CN1927888B - Recombination albumen of GLP-1 and analogue thereof and human lysozyme fusion and application thereof - Google Patents
Recombination albumen of GLP-1 and analogue thereof and human lysozyme fusion and application thereof Download PDFInfo
- Publication number
- CN1927888B CN1927888B CN2006100479632A CN200610047963A CN1927888B CN 1927888 B CN1927888 B CN 1927888B CN 2006100479632 A CN2006100479632 A CN 2006100479632A CN 200610047963 A CN200610047963 A CN 200610047963A CN 1927888 B CN1927888 B CN 1927888B
- Authority
- CN
- China
- Prior art keywords
- human lysozyme
- hlz
- blood sugar
- sugar reducing
- group
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Abstract
The present invention relates to recombinant protein of hypoglycemic peptide and human lysozyme and its use. The hypoglycemic peptide in the fusion protein is GLP-1 or its analog and has amino acid sequence of one of those shown in SEQ ID Nos. 1-5; and the human lysozyme has amino acid sequence as shown in SEQ ID No. 6. The hypoglycemic peptide and the human lysozyme are connected in one of the following four connection modes: hypoglycemic peptide-connecting peptide-human lysozyme, hypoglycemic peptide-human lysozyme, human lysozyme-connecting peptide-hypoglycemic peptide and human lysozyme-hypoglycemic peptide. The fusion protein has the hypoglycemic activity of GLP-1 maintained, prolonged half life, as well as anti-infective activity and AGE level-lowering function of human lysozyme, and may be used in preparing medicine for treating diabetes and diabetes complication.
Description
Technical field
The present invention relates to recombinant protein and in the application of pharmacy field, relate in particular to blood sugar reducing peptide such as GLP-1 and analogue thereof and human lysozyme and merge the recombinant protein that express the back at gene level, and the application of such fusion rotein in non insulin dependent diabetes and complication treatment thereof.
Background technology
Glucagon-like peptide I (glucagon-like peptide-1, GLP-1) be a kind of enteron aisle hormone of human body self excretory, it is a kind of 30 the amino acid whose small peptides that produced after the enteron aisle followed by action of proteolytic enzymes by Proglucagon (Proglucagon) molecule.This peptide stimulates insulin secretion by the special receptors bind with the beta Cell of islet surface.The intravital GLP-1 of people has two kinds of forms, and a kind of is GLP-1 (7-36) NH
2, by the polypeptide that 30 amino-acid residues are formed, its C end has been amidation; Another kind is GLP-1 (7-37), by the polypeptide that 31 amino-acid residues are formed, and GLP-1 (7-36) NH
2With GLP-1 (7-37) identical promoting insulin secretion is arranged.
GLP-1 is a kind of very ideal Remedies for diabetes.Can obviously reduce patient at the blood sugar of using after the meal, stimulate the generation of Regular Insulin, can also play certain fat-reducing effect simultaneously, and can not cause hypoglycemia (Drucker DJ, Diabetes.1998 Feb; 47 (2): 159-69), in addition, GLP-1 also has certain short pancreas refresh function (Drucker DJ, Endocrinology.2003 Dec; 144 (12): yet 5145-8), the various countries scholar also finds under study for action, because GLP-1 can be degraded by intravital dipeptidyl peptidase (DPP IV) very soon, and from kidney, be excreted, to such an extent as to its transformation period in vivo is very short, have only 90 to 120 seconds, limited of the exploitation of this peptide to a great extent as Remedies for diabetes.The research of the GLP-1 analogue that therefore, activity is stronger, stability is higher is the emphasis of present various countries scholar's research.On the problem that solves the transformation period weak point, it is recombinant expressed that the relatively large albumen of small peptide and other molecular weight merges the back, is a kind of efficient ways to increase the small peptide transformation period in vivo.After GLP-1 and analogue thereof and albumin or sphaeroprotein were merged, GLP-1 and analogue thereof the transformation period in vivo just can prolong tens times of (Chuang VT, Pharm Res.2002 19:569-577; Baggio LL, Diabetes.2004 Sep; 53 (9): 2492-500).
