CN1309740C - Soluble tumour necrosis factor receptor II- - Google Patents
Soluble tumour necrosis factor receptor II- Download PDFInfo
- Publication number
- CN1309740C CN1309740C CNB2005101004689A CN200510100468A CN1309740C CN 1309740 C CN1309740 C CN 1309740C CN B2005101004689 A CNB2005101004689 A CN B2005101004689A CN 200510100468 A CN200510100468 A CN 200510100468A CN 1309740 C CN1309740 C CN 1309740C
- Authority
- CN
- China
- Prior art keywords
- gad
- stnfrii
- adiponectin
- stnfr
- fusion protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The present invention relates to soluble tumour necrosis factor receptor II-'adiponectin' sphere part double-function fusion protein (namely sTNFRII-gAD fusion protein) produced by a gene engineering technology. The sTNFRII-gAD fusion gene can be obtained by rebuilding the cDNA of sTNFRII and gAD. sTNFRII-gAD expression plasmids are constructed. The sTNFRII-gAD expression plasmids can be converted to colibacillus, and the high efficiency expression of pronucleus can be obtained. The sTNFRII-gAD fusion protein has double bioactivity of sTNFRII and gAD after the purification and the renaturation are carried out, namely, the activity of TNF alpha and the sphere part of 'adiponectin' can realize antagonism (comprising promoting the oxidation of fatty acid in vivo, enhancing the insulin sensitivity and inhibiting atherosclerosis and fatty liver). In addition, a monomer sTNFRII can form a dimer or a trimer by the trimer action of gAD, and the activity of the antagonism TNF alpha is 50 to 100 times higher than that of a corresponding monomer. Therefore, the double-function fusion protein molecule can be used for treating rheumatoid arthritis, and can be helpful for preventing and treating diseases, such as II type diabetes, adiposis, atherosclerosis, fatty liver, etc.
Description
One, technical field
The invention belongs to the genetically engineered field, be soluble tumor necrosis factor receptor II-" adiponectin " bulb fusion rotein, i.e. sTNFR II-gAD.
Two, background technology
" adiponectin " is a kind of proteohormone of finding recently (Adiponectin), because of it is found by three different laboratories are successively independent, so claim GBP-28 again, apM1, AdipoQ and Acrp30; It to blood circulation, accounts for 0.01% (5-30 μ g/ml) of human plasma total protein, so its concentration is 10 of most of hormone concentrations by the synthetic justacrine of adipocyte
3-10
6Doubly (Shimada K, Miyazaki T, Daida H. (2004) Adiponectin and atherosclerotic disease.Clin Chim Acta.344:1-12.).Its protein structure is made up of two portions: the complement Clq sample ball-like structure of N-terminal collagen shape structure and carboxyl terminal.Adiponectin exists with two kinds of forms of the ball-like structure fragment (gAD) behind total length and the protease cracking in blood.Adiponectin can form homotrimer closely by its ball-like structure, then further form more complicated homology polymer by its collagen shape structure, but gAD only can form homotrimer (Berg AH, Combs TP, Scherer PE. (2002) Acrp30/adiponectin:an adipokine regulating glucose and lipid metabolism.TrendsEndocrinol Metab.13:84-89.).Adiponectin has two kinds of acceptor AdipoR1 and AdipoR2, AdipoR1 great expression in skeletal muscle wherein, and AdipoR2 is great expression in liver then; Total length adiponectin and AdipoR2 have higher affinity, the affinity that gAD is then higher with AdipoR1, although both all can combine with AdipoR1 and AdipoR2, and by activating AMP kinases and PPAR-α approach, promote Skeletal Muscle Cell and liver cell to glucose uptake and oxidation of fatty acids (Yamauchi T, Kamon J, Ito Y, et al. (2003) Cloning of adiponectin receptors that mediate antidiabetic metabolic effects.Nature.423:762-769.).Experimentation on animals shows, it can promote the oxidation of body fat acid by muscle (account for weight of mammal 25%), reduces blood triglyceride, and by promoting the glucose metabolism of insulin sensitivity property