CN1204252C - Recombinant gene of soluble part in tumor necrosis factor acceptor and its fusion gene and product - Google Patents
Recombinant gene of soluble part in tumor necrosis factor acceptor and its fusion gene and product Download PDFInfo
- Publication number
- CN1204252C CN1204252C CN 01132074 CN01132074A CN1204252C CN 1204252 C CN1204252 C CN 1204252C CN 01132074 CN01132074 CN 01132074 CN 01132074 A CN01132074 A CN 01132074A CN 1204252 C CN1204252 C CN 1204252C
- Authority
- CN
- China
- Prior art keywords
- stnfr
- gene
- joint
- cell
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Lifetime
Links
Abstract
The present invention provides a recombinant sTNFR gene, wherein a codon conforms to the preference of mammalian cells in using codons. The present invention also provides a fusion gene containing the recombinant gene. When the gene or the fusion gene of the present invention is expressed, the expression amount of the gene in CHO cells is enhanced by about 5 times, and the affinity of the obtained fusion protein is enhanced by one order of magnitudes.
Description
Invention field
The present invention relates to the especially recombination of its soluble part of tumor necrosis factor alpha (TNF α) acceptor, and the fusion gene and the product thereof that contain this recombination.
Background of invention
Tumour necrosis factor (TNF) is that the intravital a kind of multifunction immunity of machine is regulated molecule, and it can play a role with the receptors bind on the cytolemma, often causes the death (its title promptly derives from this) of target cell or attracts immune effector cell in partial gathering.Abroad to rheumatoid arthritis (Rheumatoid Arthritis, RA) pathogeny is discovered, tumor necrosis factor alpha (TNF-α) plays a key role in the pathology process of this disease, TNF horizontal abnormality rising (Feldman M in patient or the animal model pathology joint cavity, Brennan FM, Maini RN.The role of cytokines in rheumatoid arthritis.Ann RevImmunol 1996; 14:397; Grom A, Murray KF, Luyrink L etc., Patterns of expression oftumor necrosis factor a, tumor necrosis factor β, and their receptors in synovia ofpatients with juvenile rheumatoid arthritis and juvenile spondyloarthropathy.ArthritisRheum 1996,39:1703; Saxne T, Palladino Jr MA, Heinegard D etc., Detection oftumor necrosis factor alpha but not tumor necrosis factor beta in rheumatoid arthritissynovial fluid and serum.Arthritis Rheum 1988; 31:1041; Klareskog L and McDevitt H:Rheumatoid arthritis and its animal models:the role of TNF-α and the possibleabsence of specific immune reactions.Current Opinion in Immunology, 1999; 11:657-662)).Its content in joint cavity raises in a large number, the receptors bind of one side and synovium of joint cell causes this cell coup injury, and on the other hand, it can convene immune effector cell to assemble so far, secrete more cytokine, produce stronger more persistent autoimmune response.At the RA patient part excessive TNF-alpha expression being arranged, is one of principal element that causes disease sites swelling and pain.
And have in a large number and studies show that TNF still causes the main medium of septic shock syndromes.The TNF-alpha levels raises and is indicating that mortality ratio or disability rate raise among the septic shock syndromes patients serum.The antagonist of passive input TNF-α can prevent that LPS and bacterial shock from setting up jointly and knit damage that using TNF-Alpha antibodies or its acceptor clinically has certain curative effect to rheumatoid arthritis and septic shock syndromes.
To studies show that of TNF acceptor (TNFR), I type, two kinds of Tumor Necrosis Factor Receptors of II type are arranged, be I type transmembrane glycoprotein.It is more extensive wherein to distribute with the II type, stronger with the avidity of tumour necrosis factor.Just can bring into play function from signal to cell that transmit on the cytolemma though two kinds of acceptors need be positioned at, still have part to drop in the body fluid, be called soluble receptors from cell surface.Further studies show that, the acceptor of this solubility can in and TNF, activity to TNF plays down regulation (Smith CA in vivo, Farrah T, Goodwin RG.The TNF receptor superfamily of cellular and viral proteins:activation, costimulation, and death.Cell 1994; 75:959.), but because the interior transformation period of the body of this soluble receptors is very short, promptly allow to this acceptor molecule of synthetic, it also is unpractical being used for treating RA.
External existing people has made up human TNF alpha II receptor soluble part (sTNFR) and the segmental fusion rotein of people's IgG antibody Fc by genetic engineering means, discover that this fusion rotein has neutralizing effect to TNF under isolated condition, therefore the specific medicament that might succeed in developing treatment RA is (referring to Hoogenboom etc., molecular immunology 28 (9): 1027-1037,1991, " construction and expression of Ab-TNF fusion rotein "; United States Patent (USP) 5,605,690).