Aspect diabetic complication, continuing under the hyperglycemia state glucose can be under non-enzyme condition and lipid and protein binding, forms terminal glycosylation dead end product (AGEs), and kidney and vascular system are caused damage.The infringement mechanism of AGEs comprises: (1) makes crosslinked the increasing of glomerular basement membrane (GBM) composition, causes GBM to thicken and aperture selectivity and the forfeiture of electric charge selectivity, and produces proteinuria; (2) vascular stroma of saccharification can be caught by AGEs and be oozed out EV solubility plasma proteins such as LDL, and getting rich contains cholesterol LDL in local accumulation, promotes arteriosclerosis; (3) make aldose reductase (AR) saccharification, its active increasing participates in the activation of polyol pathway; Then remove after the LDL saccharification and reduce, LDL concentration raises in the hyperamization slurry, infiltrates vessel wall, promotes vascular complication to take place; (4) combine activating cells by specific receptors (RAGE) on AGEs and the cell, scavenger cell especially, cytokine that subsequent secretion is a large amount of and cell medium such as IL-1, TNF1, TGFb, PDGF etc. cause tissue injury.In addition, AGEs increases with also causing cellular oxidation after RAGE combines, and produces a large amount of oxyradicals, and activates NFkB, and the latter can induce ET-1 and the vascular cell adhesion factor-1 expression such as (VCAM-1).In addition, the albumin that Amadori modifies on the mesentery of vitro culture can not only be induced TGFb1 gene and protein expression, also can raise TGFb II receptor function, thereby promotes the expression of extracellular matrix protein.
N,O-Diacetylmuramidase is the important component part of non-special defence in the human body, and the intravital N,O-Diacetylmuramidase level of most type ii diabetes patients is lower, and this may be the major reason that the diabetic subject easily infects.On the human lysozyme molecule one comprise 18 amino acid whose structural domains can with the AGEs combination, alleviate renal impairment and the vascular lesion of AGEs to the diabetic subject.Its mechanism of action is: (1) combines after-acceleration AGEs and discharges in body with AGEs; (2) suppress scavenger cell and mesangial cell and discharge inflammatory factor; (3) improve diabetic subject's proteinuria; (4) promote the removing of scavenger cell to AGEs.(Zheng?F，Mol?Med.2001Nov；7(11)：737-47.)
Can infer that based on above-mentioned theory and practice GLP-1 and human lysozyme are built together is fusion rotein, this fusion rotein can be used for the treatment of diabetes and complication thereof with having the dual biologic activity of GLP-1 and human lysozyme simultaneously so; And can prolong the GLP-1 transformation period in vivo.
The patent No. is to relate to " fusion rotein of human lysozyme/GLP-1 " in the disclosed content of United States Patent (USP) " Fusion proteins incorporating lysozyme " of US 7045677; But its objective is and obtain the GLP-1 monomer: the GLP-1 small peptide very easily is degraded in vivo, and can't produce by the normal lactic secretion process, just can produce after forming fusion rotein with human lysozyme by transgenic animal, and by lactation; Simultaneously, contained protein major part is acid in the milk, this makes the human lysozyme fusion protein of alkalescence be easy to be separated, therefore, this patent inventor changes the antigen-4 fusion protein gene of GLP-1/ N,O-Diacetylmuramidase over to animal, and the render transgenic animal produces fusion rotein, and along with lactation, from milk, extract this fusion rotein then, again GLP-1 and N,O-Diacetylmuramidase cracking are opened then, extract at last and obtain the GLP-1 small peptide.This patent inventor does not predict the dual biological activity of human lysozyme/GLP-1 fusion rotein itself, and " fusion rotein of human lysozyme/GLP-1 " that produced at least also comprises a restriction enzyme site between human lysozyme and GLP-1 except comprising human lysozyme, GLP-1 and connection peptides sequence.
Summary of the invention
The object of the present invention is to provide a kind of deficiency that can overcome transformation period weak point in the blood sugar reducing peptide bodies such as GLP-1 and analogue thereof, and the fusion rotein that has blood sugar reducing peptide and the dual biologic activity of N,O-Diacetylmuramidase simultaneously.This fusion rotein is lowering blood glucose effectively, can improve diabetic subject's anti-infection ability, the infringement that alleviates its kidney and blood vessel again.
On the basis of comprehensive existing achievement in research, the present invention is by a large amount of experiment screenings, selected totally 5 kinds of small peptides that comprise GLP-1 and analogue thereof with hypoglycemic activity, be respectively blood sugar reducing peptide 1～5, express after the coding gene of these 5 kinds of blood sugar reducing peptide aminoacid sequences and human lysozyme gene merged, separation and purification obtains Target Fusion albumen.
