japonicum patient's positive serum is coated on the near-end of absorption layer as nature controlling line, the colloidal gold solution of mark arginase of Japanese blood fluke is added drop-wise to the glass fiber sheets after drying, is placed on the other end of chromatographic film.

The preparation of Radioactive colloidal gold and mark: chlor(o)aurate is made into 0.01% concentration with deionized ultrapure water, after boiling, the citric acid three sodium solution of rapid adding 1%, (every 100ml adds 2ml), not from the rapid jolting mixing of fire, boil solution colour always and become the red recession fire of grape wine, supply original volume with ultrapure water.The about 20nm of median size of the Radioactive colloidal gold of preparation.The colloidal gold solution for preparing is transferred pH6.0 with the solution of potassium carbonate of 0.25mol/L, the arginase that under stirring state, adds purifying by the amount of 15 μ g/mL, reacted 10 minutes, centrifugal 30 minutes of the centrifugal force of 15000g, precipitation suspends again with the PBS (pH6.0) of original volume 1/10.

Embodiment 10: the preparation vaccine

1.DNA vaccine

The cDNA of ARG gene is cloned into eukaryon expression plasmid pEGFP-N1; By a large amount of extracting plasmids of " molecular cloning experiment guide " described alkaline lysis; Behind eukaryon recombinant plasmid dna immunization mouse, get the abdominal cavity cell smear, fluorescent microscope is observed fluorescence down, and to detect the expression of recombinant antigen, if detect fluorescence, this recombinant plasmid can reach target protein at body surface, promptly can be used for dna vaccination.Employing is suitable for the CpG adjuvant of corresponding animal; the amount of eucaryon plasmid 80 μ g+CpG 20 a μ g/ mouse that make up according to goal gene; femoribus internus intramuscular injection, every 2w immunity once are total to immunity 3 times; back 30 days of last immunity; 40/mouse challenge infections of schistosoma japonicum cercariae after 45 days, detect borer population and worm's ovum number; calculate worm reduction rate, egg reduction rate, estimate the protectiveness effect.

2. protein vaccine

The cDNA of ARG gene is cloned into prokaryotic expression plasmid pET30a (+), behind the protokaryon abduction delivering, with Ni-TED affinity chromatography column purification, obtains (His) 6 fusion roteins of purifying, the Bradford method detects proteinic concentration, promptly can be used as protein vaccine.Get 50 μ g/50 μ l target protein+50 μ l freund adjuvant/mouse, after emulsification mixes, neck, back, belly, inguinal region is subcutaneous and mouse insole multi-point injection immune mouse, every 2w immunity once, totally 3 times, the complete freund adjuvant of initial immunity, twice immunity in the back full freund adjuvant that toos many or too much for use; 2w after the last immunity, 40/mouse challenge infections of schistosoma japonicum cercariae after 45 days, detect borer population and worm's ovum number, calculate worm reduction rate, egg reduction rate, estimate the protectiveness effect.

3. polypeptide vaccine

ARG is important metabolic enzyme, it is conservative relatively between each species, information biology is found, there is an epi-position to be positioned at zymophore, if stimulate antibody that body produces just can with this position combination, may influence enzymic activity and produce fatal side effect, therefore, the development of peptide vaccine becomes necessary.Utilize all epitopes of phage display techniques research ARG; the epitope with host's no cross reaction is found out in research; will with the epitope combined immunization mouse of host's no cross reaction after; 40/mouse challenge infections of schistosoma japonicum cercariae; after 45 days; detect borer population and worm's ovum number, calculate worm reduction rate, egg reduction rate, estimate the protectiveness effect.

Sequence table

＜110〉Zhongshan University

＜120〉arginase of Japanese blood fluke, its coding nucleic acid and application thereof