Goal of the invention
The object of the present invention is to provide a kind of sTNFR gene of reorganization, it can improve the expression in mammalian cell.
The present invention also aims to provide a kind of fusion gene that contains this recombination, and the fusion rotein that obtains thus, this albumen has stronger immune avidity.
The present invention also aims to provide the recombinant vectors that contains recombination of the present invention, but transfection mammalian cell and realize high expression level.
The present invention also aims to provide the mammalian cell that contains recombinant vectors of the present invention.
Technical scheme
In order to realize purpose of the present invention, the invention provides a kind of new reorganization sTNFR gene, codon wherein meet mammalian cell access to your password the son preferences, the sequence of described recombination is SEQ IDNO:1:
gtagctgtgt?gcgcagctct?cgcggtgggt?ctcgacctgt?gcgcagcagc?tcaggcgttc 060
ccagcacacg?tagctttgac?cccataggca?cctgacccag?gtaggacttg?gcgactgagt 120
gattagtacg?agcacacggc?acacatctgt?tggaggaagt?ggtcaccagg?tcagcaggct 180
aaggtgttgt?gcacgaacac?gtctgaaacg?gtctgagagt?cgtgagacga?gaggacgtag 240
acgcacctgt?gcaagtgcgt?accggactgg?ttcagatgcg?gatcgcgttg?cagttcggag 300
cacgtcgaca?cacaggcatg?gacgcgagat?cacaagcgaa?tgtgcacgtg?aaggcctgga 360
tggtactgcg?ccctaaggaa?ccatgacgga?tggcgactct?gggcacctct?ccgaaattgg 420
cgaccaggtt?taggagtcgc?aagtcctggt?acggacacct?ctgaggttgt?ctggaaccca?480
g 481
For the purpose of cloning and expression, the present invention has increased by one section operating sequence CAT in this sequence before this structure gene
GctagcATG.Wherein, preceding 3 protection bases that the capitalization base is represented, underscore partly is the NheI restriction enzyme site, is thereafter the initiator codon ATG that adds.
The present invention also provides the fusion gene that comprises this recombination.Wherein, reorganization sTNFR gene and the segmental fusion of human IgG Fc.
In a kind of preferred implementation of the present invention, reorganization sTNFR gene is by one section joint sequence and the segmental fusion of human IgG Fc, and its amino acid sequence coded is (Ala
3Ser
2)
5(SEQ ID NO:2).One of dna sequence dna of this aminoacid sequence is: 5 '-ACCACAACCT CGTCAACCAC AACCTCGTCA ACCACAACCTCGTCAACCAC AACCTCGTCA ACCACAACCT CGTCA-3 ' (SEQ ID NO:3).
The present invention also aims to provide the recombinant vectors that contains recombination of the present invention, but transfection mammalian cell and realize high expression level.Described carrier can be the mammiferous expression vectors of various suitable transfections well known in the art.
The present invention also aims to provide the mammalian cell that contains recombinant vectors of the present invention.Described mammalian cell can be a Chinese hamster ovary celI for example, Hela cell, mouse Ltk-(4) cell, various Mammals engineering cell strains commonly used such as monkey kidney VERO cell.
The invention effect
The present invention is when making up the fusion gene of human TNF alpha II receptor soluble part (sTNFR) and people Ig antibody Fc fragment, by artificial redesign sTNFR gene and and the Fc fragment between joint sequence, make the avidity of this fusion rotein improve tens of times, and its expression amount in Chinese hamster ovary celI has improved nearly 5 times.
Preferred implementation
Embodiment 1
The preparation of total length reorganization sTNFR gene
Synthesizing of total length reorganization sTNFR gene
The present invention according to mammalian cell access to your password the son preferences, the segmental aminoacid sequence of known sTNFR, designed one section new reorganization sTNFR gene (SEQ ID NO:1) that has the clonal expression operating sequence:
CAT
gctagcATG
gtagctgtgt?gcgcagctct?cgcggtgggt?ctcgacctgt?gcgcagcagc?tcaggcgttc 60
ccagcacacg?tagctttgac?cccataggca?cctgacccag?gtaggacttg?gcgactgagt 120
gattagtacg?agcacacggc?acacatctgt?tggaggaagt?ggtcaccagg?tcagcaggct 180
aaggtgttgt?gcacgaacac?gtctgaaacg?gtctgagagt?cgtgagacga?gaggacgtag 240
acgcacctgt?gcaagtgcgt?accggactgg?ttcagatgcg?gatcgcgttg?cagttcggag 300
cacgtcgaca?cacaggcatg?gacgcgagat?cacaagcgaa?tgtgcacgtg?aaggcctgga 360
tggtactgcg?ccctaaggaa?ccatgacgga?tggcgactct?gggcacctct?ccgaaattgg 420
cgaccaggtt?taggagtcgc?aagtcctggt?acggacacct?ctgaggttgt?ctggaaccca 480
g 481
Utilization GCG software decomposes fragment into about 85b with above-mentioned sequence and complementary sequence thereof; amount to 22 polynucleotide passages; wherein normal chain first fragment be 5 '-CAGgctagcATGgtagctgtgtgcgcagctctcgcggtgggtctcgacctg-3 ' (SEQ ID NO:4); its front three base is the protection base; 4-9 base is the restriction enzyme site (Nhe I) when expression vector inserts, and first ATG is the initiator codon that adds.This fragment also is the upstream primer when synthesizing the total length fusion gene, and note is made sTNFR-M5 ' in this research.Principle of design is the complementation district that 18-20 base arranged between the complementary adjacent segment.Reference literature Protein EngineeringVol.5, No.8, pp.827-829, Chrisostomos Prodromou and Laurenee H, the method for Pearl (1992) is carried out segmental synthetic, carries out the PAGE purifying then.