Fusion rotein of the present invention is to merge the recombinant protein that express the back by blood sugar reducing peptide and human lysozyme at gene level;
Wherein said blood sugar reducing peptide is GLP-1 (7-36) or its analogue, its aminoacid sequence is a kind of in the aminoacid sequence shown in SEQ IDNO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 and/or the SEQ ID NO.5, and their aminoacid sequence is respectively:
Blood sugar reducing peptide 1:
His?Gly?Glu?Gly?Thr?Phe?Thr?Ser?Asp?Leu?Ser?Lys?Gln?Met?Glu?Glu?Glu?Ala?Val?Arg
Leu?Phe?Ile?Glu?Trp?Leu?Lys?Asn?Gly?Gly?Pro?Ser?Ser?Gly?Ala?Pro?Pro?Pro?Ser
(SEQ?ID?NO.1)
Blood sugar reducing peptide 2:
His?Ala?Glu?Gly?Thr?Phe?Thr?Ser?Asp?Val?Ser?Ser?Tyr?Leu?Glu?Gly?Gln?Ala?Ala?Lys
Glu?Phe?Ile?Ala?Trp?Leu?Val?Lys?Gly?Arg
(SEQ?ID?NO.2)
Blood sugar reducing peptide 3:
His?Gly?Glu?Gly?Thr?Phe?Thr?Ser?Asp?Val?Ser?Ser?Tyr?Leu?Glu?Gly?Gln?Ala?Ala?Lys
Glu?Phe?Ile?Ala?Trp?Leu?Val?Lys?Gly?Arg
(SEQ?ID?NO.3)
Blood sugar reducing peptide 4:
His?Gly?Glu?Gly?Thr?Phe?Thr?Ser?Asp?Val?Ser?Ser?Tyr?Leu?Glu?Gly?Gln?Ala?Ala?Lys
Glu?Phe?Ile?Ala?Trp?Leu
(SEQ?ID?NO.4)
Blood sugar reducing peptide 5:
His?Gly?Glu?Gly?Thr?Phe?Thr?Ser?Asp?Val?Ser?Ser?Tyr?Leu?Glu?Gly?Gln?Ala?Ala?Lys
Glu?Phe?Ile?Ala?Trp?Leu?Val?Lys?Gly?Arg?Thr?Ser
(SEQ?ID?NO.5)
The aminoacid sequence of described human lysozyme is shown in SEQ ID NO.6, that is:
Lys?Val?Phe?Glu?Arg?Cys?Glu?Leu?Ala?Arg?Thr?Leu?Lys?Arg?Leu?Gly?Met?Asp?Gly
Tyr?Arg?Gly?Met?Ser?Leu?Ala?Asn?Trp?Met?Cys?Leu?Ala?Lys?Trp?Glu?Ser?Gly?Tyr?Asn
Thr?Arg?Ala?Thr?Asn?Tyr?Asn?Ala?Gly?Asp?Arg?Ser?Thr?Asp?Tyr?Gly?Ile?Phe?Gln?Ile
Asn?Ser?Arg?Tyr?Trp?Cys?Asn?Asp?Gly?Lys?Thr?Pro?Gly?Ala?Val?Asn?Ala?Cys?His?Leu
Ser?Cys?Ser?Ala?Leu?Leu?Gln?Asp?Asn?Ile?Ala?Asp?Ala?Val?Ala?Cys?Ala?Lys?Arg?Val
Val?Arg?Asp?Pro?Gln?Gly?Ile?Arg?Ala?Trp?Val?Ala?Trp?Arg?Asn?Arg?Cys?Gln?Asn?Arg
Asp?Val?Arg?Gln?Tyr?Val?Gln?Gly?Cys?Gly?Val
(SEQ?ID?NO.6)
Blood sugar reducing peptide and human lysozyme are by a kind of connection the in following four kinds of modes:
1. blood sugar reducing peptide-connection peptides-human lysozyme,
2. blood sugar reducing peptide-human lysozyme,
3. human lysozyme-connection peptides-blood sugar reducing peptide,
4. human lysozyme-blood sugar reducing peptide;
Connection peptides is one and flexibly connects son, is used to connect two albumen that need merge, and its effect is in order to make two albumen fold, can not influence each other when forming sterie configuration, to keep biologic activity separately.Generally, alternately will possessing of successive glycine (G) or glycine and Serine (S) flexibly connects sub function.The amino acid no of connection peptides is generally in 20, but the array mode of G and S fixed pattern not at present.The connection peptides that is adopted in the embodiments of the invention is the straight chain small peptide that is rich in glycine (G) and Serine (S) a: GGSGGS, but undoubtedly, any small peptide with above-mentioned linkage function can and can not influence enforcement of the present invention as the use of the connection peptides among the present invention.