improvement; The mouse of adiponectin disappearance is rendered as insulin resistant (insulin resistance), finally develop into type ii diabetes (Maeda N, Shimomura I, Kishida K, et al. (2002) Diet-induced insulin resistance in micelacking adiponectin/ACRP30.Nat Med.8:731-737.).It can be by suppressing monocyte/macrophage adhesion, migration and to the picked-up and the accumulation of modified low density lipoprotein, thereby suppress atherosclerotic formation.Clinical studies show, adiponectin concentration in obesity, type ii diabetes and the patients with coronary heart disease blood general low (Diez JJ, Iglesias P. (2003) The role of the novel adipocyte-derived hormone adiponectinin human disease.Eur J Endocrinol.148:293-300.).In addition, adiponectin can enter celiolymph by circulation and act on neuronal cell.The adiponectin that these central authorities discharge can make losing weight of mouse, and fat reduces; And it is effective too to lack the mouse that causes glucose level rising and fat to accumulate because of leptin (leptin).Be different from central leptin by reducing ingestion of food, central authorities' adiponectin then is by improving energy expenditure (the Qi Y that loses weight, Takahashi N, Hileman SM, et al. (2004) Adiponectin acts in the brain todecrease body weight.Nat Med.10:524-529.).Adiponectin can also be by promoting liver cell to oxidation of fatty acids with suppress the generation of the synthetic and TNF α of liver cell lipid acid, thereby slow down generation (the Xu A of alcohol/non-alcoholic fatty liver disease, Wang Y, Keshaw H, et al. (2003) The fat-derived hormone adiponectinalleviates alcoholic and nonalcoholic fatty liver diseases in mice.J Clin Invest.112:91-100.).Therefore, adiponectin is a cytokine with control type ii diabetes, obesity, atherosclerosis and fatty liver potentiality.
Soluble tumor necrosis factor receptor II (sTNFR II) is the natural agonist of TNF α, it is cytolemma outside part (the Mohler KM of Tumor Necrosis Factor Receptors II, Torrance DS, Smith CA, et al. (1993) Soluble tumor necrosis factor receptors are effective therapeutic agents in lethalendotoxemia and function simultaneously as both TNF carriers and TNF antagonists.JImmunol.151:1548-61.).The fused protein dimer (sTNFRII-Fc, called after Etanercept) that sTNFRII and IgG1 Fc (CH2 and CH3) form has been used for the treatment of rheumatoid arthritis from 1999 since the drugs approved by FDA clinically.Studies show that by the Dimerized effect of Fc, the ability of Etanercept anti-TNF alpha short of money is monomeric nearly 50 times of corresponding sTNFR II.Nearest numerous studies show that, TNF α also is the important virulence factor (Wisse BE. (2004) The inflammatory syndrome:The role of adipose tissue cytokines in metabolic disorderslinked to obesity.J Am Soc Nephrol 15:2792-2800.) in the pathologies such as type ii diabetes, obesity, atherosclerosis and fatty liver.Therefore, anti-TNF alpha short of money can not only be treated rheumatoid arthritis, and helps the control of type ii diabetes, obesity, atherosclerosis and fatty liver diseases.
It is highly important that, sTNFR II-gAD fusion rotein turns usefulness into by the tripolymer of gAD, impel sTNFRII to form homology two or tripolymer, can strengthen the avidity of this fusion rotein and TNF α greatly, and can prolong the transformation period of this fusion rotein in blood circulation because of molecular weight increases.In addition, combine with its acceptor AdipoR1 and AdipoR2 by gAD, the mixture that sTNFR II-gAD and TNF α interact and form can be directed to skeletal muscle and liver, finally TNF α can be removed from blood circulation.Therefore, no matter sTNFR II-gAD fusion rotein is on function, still on the ability of anti-TNF alpha short of money, the sTNFRII-Fc fusion rotein that all is better than present clinical use (promptly can only competitive inhibition TNF α, and it can not be removed from blood circulation, so must for a long time and continue medication).