Synthetic fragment well is dissolved in the tri-distilled water of sterilization according to the concentration of 2 μ g/ μ l, carries out PCR in accordance with the following methods with commercially available PCR test kit:
The composition of reaction system:
Become dosis refracta (μ l)
10XPCR reaction buffer 10
25mM?Mg
2SO
4 10
PfuDNA polysaccharase (5U/ μ l) 2
Each 1 μ l of polynucleotide passage (2 μ g/ μ l) amounts to 25 μ l
Sterilization tri-distilled water to 100 μ l
Reaction conditions:
Pre-sex change: 94 ℃, 2 minutes;
Major cycle: 94 ℃, 1 minute; 55 ℃, 1 minute; 72 ℃, 3 minutes;
Cycle number: 20
Extend the back: 72 ℃, and 5 minutes.
The PCR process is carried out on PROGENE GENIUS thermal cycler.
Electrophoresis is identified with gel and is reclaimed
Carry out PCR according to above-mentioned condition.After finishing product is identified on 0.8% agarose gel electrophoresis that finding has two bands in the product, wherein a molecular weight reclaims test kit with the gel of Promega company and reclaims this fragment about 480bp, and the specification sheets of operating according to producer carries out.Altogether about 3 micrograms of DNA.Clone, screening and the order-checking of reorganization sTNFR gene
Above-mentioned dna fragmentation is cloned on the pUC18 carrier according to ordinary method, behind the transformed into escherichia coli DH5 α cell at the dull and stereotyped enterprising row filter of IPTG/X-gal, get 20 white bacterial plaques and be inoculated in the liquid LB substratum that contains penbritin and increase, with plasmid extraction purification kit (Promega) extracting plasmid DNA and carry out enzyme and cut and selected the correct clone of 12 sizes after the evaluation and carried out determined dna sequence.According to sequencing result, confirmed 2 right-on clones of sequence, be sTNFR-M6 and sTNFR-M10.
Embodiment 2
The preparation of natural sTNFR gene
The pcr amplification of unexpected sTNFR gene (sTNFR-N)
The sequence of natural sTNFR gene is known, can be referring to for example Genebank accession number AH006638.Design of amplification primers in view of the above:
Upstream primer: 5 '-CAG
GctagcAtggcgcccgtcgccgtc-3 ' (SEQ ID NO:5),
Wherein, CAG is the protection base, and underscore partly is the point of contact (Nhe I) when expression vector pMSG (Pharmacia) clones.This fragment also is the upstream primer when making up natural sTNFR and Fc total length fusion gene, and note is made sTNFR-N5 '.
Downstream primer: 5 '-cttgcacaccacgtctg-3 ' (SEQ ID NO:6).
Synthetic above-mentioned primer is used for PCR behind the PAGE purifying.
With Trizol reagent extracted total RNA from human liver cell of GIBCO company, operating process is carried out according to the explanation of producer.Extractive total RNA reverse transcription test kit with INVITROGENE company after confirming integrity on 1% agarose electrophoresis carries out reverse transcription according to producer's explanation, obtains cDNA.Reaction finishes, behind the reaction system DNA of Promega company extracting and purifying test kit purifying as the template of PCR.
Utilize above-mentioned primer and template DNA to carry out PCR, its reaction system is as follows:
Become dosis refracta (μ l)
10XPCR reaction buffer 10
25mM?Mg
2SO
4 10
PfuDNA polysaccharase (5U/ μ l) 2
Each 3 μ l of primer (2 μ g/ μ l) amount to 6 μ l
Template DNA (1.8 μ g/ μ l) 1
Sterilization tri-distilled water to 100 μ l
The PCR process is carried out on PROGENE GENIUS thermal cycler, and cycling condition is as follows:
Pre-sex change: 94 ℃, 2 minutes;
Major cycle: 94 ℃, 1 minute, 60 ℃, 1 minute, 72 ℃, 3 minutes; Totally 30 circulations.