The fusion rotein of GLP-1 of the present invention and analogue thereof and human lysozyme obtains by gene recombination technology, concrete technical scheme according to blood sugar reducing peptide in the Target Fusion albumen with the different of human lysozyme mode of connection difference to some extent, specific embodiments of the invention are described in detail the technical scheme of 5 kinds of different blood sugar reducing peptides with 4 kinds of different mode of connection and human lysozyme construction of fusion protein.
The present invention adopts SDS-PAGE electrophoresis and western-blot that above-mentioned 20 kinds of fusion roteins are identified: the SDS-PAGE electrophoresis adopts the acrylamide gel of 15% concentration, Xylene Brilliant Cyanine G R-250 dyeing, after the scanning of gel imaging instrument, obtain the result, the molecular weight that proves each fusion rotein all with estimate big or small consistent, be about 18KD; On this basis, adopt anti-human lysozyme monoclonal antibody that the albumen that is transferred on the nitrocellulose filter is carried out Western-blot, first antibody is with anti-human lysozyme monoclonal antibody, the two anti-rabbit anti-mouse antibodies that adopt alkali phosphatase enzyme mark, the fluorogenic substrate colour developing, after X-ray sheet exposure is developed, obtain the result again, confirmed that further these fusion roteins are the fusion rotein of N,O-Diacetylmuramidase.
In addition, the present invention also to having carried out the check of biologic activity according to 20 kinds of fusion roteins that aforesaid method obtained, comprising totally:
(1) is animal model with the positive contrast of GLP-1, GK type ii diabetes rat, detects the hypoglycemic activity and the time length thereof of fusion rotein; Experimental result proof fusion rotein has similar hypoglycemic activity to GLP-1, and its hypoglycemic activity prolongs 3 days approximately than GLP-1.
(2) the rat Langerhans islet β cell with the positive contrast of GLP-1, vitro culture is an experimental model, detects fusion rotein stimulation in rats beta Cell of islet excreting insulin and stimulates the outgrowth situation of beta Cell of islet; Experimental result proof fusion rotein is the same with GLP-1, has the beta Cell of islet excreting insulin of stimulation and the outgrowth effect of stimulation in rats beta Cell of islet.
(3) be experimental model with the positive contrast of GLP-1, normal Kunming mouse, detect fusion rotein glucose tolerance effect; Experimental result proof fusion rotein has the better glucose tolerance than GLP-1.
(4) the NOD mouse that infects with the positive contrast of human lysozyme, golden yellow Portugal coccus is a model, detects the anti-infectious function of fusion rotein; The same effect of experimental result proof fusion rotein with anti-NOD mouse infection with the positive control human lysozyme.
(5) be model with the positive contrast of human lysozyme, NOD mouse, estimate fusion rotein removing AGEs and improve the urine protein effect by measuring blood and urine AGEs value and albumin/creatinine ratio; Experimental result proves the same discharge that has AGEs level in the reduction NOD mouse blood, promotes AGEs in the urine with the human lysozyme positive control of fusion rotein, alleviates albuminuretic effect.
According to The above results as can be known, the fusion rotein of GLP-1 and analogue thereof and human lysozyme has kept the hypoglycemic activity of GLP-1 class blood sugar reducing peptide, solved small peptides such as GLP-1 and analogue thereof short problem of transformation period in vivo, also have the anti-infective of human lysozyme and reduce the AGEs level, promote AGEs in the urine discharge, alleviate albuminuretic effect, help alleviating owing to the AGEs level increases many diabetic complication symptoms of bringing, therefore, fusion rotein of the present invention can be used for preparing the medicine of treatment diabetes and control diabetic complication.