Three, summary of the invention
The invention process of sTNFR II-gAD fusion rotein is as follows: in order to obtain to contain the plasmid of sTNFR II-gAD fusion gene, we have carried out clone and terminal the transformation to sTNFR II or gAD cDNA, have made up sTNFR II-gAD-pET24 recombinant plasmid; With this recombinant plasmid transformed e. coli bl21 (DE3), obtain corresponding engineering bacterium intestinal bacteria sTNFR II-gAD/pET24, and sTNFR II-gAD fusion gene has been realized expression, expression efficiency is 15-20%; Its expression product is respectively sTNFR II-gAD fusion rotein, has the bifunctional molecule activity, the activity in anti-TNF alpha promptly short of money and " fat splits element " bulb (comprising the oxidation, raising insulin sensitivity, inhibition atherosclerosis and the fatty liver that promote body fat acid).Fusion rotein mainly exists with the inclusion body form in bacterium; Separation and purification albumen and renaturation have obtained sTNFR II-gAD bifunctional fusion proteins after handling.6His is introduced the C end of fusion rotein, thereby be convenient to the separation and purification of this fusion rotein.
STNFR II-gAD bifunctional fusion proteins of the present invention wherein has the activity of anti-TNF alpha short of money (to hatch ED altogether with 0.25ng/mL TNF α
50=1-10ng/mL) and the biologic activity of adiponectin (as suppressing the propagation of mouse marrow leukaemia cell strain M1, half effectively suppresses dosage ED
50Be about 10 μ g/ml; And U-9889 (Streptozotocin) inductive type i diabetes mouse there is remarkable hypoglycemic effect.
STNFR II turns usefulness into by the tripolymer of gAD, impels sTNFR II to form homology two or tripolymer, thereby has strengthened the avidity of this fusion rotein and TNF α greatly, and can prolong the transformation period of this fusion rotein in blood circulation because of molecular weight increases.Combine with its acceptor AdipoR1 and AdipoR2 by gAD, the mixture that sTNFR II-gAD fusion rotein and TNF α interact and form can be directed to skeletal muscle and liver, finally TNF α can be removed from blood circulation.
Four, description of drawings
Fig. 1 is the synoptic diagram of plasmid sTNFR II-gAD-pET24.
Fig. 2 is sTNFR II-gAD fusion rotein efficiently expressing in intestinal bacteria.
Five, embodiment
By following embodiment technical characterictic of the present invention is described in detail.
Materials and methods:
One, animal, cell strain, bacterial strain and plasmid: mouse marrow leukaemia cell strain M1, inoblast strain L929, escherichia coli DH5a and BL21 (DE3); Prokaryotic expression plasmid pET24a (Kanar, Novagen).
Two, main biochemical reagents and material: DNeasy organize the preparation test kit (Qiagen) of test kit and plasmid DNA, synthetic (Sigma) of oligonucleotide, Trizol, SuperScript II reversed transcriptive enzyme, Platinum Pfx archaeal dna polymerase and T4 dna ligase (Invitrogen); STNFR II-Fc (R﹠amp; D Systems), agarose and SDS-PAGE (Biorad); Ni-NTA (Qiagen) and Sephacryl S-200 filler (Pharmacia).
Three, the connection of dna fragmentation, conversion and transformant screening, restriction endonuclease analysis, the equal reference literature of ordinary method (Sambrook J such as SDS-polyacrylamide gel electrophoresis, et al.Molecular Cloning-A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York, 2nd edition, 1989) or the product description that provides of producer; Dna sequence analysis is finished in the dna sequencing service centre of UTSW.
Four, mouse type i diabetes Preparation of model: reference literature (Kuniathoor VV, Wilson DL, LeBoeufRC. (1996) Increased atherosclerosis in streptozotocin-induced diabetic mice.J ClinInvest 97:1767-1773.) with U-9889 (Streptozotocin, every day the 40mg/kg body weight, continuous 5 days, abdominal injection) induce male CL57BL/6 that type i diabetes (blood sugar concentration is 310-420mg/dl, and normal control is 160-230mg/dl) takes place.
The preparation of embodiment 1.gAD cDNA.
Play total RNA of human hypodermic fat tissue with the Trizol extracting, and with it as template, carry out RT-PCR and prepare gAD cDNA.
The preparation of embodiment 2.sTNFR II cDNA.