Extend the back: 72 ℃, and 5 minutes.
The evaluation of PCR product and gel reclaim
Carry out PCR according to above-mentioned condition.After finishing product is identified on 0.8% agarose gel electrophoresis that finding has the single band of a molecular weight about 450bp～500bp in the product, consistent with the 480bp size of expection.Gel recovery test kit with Promega company reclaims this fragment, and operation is carried out according to the specification sheets of producer.Altogether about 2.8 micrograms of DNA.
The clone of natural sTNFR gene, screening and order-checking
Above-mentioned dna fragmentation is cloned on the pUC18 carrier according to ordinary method, behind the transformed into escherichia coli DH5a cell at the dull and stereotyped enterprising row filter of IPTG/X-gal, get 5 white bacterial plaques and be inoculated in the liquid LB substratum that contains penbritin and increase, with plasmid extraction purification kit (Promega) extracting plasmid DNA and carry out enzyme and cut and selected the correct clone of 3 sizes after the evaluation and carried out determined dna sequence.According to sequencing result, 1 the right-on clone of sequence, i.e. sTNFR-N3 have been confirmed.
Embodiment 3
The acquisition of sTNFR-Fc fusion gene
Human IgG1 Fc fragments sequence is known (referring to for example WO9411026).Design 3 ' end primer in view of the above:
IgG1Fc-3 ' primer: 5 '-gca
CtcgagTtttacccggagacagggagag-3 ' (SEQ ID NO:7).
Wherein, gca is the protection base, and underscore partly is the point of contact (Xho I) when above-mentioned expression vector is cloned.This primer also is the downstream primer that obtains total length sTNFR and Fc fusion gene.
Design the primer of cross-over connection sTNFR and Fc in addition, what be used to recombinate sTNFR is:
Primer M:5 '-cagacgtggtgtgcaagccctctgaggttgtctggaacccag-3 ' (SEQ ID NO:8).
What be used for natural sTNFR is:
Primer N:5 '-cagacgtggtgtgcaagcccacatgcccaccgtgcccagcac-3 ' (SEQ ID NO:9).
Above primer is synthetic according to ordinary method, and carries out the PAGE purifying.
With aforesaid sTNFR-M and plasmid the pMG18 (" DEVELOPMENT that has total length IgG1 gene
OF?TOOLS?FOR?ENVIRONMENTAL?MONITORING?BASED?ON?INCP-9?PLASMIDS
SEQUENCES”，pp119-147，A.Greated，R.Krasowiak，M.Titok，C.M.Thomas?School
of?Biological?Sciences，University?of?Birmingham，Edgbaston，Birmingham?B15?2TT，
UK?and?Faculty?of?Biology，Dept?of?Microbiology，Belarus?State?University?Scorina?Av.
4, Minsk 220080 Belarus) be template, sTNFR-M5 ', IgG1Fc-3 ' and aforementioned primer M are that primer carries out PCR.Carrying out gel after the acquisition molecular weight is about the single band of 1049bp on the agarose gel electrophoresis reclaims.The DNA that obtains is cloned on the pUC18 carrier back transformed into escherichia coli and is carried out blue hickie screening according to ordinary method.Cut by enzyme and to identify and a right-on clone of sequence has been confirmed in order-checking that note is made sTNFR-M/Fc.
In like manner, replace sTNFR-M with sTNFR-N, sTNFR-N5 ' replacement sTNFR-M5 ' replaces primer M with primer N, makes sTNFR-N/Fc.
Embodiment 4
The preparation of total length sTNFR/ joint/Fc fusion gene
Its aminoacid sequence of joint sequence of the present invention's design is:
(Ala
3Ser
2)
5(SEQ?ID?NO：2)；
One of its dna sequence dna is:
5’-ACCACAACCTCGTCAACCACAACCTCGTCAACCACAACCTCGTCAACCACAACCTCGTCAACCACAACCTCGTCA-3’(SEQ?ID?NO：3)。
For by PCR with sTNFR coding region and Fc fragment assembly, these segmental head and the tail respectively add one respectively with sTNFR coding region 3 ' end and Fc coding region 5 ' end complementary sequence, each about 20 base length.Be used to connect the note work " joint-M " of sTNFR-M, its sequence is:
5’-tgaggttgtctggaacccagACCACAACCTCGTCAACCACAACCTCGTCAACCACAACCTCGTCAACCACAACCTCGTCAACCACAACCTCGTCAacatgcccaccgtgcccagcac-3’(SEQ?ID?NO：10)；
Be used to connect the note work " joint-N " of sTNFR-N, its sequence is:
5’-cagacgtggtgtgcaagcccACCACAACCTCGTCAACCACAACCTCGTCAACCACAACCTCGTCAACCACAACCTCGTCAACCACAACCTCGTCAacatgcccaccgtgcccagcac-3’(SEQ?ID?NO：11)。
Synthetic above-mentioned two kinds of joints, and carry out the Page purifying.