Description of drawings
Accompanying drawing 2 width of cloth of the present invention, they are respectively:
Fig. 1: 5 kinds of different blood sugar reducing peptides make up the SDS-PAGE electrophoresis result figure of 20 kinds of fusion roteins that form with 4 kinds of different mode of connection and human lysozyme;
Wherein, sample 1 is standard molecular weight Marks; Sample 2～21 is respectively P1-L-hlz, P1-hlz, hlz-L-P1, hlz-P1, P4-L-hlz, P4-hlz, hlz-L-P4, hlz-P4, P2-L-hlz, P2-hlz, hlz-L-P2, hlz-P2, P3-L-hlz, P3-hlz, hlz-L-P3, hlz-P3, P5-L-hlz, P5-hlz, hlz-L-P5 and hlz-P5;
Fig. 2: the Western-blot that 5 kinds of different blood sugar reducing peptides make up 20 kinds of fusion roteins that form with 4 kinds of different mode of connection and human lysozyme is figure as a result;
Wherein, sample 1 is standard molecular weight Marks; Sample 2～21 is respectively P4-L-hlz, P4-hlz, hlz-L-P4, hlz-P4, P2-L-hlz, P2-hlz, hlz-L-P2, hlz-P2, P3-L-hlz, P3-hlz, hlz-L-P3, hlz-P3, P5-L-hlz, P5-hlz, hlz-L-P5, hlz-P5, P1-L-hlz, P1-hlz, hlz-L-P1, hlz-P1.
Fig. 1 is a Figure of abstract of the present invention.
Need to prove: in this specification sheets, represent blood sugar reducing peptide 1～5 respectively successively with P1～P5; L represents connection peptides GGSGGS, hlz representative N,O-Diacetylmuramidase.
For example: P1-L-hlz promptly represents to have the fusion rotein of " blood sugar reducing peptide 1-GGSGGS-human lysozyme " aminoacid sequence, that is the polypeptide that is linked in sequence and is formed by sequence three shown in sequence shown in the SEQ ID NO.1, connection peptides GGSGGS, the SEQ ID NO.6.
Embodiment
Below in conjunction with embodiment content of the present invention is described further.
Employed connection peptides is that GGSGGS, carrier are that the host bacterium of pPIC9k, expression is a pichia spp in following examples.Wherein, the pPIC9k carrier is a kind of commercial universal support, available from Invitrogen company; Described Pichia yeast is the host bacterium supporting with the pPIC9K carrier, also is available from Invitrogen company.To selecting of above-mentioned connection peptides, carrier and expressive host, should not be considered as any type of restriction of the present invention only in order more clearly to illustrate content of the present invention.
For the convenience of describing, if no special instructions, " fusion rotein " in this specification sheets refers to the recombinant protein that GLP-1 and analogue and human lysozyme thereof merge; Blood sugar reducing peptide 1～5 refers to respectively that successively aminoacid sequence is the blood sugar reducing peptide of SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5.
The toolenzyme that gene is synthetic and carrier construction is used in following examples, archaeal dna polymerase, dNTP equimolecular biological reagent are all available from the precious biotech firm (TaKaRa) in Dalian, and the primer of amplification gene also is synthetic by the precious biotech firm in Dalian.
Embodiment 1
In pichia spp, express the method for " blood sugar reducing peptide 1-connection peptides-human lysozyme " fusion rotein, comprise following concrete steps:
(1) obtains the gene of coding " blood sugar reducing peptide 1-GGSGGS " sequence
1. synthetic primer EX-F1 and EX-R1
EX-F?1：5’tactcgagaaaagacatggtgaaggaacatttaccagtgacttgtcaaaacagatggaagaggaggcagtgcgg?3’(SEQ?ID?NO.7)
EX-R?1：5’atggatccacctgagccacccgatggcggaggtgccccgctacttggtcctccgttcttaagccactcaataaataaccgcactgcctcctcttcc?3’(SEQ?ID?NO.8)
2. after annealing, extend according to following reaction conditions, above-mentioned two kinds of primers obtain the gene of coding " blood sugar reducing peptide 1-GGSGGS " sequence
Reaction system cumulative volume 50 μ l wherein contain dNTP 4 μ l (4 kinds of nucleotide concentrations respectively are 2.5mM), each 1 μ l of above-mentioned two kinds of primers of 25 μ M, Ex Taq archaeal dna polymerase 0.3 μ l (containing 1.5U), 10x reaction buffer 5 μ l, water 39 μ l.Annealing, the cycling condition that extends are: enter following circulation after 94 ℃ of pre-sex change in 3 minutes: 94 ℃ 10 seconds → 55 ℃ 10 seconds → 72 ℃ 20 seconds, 10 circulations.Reaction product reclaims after 1.5% agarose electrophoresis.