Play total RNA of peripheral blood mononuclear cell with the Trizol extracting, and with it as template, carry out RT-PCR and prepare sTNFR II cDNA.
Embodiment 3.sTNFR II-gAD-pET24 construction of recombinant plasmid.
Prepare sTNFR II-gAD-6His fusion gene with PCR, and carry out nucleotide sequencing; Then it is cloned respectively in pET24a, obtain sTNFR II-gAD-pET24 recombinant plasmid (Fig. 1), and limiting it property endonuclease analysis is identified.
Embodiment 4.sTNFR II-gAD fusion gene efficiently expressing in intestinal bacteria.
With sTNFR II-gAD-pET24 recombinant plasmid difference transformed into escherichia coli BL21 (DE3), obtain corresponding engineering bacterium sTNFR II-gAD/pET24; And sTNFR II-gAD fusion gene realized expression, and expression efficiency is 20-30%, mainly there be (Fig. 2) in expression product with the form of inclusion body.
The preparation of embodiment 5.sTNFR II-gAD-6His fusion rotein.
1. preparation inclusion body.5 gram thalline are suspended among the 100ml 1xPBS, ultrasonic in the ice bath (electric current 270mA), 30 seconds * 10 times (each 30 seconds at interval); Lysate is in 4 ℃ centrifugal 10 minutes (8000g), precipitation is suspended among the 100ml 1xPBS (including 4mol/L urea, 0.5%Triton X-100,20mmol/L EDTA) carries out rinsing, centrifugal subsequently (1000g * 10 minute) collecting precipitation; After twice of the rinsing, be dissolved in the 100mmol/L sodium phosphate buffer, in the 8mol/L urea (pH 8.0), 15000g * 15 minute supernatant.
2.Ni-NTA column chromatography: the solubilization of inclusion bodies liquid for preparing is splined on the Ni-NTA post, and (2.6 * 5cm), (100mmol/L sodium phosphate buffer, 8mol/L urea pH8.0) wash to sample A with balance liquid
280Return to baseline; (100mmol/L sodium phosphate buffer, 8mol/L urea pH4.5) carry out wash-out, collect fusion rotein mass peak (SDS-PAGE evaluation) to use elutriant then.
3. dialysis renaturation: the sTNFR II-gAD fusion rotein that the Ni-NTA column chromatography purification is obtained transfers to OD
280=0.2,4 ℃ of dialysis renaturation are 12 hours in greater than the dialyzate of 20 times of volumes (the 1mmol/L reduced glutathione, 0.2mmol/L oxidized form Triptide, pH 9.0 for 100mmol/L NaHCO3,1.0mol/L urea); At 50mmol/LNaHCO3,500mmol/L NaCl continues dialysis 6 hours among the pH 11 then; The centrifugal insolubles of removing is collected supernatant.
The active mensuration of embodiment 6.sTNFR II-gAD.
1. the functional examination of anti-TNF alpha short of money: reference literature (Mohler KM; Torrance DS; Smith CA; etal. (1993) Soluble tumor necrosis factor receptors are effective therapeutic agents inlethal endotoxemia and function simultaneously as both TNF carriers and TNFantagonists.J Immunol.151:1548-61.); under the situation that 0.25ng/ml TNF α exists;, record half and effectively protect dosage ED as positive control with Etanercept
50Be about 1-10ng/ml.
2. the active mensuration of adiponectin:
A) reference literature (Yokota T, Oritani K, Takahashi I, et al. (2000) Adiponectin, a newmember of the family of soluble defense collagens, negatively regulates the growth ofmyelomonocytic progenitors and the functions of macrophages.Blood 96:1723-1732.), record half and effectively suppress dosage ED
50Be about 10 μ g/ml.
B) measure sTNFR II-gAD (5 μ g/g body weight, abdominal injection) hypoglycemic effect to the back type i diabetes C57BL/6 mouse of taking food (sees the following form, n=5, with Walaphage as positive control), the result shows that sTNFR II-gAD has remarkable hypoglycemic effect in injection in back 4 hours.
| The injection back time (hour) | 2 | 4 | 6 | 8 |
| Physiological saline (%) | 9.10±3.58 | 16.50±5.47 | 33.25±4.66 | 45.25±3.09 |
| Walaphage (%) | 45.00±7.36 * | 67.50±2.02 ** | 70.50±3.79 * | 67.00±9.14 |
| sTNFRII- gAD(％) | 44.30±1 0.90 * | 42.50±8.17 * | 51.50±7.41 | 55.00±7.23 |
Annotate: * is P＜0.05, and * * is P＜0.01.