Right with IgG1Fc-3 ' primer with " joint-M " formation primer, be that template is carried out PCR with the plasmid pMG18 that contains human IgG1's complete sequence, obtain to have the human IgG1 Fc fragment of joint-M, its size is 764bp (669bp+95bp).PCR, electrophoresis, the method that evaluation and gel reclaim is described with reference to embodiment 1.The DNA note that obtains is made " joint-M/Fc ".
In like manner, with " joint-N " replacement " joint-M ", make " joint-N/Fc ".
DNA with aforementioned " joint-M/Fc " and sTNFR-M6 is a template, and sTNFR-M5 ' and IgG1Fc-3 ' carry out PCR for primer.Reaction system is:
Become dosis refracta (μ l)
10XPCR reaction buffer 10
25mM?Mg
2SO
4 10
Pfu archaeal dna polymerase (5U/ μ l) 2
Each 1.5 μ l of primer (2 μ g/ μ l) amount to 2 μ l
Joint-M/Fc DNA (1.6 μ g/ μ l) 1
sTNFR-M6(1.5μg/μl) 1.1
Sterilization tri-distilled water to 100 μ l
The PCR process is carried out on PROGENE GENIUS thermal cycler, and cycling condition is as follows:
Pre-sex change: 94 ℃, 2 minutes;
Major cycle: 94 ℃, 1 minute, 60 ℃, 1 minute, 72 ℃, 3 minutes; Totally 30 circulations.
Extend the back: 72 ℃, and 5 minutes.
The evaluation of PCR product and gel reclaim
The PCR product of above gained is identified on 0.8% agarose gel electrophoresis finding has the single band of a molecular weight about 1100bp in the product, consistent with the 1109bp size of expection.Gel recovery test kit with Promega company reclaims this fragment, and operation is carried out according to the specification sheets of producer.Altogether about 1.8 micrograms of DNA.
Merge clone, screening and the order-checking of sTNFR gene
Above-mentioned dna fragmentation is cloned on the pUC18 carrier according to ordinary method, behind the transformed into escherichia coli DH5a cell at the dull and stereotyped enterprising row filter of IPTG/X-gal, get 7 white bacterial plaques and be inoculated in the liquid LB substratum that contains penbritin and increase, with plasmid extraction purification kit (Promega) extracting plasmid DNA and carry out enzyme and cut and selected the correct clone of 2 sizes after the evaluation and carried out determined dna sequence.According to sequencing result, confirmed 1 right-on clone of sequence, note is made " sTNFR-M/ joint/Fc ".
In like manner,, replace sTNFR-M6,, obtain " sTNFR-N/ joint/Fc " with sTNFR-N5 ' replacement sTNFR-M5 ' with sTNFR-N3 with " joint-N/Fc " replacement " joint-M/Fc ".
Embodiment 5
The sTNFR expression of gene
The structure of integrative gene expression vector
The pUC18[sTNFR/Fc that embodiment 3 and 4 is made up] and pUC18[sTNFR/ joint/Fc] correctly clone and be inoculated in the 20ml liquid LB substratum that contains penbritin, 37 ℃ of overnight incubation, with the Midi plasmid DNA extracting and purifying test kit extracting plasmid DNA of Promega company, each get about 30 micrograms of plasmid DNA.
Use Nhe I and Xho I (Phamarcia) (10U/ul) to digest pUC18[sTNFR/Fc respectively], pUC18[sTNFR/ joint/Fc] and expression plasmid pMSG (Phamarcia).37 ℃ of reactions of endonuclease reaction are spent the night.Enzyme is cut product and carry out isolation identification on 0.8% agarose electrophoresis, with the big or small correct fragment of size that is about of gel recovery test kit recovery of Promega company.
Use T4 dna ligase (10U/ul) sTNFR/Fc or sTNFR/ joint/Fc to be connected to the Nhe I and the Xho I site of pMSG carrier respectively.
According to ordinary method (seeing Sambrook etc., 1989) connection gained reorganization pMSG transformed into escherichia coli DH5a bacterial strain, and on the IPTG/X-Gal plate culture medium, carry out blue hickie screening.Respectively get 10 of hickies and be inoculated in and extract plasmid after 37 ℃ of cultivations of LB liquid nutrient medium and carry out enzyme as previously mentioned and cut evaluation, every kind of fusion gene obtains 4 segmental clones of insertion with correct size at least, as candidate clone.