5 ' end of the gene of resulting coding " blood sugar reducing peptide 1-GGSGGS " sequence comprises the base sequence of Xho I restriction enzyme site and alpha factor signal peptide end, i.e. tactcgagaaaaga; 3 ' end comprises the gene of peptide GGSGGS and BamH I restriction enzyme site in succession of encoding.
(2) gene of acquisition coding human lysozyme
The primer hly pf1 and the hly pr1 of 1. synthetic amplification human lysozyme gene
hly?pf1：5’atgaattcggatccaaggtctttgaaaggtgtgag?3’；(SEQ?ID?NO.14
hly?pr1：5’atgcggccgcttacactccacaaccttgaacatactg?3’；(SEQ?ID?NO.15)
5 ' the end of upstream primer hly pf1 has been introduced EcoR I restriction enzyme site and BamH I restriction enzyme site.Downstream primer hly pr1 5 ' end is introduced Not I restriction endonuclease sites;
2. the acquisition of human lysozyme gene
Use the pcr amplification human lysozyme gene with primer hly pf1 and hly pr1, human lysozyme gene adopts the RT-PCR method to obtain from human lymphocyte by the technician of our company and is cloned in (the pDM18 T carrier of TaKaRa company) in the T carrier, and turns out to be the cDNA of human lysozyme through order-checking.The reaction conditions of PCR is: reaction cumulative volume 50 μ l wherein contain the primer hly pf1 of dNTP 4 μ l (4 kinds of nucleotide concentration concentration respectively are 2.5mM), 25 μ M and each 1 μ l of primer hly pr1, Ex Taq archaeal dna polymerase 0.3 μ l (containing 1.5U), 10x reaction buffer 5 μ l, the T vector plasmid DNA 1 μ l that contains Human Lysozyme cDNA, water 38 μ l.Annealing, the cycling condition that extends are: enter following circulation after 94 ℃ of pre-sex change in 3 minutes, 94 ℃ 20 seconds → 55 ℃ 20 seconds → 72 ℃ 30 seconds, 25 circulations.
Amplified production reclaims after 1.0% agarose electrophoresis.So just obtained 5 ' end band EcoR I restriction enzyme site and BamH I restriction enzyme site, the human lysozyme gene sequence of 3 ' end band Not I restriction enzyme site.
(3) structure of blood sugar reducing peptide 1-GGSGGS-human lysozyme fusion gene carrier
1. human lysozyme gene is cloned into the pPIC9K carrier:
With the human lysozyme gene of step (2) gained with EcoR I and Not I double digestion rear clone EcoR I and the Not I site to the Yeast expression carrier multiple clone site, this carrier is at pPIC9K carrier (a kind of commercial universal support, available from Invitrogen company) the basis on carrier after one in original BamH I restriction enzyme site of carrier and original two the Xho I restriction enzyme sites of carrier (alpha factor signal peptide beyond an Xho I restriction enzyme site) suddenlyd change, be that new carrier does not contain BamH I restriction enzyme site, only contain an Xho I restriction enzyme site (being positioned at alpha factor signal peptide).The preliminary positive colony of confirming carries out sequencing, confirms that human lysozyme gene is the downstream that is cloned in the carrier alpha factor signal peptide.
2. blood sugar reducing peptide 1-GGSGGS gene clone to human lysozyme-pPIC9K carrier contains pPIC9K carrier the Xho I and the BamH I double digestion of human lysozyme, be connected with the blood sugar reducing peptide 1-GGSGGS gene of same double digestion, transform the JM109 intestinal bacteria, obtained blood sugar reducing peptide 1-GGSGGS-human lysozyme fusion gene cloning in the plasmid of Yeast expression carrier, sequencing adds their confirmation.
(4) antigen-4 fusion protein gene transforms Pichia yeast
The positive colony of confirming extracts plasmid, after Sal I enzyme is cut into linearity, adopts the method for electroporation to transform the GS115 Pichia yeast, and specific operation process is with reference to report (the Wu S.Biotechniques.2004 of Wu S etc.
Jan; 36:152-4), transformed bacteria is primary dcreening operation on the MD flat board, and then carries out the G418 resistance screening, therefrom screens the Yeast engineering bacteria of anti-4mg/ml G418.