Soluble tumor necrosis factor receptor II-" adiponectin " bulb fusion rotein
＜110〉Gao Jimin
＜120〉soluble tumor necrosis factor receptor II-" adiponectin " bulb fusion rotein
<160>1
<210>1
<211>1023
<212>DNA
＜213〉artificial sequence
<220>
<221>sTNFRII-gAD-6His
<222>(1)…(555)
＜223〉this dna fragmentation is the cDNA of coding human soluble tumor necrosis factor receptor II (sTNFRII), and wherein 5 ' end contains ATG, as the initiation codon of intestinal bacteria translation sTNFRII-gAD-6His fusion rotein.
<220>
<221>sTNFRII-gAD-6His
<222>(556)…(564)
＜223〉be the restriction enzyme site of EcoRI and NdeI mend flat after, flush end is connected to form.
<220>
<221>sTNFRII-gAD-6His
<222>(565…1023)
＜223〉dna fragmentation (459bp) coding " adiponectin " bulb (gAD), its 3 ' end contains XhoI site of coding, the sequence (997-1023bp) of 6 Histidines and stop code.
<400>1
1 ATGTTGCCCGCCCAGGTGGCATTTACACCCTACGCCCCGGAGCCCGGGAGCACATGCCGG 60
MetLeuProAlaGlnValAlaPheThrProTyrAlaProGluProGlySerThrCysArg
61 CTCAGAGAATACTATGACCAGACAGCTCAGATGTGCTGCAGCAAATGCTCGCCGGGCCAA 120
LeuArgGluTyrTyrAspGlnThrAlaGlnMetCysCysSerLysCysSerProGlyGln
121 CATGCAAAAGTCTTCTGTACCAAGACCTCGGACACCGTGTGTGACTCCTGTGAGGACAGC 180
HisAlaLysValPheCysThrLysThrSerAspThrValCysAspSerCysGluAspSer
181 ACATACACCCAGCTCTGGAACTGGGTTCCCGAGTGCTTGAGCTGTGGCTCCCGCTGTAGC 240
ThrTyrThrGlnLeuTrpAsnTrpValProGluCysLeuSerCysGlySerArgCysSer
241 TCTGACCAGGTGGAAACTCAAGCCTGCACTCGGGAACAGAACCGCATCTGCACCTGCAGG 300
SerAspGlnValGluThrGlnAlaCysThrArgGluGlnAsnArgIleCysThrCysArg
301 CCCGGCTGGTACTGCGCGCTGAGCAAGCAGGAGGGGTGCCGGCTGTGCGCGCCGCTGCGC 360
ProGlyTrpTyrCysAlaLeuSerLysGlnGluGlyCysArgLeuCysAlaProLeuArg
361 AAGTGCCGCCCGGGCTTCGGCGTGGCCAGACCAGGAACTGAAACATCAGACGTGGTGTGC 420
LysCysArgProGlyPheGlyValAlaArgProGlyThrGluThrSerAspValValCys
421 AAGCCCTGTGCCCCGGGGACGTTCTCCAACACGACTTCATCCACGGATATTTGCAGGCCC 480
LysProCysAlaProGlyThrPheSerAsnThrThrSerSerThrAspIleCysArgPro
481 CACCAGATCTGTAACGTGGTGGCCATCCCTGGGAATGCAAGCATGGATGCAGTCTGCACG 540
HisGlnIleCysAsnValValAlaIleProGlyAsnAlaSerMetAspAlaValCysThr
541 TCCACGTCCCCCACCGAATTTATGAAAGGAGAACCTGGAGAAGGTGCCTATGTATACCGC 600
SerThrSerProThrGlTPheMetLysGlyGlTProGlyGlTGlyAlaTyrValTyrArg
601 TCAGCATTCAGTGTGGGATTGGAGACTTACGTTACTATCCCCAACATGCCCATTCGCTTT 660
SerAlaPheSerValGlyLeTGlTThrTyrValThrIleProAsnMetProIleArgPhe
661 ACCAAGATCTTCTACAATCAGCAAAACCACTATGATGGCTCCACTGGTAAATTCCACTGC 720
ThrLysIlePheTyrAsnGlnGlnAsnHisTyrAspGlySerThrGlyLysPheHisCys
721 AACATTCCTGGGCTGTACTACTTTGCCTACCACATCACAGTCTATATGAAGGATGTGAAG 780
AsnIleProGlyLeTTyrTyrPheAlaTyrHisIleThrValTyrMetLysAspValLys
781 GTCAGCCTCTTCAAGAAGGACAAGGCTATGCTCTTCACCTATGATCAGTACCAGGAAAAT 840
ValSerLeTPheLysLysAspLysAlaMetLeTPheThrTyrAspGlnTyrGlnGlTAsn
841 AATGTGGACCAGGCCTCCGGCTCTGTGCTCCTGCATCTGGAGGTGGGCGACCAAGTCTGG 900
AsnValAspGlnAlaSerGlySerValLeTLeTHisLeTGlTValGlyAspGlnValTrp
901 CTCCAGGTGTATGGGGAAGGAGAGCGTAATGGACTCTATGCTGATAATGACAATGACTCC 960
LeTGlnValTyrGlyGlTGlyGlTArgAsnGlyLeTTyrAlaAspAsnAspAsnAspSer
961 ACCTTCACAGGCTTTCTTCTCTACCATGACACCAACCTCGAGCACCACCACCACCACCAC 1020
ThrPheThrGlyPheLeTLeTTyrHisAspThrAsnLeuGluHisHisHisHisHisHis
1021 TGA 1023
*
Claims (4)