Carry out dna sequencing with two in the above-mentioned candidate clone.According to sequencing result, confirm to insert the in full accord of fragments sequence and design respectively.The correct clone of gained is remembered work: pMSG[sTNFR-M/Fc respectively], pMSG[sTNFR-N/Fc], pMSG[sTNFR-N/ joint/Fc] and pMSG[sTNFR-M/ joint/Fc].
The conversion of Chinese hamster ovary celI and expression
Get the coli strain that has above-mentioned four kinds of reorganization pMSG, be inoculated in the 2xYT liquid nutrient medium that 500ml has added penbritin respectively, 37 ℃, the 260rpm concussion was cultivated 16 hours.With " Ultrapure Plasmid Purification Kit " extracting plasmid DNA of Qiagen company, extractive process is carried out according to the specification sheets that producer provides.
Use the liposome transfection Chinese hamster ovary celI, the transfection reagent box is available from Invitrogene company.Get the pMSG[sTNFR-N/ joint/Fc of above-mentioned purifying during transfection respectively], pMSG[sTNFR-M/ joint/Fc], pMSG[sTNFR-M/Fc], pMSG[sTNFR-N/Fc] plasmid 100 micrograms carry out transfection as the DNA sample to Chinese hamster ovary celI, the transfection schedule of operation is carried out according to the specification sheets of producer.
Chinese hamster ovary celI after the transfection is through continuous 3 months methotrexate (MTX) screening, and to 10 μ M, per two weeks increase a concentration to its concentration from 0.05 μ M, and the consumption of each MTX is about previous 2 times, concrete visual cell's growing state and deciding.Cell cultures is carried out according to routine, and substratum is: 15% foetal calf serum (Gibco)+RPM1640/DEME.In 37 ℃, 5%CO
2Cultivate in the incubator.Carry out mono-clonalization according to routine extreme dilution method then.Use the ELISA method and detect its Expression of Fusion Protein amount respectively, obtain pMSG[sTNFR-N/ joint/Fc altogether] clone 89, pMSG[sTNFR-M/ joint/Fc] clone 63, pMSG[sTNFR-M/Fc] clone 87, pMSG[sTNFR-N/Fc] clone 96.
The conventional cultivation in the DEME substratum studied through the expression intensity of the above-mentioned part clone of ELISA sTNFR, and concrete data are as follows:
Gene type pMSG[sTNFR-N/ pMSG[sTNFR-pMSG[sTNFR-pMSG[sTNFR-
Joint/Fc] M/ joint/Fc] N/Fc] M/Fc]
Tested clone's quantity 32 44 38 48
Average expression level 0.26 ± 0.23 1.47 ± 0.33 0.31 ± 0.17 1.29 ± 0.42
(mg/L supernatant)
Above data declaration, reorganization sTNFR gene of the present invention has significantly improved its expression level, and the amplitude of raising is up to 4.16～5.65 times.This proteinic scale production had important economic value.
Embodiment 6
The sTNFR fusion rotein is to the research of TNF α antagonistic ability
With above-mentioned pMSG[sTNFR-N/ joint/Fc], pMSG[sTNFR-M/ joint/Fc], pMSG[sTNFR-M/Fc], pMSG[sTNFR-N/Fc] expression cell line cultivate the back and carry out affinity chromatography with A albumen-Sepharose, acquisition purity reaches the fusion rotein more than 90%.
The fusion rotein of above-mentioned four kinds of purifying detects its neutralising capacity to TNF α by the following method.
1. the L929 cell of taking the logarithm vegetative period digests fully cell dispersion of back with 1% trypsinase is conventional, and is diluted to 2 * 10 with cell culture fluid
5Cells/ml.
2. get 4 of 96 orifice plates, add 100 μ l cell suspending liquids, 5%CO in every hole
2Cultivated 24 hours for 37 ℃ in the incubator.
3. the cell culture fluid with 1～2 μ g/ml dactinomycin and 0.001 μ g/ml TNF α standard substance (Phamacia company product) is diluted to 10 μ g/ml, 1.0 μ g/ml, 0.1 μ g/ml, 0.01 μ g/ml, 0.001 μ g/ml, 0.0001 μ g/ml and 0.00001 μ g/ml with testing sample.
4. every hole adds the various dilution samples of 100 μ l, 3 holes of each extent of dilution.Negative control only adds the cell culture fluid that contains 1～2 μ g/ml dactinomycin.The TNF α (2 μ g/ml) that adds high dosage in the positive control.
5.5%CO
2Cultivated 24 hours or longer for 37 ℃ in the incubator.Incubation time is determined according to the cell in the positive control hole is all dead.
6. on plate reading machine, read the optical density(OD) data with MTT dyeing back.
From above data as can be seen, the fusion rotein that adds joint has improved about 3 times than the fusion rotein that does not have joint to the neutralising capacity of TNF α.This explanation, the adding of joint can obviously improve the neutralising capacity of fusion rotein, i.e. avidity.