(5) fermentation expression
The Yeast engineering bacteria that step (4) screening obtains adopts ordinary method to carry out fermentation expression under methanol induction.Fermentation is carried out in Germany ' Bei Lang ' 30-L fermentor tank, and fermented liquid calculates that through protein electrophoresis scanning expression amount is about 1mg/ml (1000mg/l).Glycerine stream adds the method that adds with methyl alcohol stream and carries out (Zhang W.J Ind Microbiol Biotechnol.2003 Apr with reference to the report of Zhang W etc. in the fermentation; 30 (4): 210-5.).
(6) product extracts purifying
Comprise that fermented liquid is centrifugal, ultrafiltration, ion-exchange chromatography.The method of the concentrated employing ultrafiltration of fermented liquid, ultra-filtration membrane are the 5K film of Millipore company; Spissated fermented liquid adopts the CMFF ion exchange chromatography to carry out purifying behind G25 gel-filtration desalination.G25 and CMFF gel are also all available from Millipore company.Product conduct behind the purifying is the biological activity assay fusion rotein subsequently.
Embodiment 2
Express the method for " blood sugar reducing peptide 2-connection peptides-human lysozyme " fusion rotein in pichia spp, the employed primer, all the other steps are all identical with embodiment 1 described technical scheme steps in step (1).
In the present embodiment for obtain the coding " blood sugar reducing peptide 2-GGSGGS " sequence the primer that gene adopted be G-A-F1 and G-R1:
G-A-F?1：5’tactcgagaaaagacatgctgaagggacctttaccagtgatgtaagttcttatttggaaggccaagctgcc?3’；(SEQIDNO.9)
G-R?1：5’atggatccacctgagccacctcggcctttcaccagccaagcaatgaattccttggcagcttggccttccaaataag?3’；(SEQIDNO.10)
Embodiment 3
Express the method for " blood sugar reducing peptide 3-connection peptides-human lysozyme " fusion rotein in pichia spp, the employed primer, all the other steps are all identical with embodiment 1 described technical scheme steps in step (1).
In the present embodiment for obtain the coding " blood sugar reducing peptide 3-GGSGGS " sequence the primer that gene adopted be G-G-F1 and G-R1:
G-G-F?1：5’tactcgagaaaagacatggtgaagggacctttaccagtgatgtaagttcttatttggaaggccaagctgcc?3’；(SEQ?ID?NO.11)
G-R1：5’atggatccacctgagccacctcggcctttcaccagccaagcaatgaattccttggcagcttggccttccaaataag?3’；(SEQ?ID?NO.10)
Embodiment 4
Express the method for " blood sugar reducing peptide 4-connection peptides-human lysozyme " fusion rotein in pichia spp, the employed primer, all the other steps are all identical with embodiment 1 described technical scheme steps in step (1).
In the present embodiment for obtain the coding " blood sugar reducing peptide 4-GGSGGS " sequence the primer that gene adopted be G-G-F1 and G-26-R1:
G-G-F?1：5’tactcgagaaaagacatggtgaagggacctttaccagtgatgtaagttcttatttggaaggccaagctgcc?3’(SEQ?IDNO.11)
G-26-R1：5’atggatccacctgagccacccagccaagcaatgaattccttggcagcttggccttccaaataag3’(SEQ?ID?NO.12)
Embodiment 5
Express the method for " blood sugar reducing peptide 5-connection peptides-human lysozyme " fusion rotein in pichia spp, the employed primer, all the other steps are all identical with embodiment 1 described technical scheme steps in step (1).
In the present embodiment for obtain the coding " blood sugar reducing peptide 5-GGSGGS " sequence the primer that gene adopted be G-G-F1 and G-TS-R1:
G-G-F?1：5’tactcgagaaaagacatggtgaagggacctttaccagtgatgtaagttcttatttggaaggccaagctgcc?3’(SEQ?IDNO.11)
G-TS-R1：5’atggatccacctgagccaccactagttcggcctttcaccagccaagcaatgaactccttggcagcttggcc?3’(SEQ?ID?NO.13)
Embodiment 6
In pichia spp, express the method for " blood sugar reducing peptide 1-human lysozyme " fusion rotein, may further comprise the steps:
(1) obtains the gene of blood sugar reducing peptide 1
1. synthetic primer EX-F1 and EX-R2
EX-F?1：5’tactcgagaaaagacatggtgaaggaacatttaccagtgacttgtcaaaacagatggaagaggaggcagtgcgg?3’(SEQ?ID?NO.7)
EX-R2：5’ctcacacctttcaaagaccttcgatggcggaggtgccccgctacttggtcctccgttcttaagccactcaataaataaccgcactgcctcctcttcc?3’(SEQ?ID?NO.16)
2. above-mentioned two kinds of primer annealings extend, and have obtained the gene of blood sugar reducing peptide 1 that 3 ' end comprises preceding 21 bases of human lysozyme gene.