<130>sjARG

<160>8

<170>PatentIn?version?3.1

<210>1

<211>1273

<212>DNA

<213>Schistosoma?japonicum

<400>1

gacaagcaaa?aatgttgaaa?tccgttgcaa?ccccttatta?tcctgttcaa?aatggtgaaa 60

cacctaagct?tttatatcca?catgtcaatt?tcttgggtat?acctgttaac?aaagggcaac 120

caaaacttgg?tacatatcag?ggaccagatt?ttattagaaa?atctaacttc?ttccagcttg 180

tagctgaaga?tggaatccaa?ataaccgact?gtggagatgt?catacctgta?gaactaagtg 240

aatcagagga?tccagaacgt?tgtggaatga?aatggtcaag?aagtttcaca?cagaccactt 300

tgaaaatagc?tgaccgtgta?gaacagttgg?taaaagggtc?aaataaacat?agtattgaat 360

ccagtaattc?gaaaccatca?ccattagtaa?ttgttggcgg?tgatcatagt?atggcgactg 420

gaactatact?tggacatgct?agagccaaac?cagatgtgtg?cattatatgg?gttgatgctc 480

atggtgatat?aaatacacca?ccaaactcaa?ctactggaaa?tatacatgga?atgccattaa 540

gttttctagt?aaaagaacta?caagatcaaa?ttccatggtt?ggatgacttt?catagtataa 600

aaccatgtct?ggatgccagc?aatcttgttt?acattggttt?acgggattta?gacgtttatg 660

aaacacggga?tataagaaag?catggtatag?cttattttac?aatgcttgac?gttgatcgaa 720

tgggaatgga?agccgtcatt?aaagaagcat?tacaagctgt?gaatccgaga?ttagagaaac 780

ctattcattt?aagttttgat?attgatgcat?tggatccttc?aattgctcca?agtactggta 840

ctgctgttcc?aggtggttta?acattacgtg?aaggtttaag?aatatgtgaa?gaaatttcag 900

ctacaggaaa?actttctatt?gttgaattgg?ctgaattaaa?tcctttgtta?ggatctaaag 960

aagatgttga?aaaaacgcaa?tcatctgctg?tgcacatttt?aagggcatcg?ttaggacatt 1020

gtcgttcagg?tcaattaccg?atgaaagtta?acaattcaac?cactaatagt?attgttagac 1080

aagctgaacg?tatacagata?aagtgataat?tattctttct?tcaatagcaa?ttaattgatt 1140

taattcttat?aataatataa?ttcaatgatc?aatatgatta?attaataatg?ttactaacaa 1200

aataatatgt?aataatacaa?tgattcaagt?atttttctaa?atatactact?attattatat 1260

ttgaaaaaaa?aaa 1273

<210>2

<211>364

<212>PRT

<213>Schistosoma?japonicum

<400>2

Met?Leu?Lys?Ser?Val?Ala?Thr?Pro?Tyr?Tyr?Pro?Val?Gln?Asn?Gly?Glu

1 5 10 15

Thr?Pro?Lys?Leu?Leu?Tyr?Pro?His?Val?Asn?Phe?Leu?Gly?Ile?Pro?Val

20 25 30

Asn?Lys?Gly?Gln?Pro?Lys?Leu?Gly?Thr?Tyr?Gln?Gly?Pro?Asp?Phe?Ile

35 40 45

Arg?Lys?Ser?Asn?Phe?Phe?Gln?Leu?Val?Ala?Glu?Asp?Gly?Ile?Gln?Ile

50 55 60

Thr?Asp?Cys?Gly?Asp?Val?Ile?Pro?Val?Glu?Leu?Ser?Glu?Ser?Glu?Asp

65 70 75 80

Pro?Glu?Arg?Cys?Gly?Met?Lys?Trp?Ser?Arg?Ser?Phe?Thr?Gln?Thr?Thr

85 90 95

Leu?Lys?Ile?Ala?Asp?Arg?Val?Glu?Gln?Leu?Val?Lys?Gly?Ser?Asn?Lys

100 105 110

His?Ser?Ile?Glu?Ser?Ser?Asn?Ser?Lys?Pro?Ser?Pro?Leu?Val?Ile?Val

115 120 125

Gly?Gly?Asp?His?Ser?Met?Ala?Thr?Gly?Thr?Ile?Leu?Gly?His?Ala?Arg

130 135 140

Ala?Lys?Pro?Asp?Val?Cys?Ile?Ile?Trp?Val?Asp?Ala?His?Gly?Asp?Ile

145 150 155 160

Asn?Thr?Pro?Pro?Asn?Ser?Thr?Thr?Gly?Asn?Ile?His?Gly?Met?Pro?Leu

165 170 175

Ser?Phe?Leu?Val?Lys?Glu?Leu?Gln?Asp?Gln?Ile?Pro?Trp?Leu?Asp?Asp

180 185 190

Phe?His?Ser?Ile?Lys?Pro?Cys?Leu?Asp?Ala?Ser?Asn?Leu?Val?Tyr?Ile

195 200 205

Gly?Leu?Arg?Asp?Leu?Asp?Val?Tyr?Glu?Thr?Arg?Asp?Ile?Arg?Lys?His

210 215 220

Gly?Ile?Ala?Tyr?Phe?Thr?Met?Leu?Asp?Val?Asp?Arg?Met?Gly?Met?Glu

225 230 235 240

Ala?Val?Ile?Lys?Glu?Ala?Leu?Gln?Ala?Val?Asn?Pro?Arg?Leu?Glu?Lys

245 250 255

Pro?Ile?His?Leu?Ser?Phe?Asp?Ile?Asp?Ala?Leu?Asp?Pro?Ser?Ile?Ala

260 265 270

Pro?Ser?Thr?Gly?Thr?Ala?Val?Pro?Gly?Gly?Leu?Thr?Leu?Arg?Glu?Gly

275 280 285

Leu?Arg?Ile?Cys?Glu?Glu?Ile?Ser?Ala?Thr?Gly?Lys?Leu?Ser?Ile?Val

290 296 300

Glu?Leu?Ala?Glu?Leu?Asn?Pro?Leu?Leu?Gly?Ser?Lys?Glu?Asp?Val?Glu