Sequence table
＜110〉Lansheng Guojian Pharmaceutic Ind. Co., Ltd., Shanghai
＜120〉reorganization sTNFR gene, and fusion gene and product
<160>11
<210>1
<211>481
<212>DNA
＜213〉polynucleotide
<400>1
GTAGCTGTGT?GCGCAGCTCT?CGCGGTGGGT?CTCGACCTGT?GCGCAGCAGC?TCAGGCGTTC?060
CCAGCACACG?TAGCTTTGAC?CCCATAGGCA?CCTGACCCAG?GTAGGACTTG?GCGACTGAGT?120
GATTAGTACG?AGCACACGGC?ACACATCTGT?TGGAGGAAGT?GGTCACCAGG?TCAGCAGGCT?180
AAGGTGTTGT?GCACGAACAC?GTCTGAAACG?GTCTGAGAGT?CGTGAGACGA?GAGGACGTAG?240
ACGCACCTGT?GCAAGTGCGT?ACCGGACTGG?TTCAGATGCG?GATCGCGTTG?CAGTTCGGAG?300
CACGTCGACA?CACAGGCATG?GACGCGAGAT?CACAAGCGAA?TGTGCACGTG?AAGGCCTGGA?360
TGGTACTGCG?CCCTAAGGAA?CCATGACGGA?TGGCGACTCT?GGGCACCTCT?CCGAAATTGG?420
CGACCAGGTT?TAGGAGTCGC?AAGTCCTGGT?ACGGACACCT?CTGAGGTTGT?CTGGAACCCA?480
G 481
<210>2
<211>25
<212>PRT
＜213〉joint peptide
<400>2
Ala?Ala?Ala?Ser?Ser?Ala?Ala?Ala?Ser?Ser?Ala?Ala?Ala?Ser?Ser?Ala
5 10 15
Ala?Ala?Ser?Ser?Ala?Ala?Ala?Ser?Ser
20 25
<210>3
<211>75
<212>DNA
＜213〉joint
<400>3
ACCACAACCT?CGTCAACCAC?AACCTCGTCA?ACCACAACCT?CGTCAACCAC?AACCTCGTCA?60
ACCACAACCT?CGTCA 75
<210>4
<211>51
<212>DNA
＜213〉primer
<400>4
CAGGCTAGCA?TGGTAGCTGT?GTGCGCAGCT?CTCGCGGTGG?GTCTCGACCT?G 51
<210>5
<211>27
<212>DNA
＜213〉primer
<400>5
CAGGCTAGCA?TGGCGCCCGT?CGCCGTC 27
<210>6
<211>17
<212>DNA
＜213〉primer
<400>6
CTTGCACACC?ACGTCTG 17
<210>7
<211>31
<212>DNA
＜213〉primer
<400>7
GCACTCGAGT?TTTACCCGGA?GACAGGGAGA?G 31
<210>8
<211>42
<212>DNA
＜213〉primer
<400>8
CAGACGTGGT?GTGCAAGCCC?TCTGAGGTTG?TCTGGAACCC?AG 42
<210>9
<211>42
<212>DNA
＜213〉primer
<400>9
CAGACGTGGT?GTGCAAGCCC?ACATGCCCAC?CGTGCCCAGC?AC 42
<210>10
<211>117
<212>DNA
＜213〉primer
<400>10
TGAGGTTGTC?TGGAACCCAG?ACCACAACCT?CGTCAACCAC?AACCTCGTCA?ACCACAACCT 60
CGTCAACCAC?AACCTCGTCA?ACCACAACCT?CGTCAACATG?CCCACCGTGC?CCAGCAC 117
<210>11
<211>117
<212>DNA
＜213〉primer
<400>11
CAGACGTGGT?GTGCAAGCCC?ACCACAACCT?CGTCAACCAC?AACCTCGTCA?ACCACAACCT 60
CGTCAACCAC?AACCTCGTCA?ACCACAACCT?CGTCAACATG?CCCACCGTGC?CCAGCAC 117
Claims (8)
1. a reorganization sTNFR gene has the described sequence of SEQ ID NO:1.
2. a fusion gene contains the described people Ig antibody Fc fragment gene of recombinating the sTNFR gene and merging with it of claim 1.
3. fusion gene according to claim 2 wherein also comprises one section one section joint sequence that is positioned between reorganization sTNFR gene and the people Ig antibody Fc fragment, and its amino acid sequence coded is (Ala
3Ser
2)
5That is SEQ ID NO:2.
4. fusion gene according to claim 3, the dna sequence dna of described joint are SEQ ID NO:3.
5. the protein of the described fusion gene of claim 3 comprises sTNFR, the joint (Ala shown in the SEQ ID NO:2
3Ser
2)
5With people Ig antibody Fc fragment.