1. fusion rotein, it is characterized in that fusion rotein that the gene of soluble tumor necrosis factor receptor II and " adiponectin " bulb gene are produced through gene recombination, expression, i.e. solubility Tumor Necrosis Factor Receptors II-" adiponectin " bulb fusion rotein.
2. fusion rotein according to claim 1 is characterized in that the C that 6His is introduced fusion rotein holds.
3. one kind contains claim 1 or 2 described Expression of Fusion Protein carriers.
4, a kind of engineering strain that transforms the described expression vector of claim 3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005101004689A CN1309740C (en) | 2005-10-20 | 2005-10-20 | Soluble tumour necrosis factor receptor II- |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005101004689A CN1309740C (en) | 2005-10-20 | 2005-10-20 | Soluble tumour necrosis factor receptor II- |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1752108A CN1752108A (en) | 2006-03-29 |
| CN1309740C true CN1309740C (en) | 2007-04-11 |
Family
ID=36679120
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2005101004689A Active CN1309740C (en) | 2005-10-20 | 2005-10-20 | Soluble tumour necrosis factor receptor II- |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1309740C (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101906156B (en) * | 2010-02-09 | 2012-10-10 | 中国药科大学 | Structures and application of bifunctional protein and derivatives of bifunctional protein |
| CN102690353B (en) * | 2011-03-25 | 2014-05-14 | 温州医学院 | Method for rapid screening of modified tumor necrosis factor receptor II-adiponectin globular-site fusion protein and application thereof |
| CN115073607A (en) * | 2021-03-12 | 2022-09-20 | 上海康岱生物医药技术股份有限公司 | Fusion protein of TNFR2 and BAFF receptor |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1417334A (en) * | 2001-10-31 | 2003-05-14 | 上海中信国健药业有限公司 | Recombinant gene of soluble part in tumor necrosis factor acceptor and its fusion gene and product |
| CN1502632A (en) * | 2002-11-26 | 2004-06-09 | 广州绿阳生物工程有限公司 | Novel TNFR-FC fusion protein |
| WO2004113387A2 (en) * | 2003-06-24 | 2004-12-29 | Merck Patent Gmbh | Tumour necrosis factor receptor molecules with reduced immunogenicity |
| CN1565631A (en) * | 2003-06-27 | 2005-01-19 | 上海中信国健药业有限公司 | Usage of fused protein of TNF receptor and globin in acute lung injury treating medicine |
-
2005
- 2005-10-20 CN CNB2005101004689A patent/CN1309740C/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1417334A (en) * | 2001-10-31 | 2003-05-14 | 上海中信国健药业有限公司 | Recombinant gene of soluble part in tumor necrosis factor acceptor and its fusion gene and product |
| CN1502632A (en) * | 2002-11-26 | 2004-06-09 | 广州绿阳生物工程有限公司 | Novel TNFR-FC fusion protein |
| WO2004113387A2 (en) * | 2003-06-24 | 2004-12-29 | Merck Patent Gmbh | Tumour necrosis factor receptor molecules with reduced immunogenicity |
| CN1565631A (en) * | 2003-06-27 | 2005-01-19 | 上海中信国健药业有限公司 | Usage of fused protein of TNF receptor and globin in acute lung injury treating medicine |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1752108A (en) | 2006-03-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP3065763B2 (en) | Use of il-22 dimer in manufacture of a medicament for intravenous administration | |