305 310 315 320

Lys?Thr?Gln?Ser?Ser?Ala?Val?His?Ile?Leu?Arg?Ala?Ser?Leu?Gly?His

325 330 335

Cys?Arg?Ser?Gly?Gln?Leu?Pro?Met?Lys?Val?Asn?Asn?Ser?Thr?Thr?Asn

340 345 350

Ser?Ile?Val?Arg?Gln?Ala?Glu?Arg?Ile?Gln?Ile?Lys

355 360

<210>3

<211>24

<212>DNA

<213>Schistosoma?japonicum

<400>3

gacaagcaaa?aatgttgaaa?tccg 24

<210>4

<21l>24

<212>DNA

<213>Schistosoma?japonicum

<400>4

tttttttttt?caaatataat?aata 24

<210>5

<211>30

<212>DNA

<213>Schistosoma?japonicum

<400>5

ccgaattcaa?aatgttgaaa?tccgttgcaa 30

<210>6

<211>28

<212>DNA

<213>Schistosoma?japonicum

<400>6

aggtcgactc?actttatctg?tatacgtt 28

<210>7

<211>40

<212>DNA

<213>Schistosoma?japonicum

<400>7

ggaatggaag?ccgtcattaa?agaagcatta?caagctgtga 40

<210>8

<211>40

<212>DNA

<213>Schistosoma?japonicum

<400>8

ggaatggaag?ccgtcattaa?cgaagcatta?caagctgtga 40

Claims

1, a kind of isolated polypeptide-arginase of Japanese blood fluke is characterized in that it includes: the polypeptide of the aminoacid sequence shown in the SEQ ID NO:2 or active fragments, analogue or the derivative of its polypeptide.

2, a kind of isolating polynucleotide, it is characterized in that described polynucleotide comprise be selected from down the group in a kind of:

(a) coding has the polynucleotide of the polypeptide of aminoacid sequence shown in the SEQ ID NO:2 or its fragment, analogue, derivative;

(b) with polynucleotide (a) complementary polynucleotide.

3, polynucleotide as claimed in claim 2, the sequence that it is characterized in that described polynucleotide include the sequence of 1-1273 position among the sequence of 12-1106 position among the SEQ ID NO:1 or the SEQ ID NO:1.

4, a kind of can with polypeptide bonded antibody, it is characterized in that described antibody be can with described arginase of Japanese blood fluke specificity bonded antibody.

5, a class is regulated the polynucleotide of expression of polypeptides, it is characterized in that they are the polynucleotide that suppress the expression of described arginase of Japanese blood fluke, and have the polynucleotide sequence shown in the SEQ ID NO:1 or its segmental antisense sequences or the oligomerization double-stranded RNA consistent with its sequence.

6, the application of polypeptide according to claim 1 is characterized in that it is applied to screen the inhibitor of arginase of Japanese blood fluke; Perhaps be used for the peptide finger print identification.

7, as the application of the described polynucleotide of arbitrary claim among the claim 2-3, it is characterized in that it is used for nucleic acid amplification reaction as primer, perhaps be used for hybridization, perhaps be used to make gene chip or microarray as probe.

8, a kind of test kit that detects Schistosoma japonicum is characterized in that it contains the primer of specific detection arginase of Japanese blood fluke, the described antibody of claim 4, the described polypeptide of claim 1 is arbitrary or its combination.

9, a kind of vaccine that is used to prevent schistosomiasis japanica is characterized in that it contains the described polypeptide of claim 1 or contains claim 2 or the carrier for expression of eukaryon of 3 described polynucleotide.