6. a recombinant vectors wherein contains claim 1 or 2 described genes.
7. a mammalian cell wherein contains the described recombinant vectors of claim 6.
8. cell according to claim 7, it is selected from Chinese hamster ovary celI, Hela cell, mouse Ltk-(4) cell, monkey kidney VERO cell.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 01132074 CN1204252C (en) | 2001-10-31 | 2001-10-31 | Recombinant gene of soluble part in tumor necrosis factor acceptor and its fusion gene and product |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 01132074 CN1204252C (en) | 2001-10-31 | 2001-10-31 | Recombinant gene of soluble part in tumor necrosis factor acceptor and its fusion gene and product |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1417334A CN1417334A (en) | 2003-05-14 |
| CN1204252C true CN1204252C (en) | 2005-06-01 |
Family
ID=4671119
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 01132074 Expired - Lifetime CN1204252C (en) | 2001-10-31 | 2001-10-31 | Recombinant gene of soluble part in tumor necrosis factor acceptor and its fusion gene and product |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1204252C (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1309740C (en) * | 2005-10-20 | 2007-04-11 | 高基民 | Soluble tumour necrosis factor receptor II- |
-
2001
- 2001-10-31 CN CN 01132074 patent/CN1204252C/en not_active Expired - Lifetime
Also Published As
| Publication number | Publication date |
|---|---|
| CN1417334A (en) | 2003-05-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN88100685A (en) | People's interleukin-3 and mutein thereof | |
| CN1131240C (en) | Chromosome 21 gene marker, compositions and methods using same | |
| CN1665840A (en) | Immunoglobulin-domain containing cell surface recognition molecules | |
| CN1620467A (en) | Secreted protein | |
| CN1436237A (en) | Nucleotide sequences involved in increasing or decreasing mammalian ovulation rate | |
| CN1204252C (en) | Recombinant gene of soluble part in tumor necrosis factor acceptor and its fusion gene and product | |
| CN1184232C (en) | Human tumor necrosin relative death inducing ligand mutein and its prepn process and medicine composition | |
| CN100335632C (en) | Seven kinds of yak milk protein gene sequence | |
| CN1260356C (en) | Recombinant gene of soluble part in cytolytic T cell relative antigen 4 and its fusion gene and product | |
| CN1506375A (en) | Azurin as bacterial protein with wide-spectrum antitumor function and its use and medicinal composition | |
| CN1257271C (en) | Serine proteinase and coded sequence thereof | |
| CN101058808A (en) | Breast cancer relevant p69 gene, coding protein and application thereof | |
| CN1234855C (en) | Recombinant Flt3 ligand gene and its fusion gene and product | |
| CN1216911C (en) | Recombinant human interleukin-4, its code nucleic acid and its application | |
| CN1251610A (en) | Novel mouse CXC chemokine receptor | |
| CN1267732A (en) | Human methyl transferase protein and its code sequence | |
| CN1267727A (en) | New human phosphorylated zymoprotein of pyruvate dehydrogenase and its code sequence | |
| CN1732258A (en) | High expression locus vector based on ferritin heavy chain gene locus | |
| CN1278002A (en) | Human RNA binding protein and coding series thereof | |
| CN1793176A (en) | Rat's IL-17RE span film region and cell inner region poly peptide and coding sequence, fusion protein and clone | |
| CN1272540A (en) | Human immune factor related protein and its coded sequence | |
| CN1860232A (en) | Methods and compositions for defining gene function | |
| CN1563382A (en) | Gene of Chinese Mainland SJPP gene stock of japanese blood fluke, clone, expression and application | |
| CN1680431A (en) | Crystal of human avidin protein and preparation thereof | |
| CN1272545A (en) | Human neurogenic glutamine transport protein and its coded sequence |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C56 | Change in the name or address of the patentee | ||
| CP03 | Change of name, title or address |
Address after: Shanghai city 201203 libing road Zhangjiang High Tech Park No. 399 Patentee after: Shanghai CP Guojian Pharmaceutical Co., Ltd. Address before: Pudong road 200120 Shanghai city Shanghai Stock Exchange Building No. 528 North Tower room 2304 Patentee before: Zhongxin Guojian Pharmaceutical Co., Ltd., Shanghai |
|
| C56 | Change in the name or address of the patentee | ||
| CP01 | Change in the name or title of a patent holder |
Address after: Shanghai city 201203 libing road Zhangjiang High Tech Park No. 399 Patentee after: Three country Kin Pharmaceutical (Shanghai) Limited by Share Ltd Address before: Shanghai city 201203 libing road Zhangjiang High Tech Park No. 399 Patentee before: Shanghai CP Guojian Pharmaceutical Co., Ltd. |
|
| CX01 | Expiry of patent term | ||
| CX01 | Expiry of patent term |
Granted publication date: 20050601 |