| CN1244872A (en) | Glucagon-like peptide-2 analogs | |
| CN1311687A (en) | Glucagon-like peptide-1 improves beta-cell response to glucose in subjects with impaired glucose tolerance | |
| CN1341122A (en) | Covalently bridged insulin dimers | |
| CN106220724A (en) | Human fibroblastic growth factor 21 recombiant protein and its preparation method and application | |
| CN1320117C (en) | Adiponectin-Glucagon-like peptide-1-like peptide recombinant protein expression vector and construction | |
| CN1309740C (en) | Soluble tumour necrosis factor receptor II- | |
| JP2022500040A (en) | Protein for the treatment of inflammatory diseases | |
| CN105705160A (en) | Use of il-22 dimers in manufacture of medicaments for treating pancreatitis | |
| CN1817904A (en) | Gerobriecin pancrease glucagon peptidel (SGLP-1), its preparation and use | |
| CN1679918A (en) | Medical use of interleukin-22 | |
| CN113105561A (en) | Preparation method and application of double-target fusion protein | |
| CN1325310A (en) | Remedies for bone metabolic errors | |
| EP3800196A1 (en) | Peptide for treating rheumatoid arthritis and use thereof | |
| CN102191207A (en) | Gene engineering bacterium of expression of soluble FGF-21 and construction method and application thereof | |
| CN100336827C (en) | South China sea conus littertus linnaeus nervotoxin and its coding sequence and use | |
| CN1145808A (en) | Human growth horomne agent for adults | |
| Omeka et al. | Characterization of four C1q/TNF-related proteins (CTRPs) from red-lip mullet (Liza haematocheila) and their transcriptional modulation in response to bacterial and pathogen-associated molecular pattern stimuli | |
| CN103539834B (en) | Chemotactic element derived peptide and expressing gene thereof and application | |
| CN1927888B (en) | Recombination albumen of GLP-1 and analogue thereof and human lysozyme fusion and application thereof | |
| CN1375500A (en) | Thymic peptide fusion protein as one new interferon and its prepn. and use | |
| CN1232536C (en) | Human dry cell factor macrophage clong irritant factor bifunction protein and its preparation | |
| CN1244584A (en) | Chemotarix factor with immunocyte chemotaxis and hemopoinesis stimulating activity | |
| CN1294987C (en) | Protein having antitumor function, and high performance expression in vitro | |
| CN1651464A (en) | Chain antibiotics / granul cell-macrophage colong stimulating factor fusion protein |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C41 | Transfer of patent application or patent right or utility model | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20090206 Address after: Dasan Zhejiang city of Wenzhou Province Higher Education Park Patentee after: Wenzhou Medical College Address before: Study on 13 biological drug gang Lu Guangzhou province Guangdong City Chigang pomegranate Institute Patentee before: Gao Jimin |
|
| ASS | Succession or assignment of patent right |
Owner name: WENZHOU MEDICAL COLLEGE Free format text: FORMER OWNER: GAO JIMIN Effective date: 20090206 |