The reaction conditions that annealing is extended is: cumulative volume 50 μ l wherein contain dNTP 4 μ l (concentration respectively is 2.5mM), each 1 μ l of above-mentioned two kinds of primers of 25 μ M, TaKaRa Ex Taq archaeal dna polymerase 0.3 μ l (containing 1.5U), 10x reaction buffer 5 μ l, water 39 μ l.Annealing, the cycling condition that extends are: enter following circulation after 94 ℃ of pre-sex change in 3 minutes, 94 ℃ 10 seconds → 55 ℃ 10 seconds → 72 ℃ 20 seconds, 10 circulations.Reaction product reclaims after 1.5% agarose electrophoresis.
(2) obtain human lysozyme gene
With hly pf2:5 ' aaggtctttgaaaggtgtgag3 ' (SEQ ID NO.17) and hly pr1:5 ' atgcggccgcttacactccacaaccttgaacatactg 3 ' (SEQ ID NO.15) is primer, with the human lysozyme gene is template, the amplification human lysozyme gene.The condition of PCR is: cumulative volume 50 μ l wherein contain the hly pf2 primer of dNTP 4 μ l (concentration respectively for 2.5mM), 25 μ M and each 1 μ l of hly pr1 primer, Ex Taq archaeal dna polymerase 0.3 μ l (containing 1.5U), 10x reaction buffer 5 μ l, the T vector plasmid DNA 1 μ l that contains Human Lysozyme cDNA, water 38 μ l.The amplification cycling condition be: enter following circulation after 94 ℃ of pre-sex change in 3 minutes, 94 ℃ 20 seconds → 55 ℃ 20 seconds → 72 ℃ 50 seconds, 30 circulations.Amplified production (people's bacteriolyze gene) reclaims after 1.0% agarose electrophoresis.
(3) obtain the fusion gene of blood sugar reducing peptide 1-human lysozyme
The blood sugar reducing peptide gene and the human lysozyme gene mixing back that make with above-mentioned steps (1), (2) are template, are primer with EX-F1 and hly pr1, adopt and merge PCR method, amplification acquisition Target Fusion gene.5 ' end of gene comprises Xho I restriction enzyme site and alpha factor signal peptide end sequence, and 3 ' end contains Not I restriction enzyme site.The method that merges PCR is: cumulative volume 50 μ l wherein contain the EX-F1 primer of dNTP 4 μ l (concentration respectively is 2.5mM), 25 μ M and each 1 μ l of hly pr1 primer, Ex Taq archaeal dna polymerase 0.3 μ l (containing 1.5U), 10x reaction buffer 5 μ l, above-mentioned blood sugar reducing peptide gene 1 μ l, human lysozyme gene 1 μ l, water 37 μ l.The amplification cycling condition be: enter following circulation after 94 ℃ of pre-sex change in 3 minutes, 94 ℃ 30 seconds → 55 ℃ 30 seconds → 72 ℃ 50 seconds, 30 circulations.Amplified production (blood sugar reducing peptide-people's bacteriolyze fusion gene) reclaims after 1.0% agarose electrophoresis.
(4) fusion gene cloning is to Yeast expression carrier and fermentation expression and purifying
Use Xho I and Not I double digestion rear clone to Yeast expression carrier the Target Fusion gene that step (3) is obtained.The preliminary positive colony of confirming carries out sequencing, confirm that the Target Fusion gene is the downstream that is cloned in the carrier alpha factor signal peptide, transformed into escherichia coli, the positive colony that order-checking is confirmed extracts plasmid, after Sal I enzyme is cut into linearity, transform the GS115 Pichia yeast, do the G418 resistance screening again, obtain the Yeast engineering bacteria of anti-4mg/ml G418.Carry out the fermentation expression of Yeast engineering bacteria subsequently.Yeast engineering bacteria adopts ordinary method to carry out fermentation expression under methanol induction.Fermentation is carried out in Germany ' Bei Lang ' 30-L fermentor tank, and fermented liquid calculates that through protein electrophoresis scanning expression amount is about 1mg/ml (1000mg/l).Fermented liquid is used for the treatment experiment of diabetes model animal subsequently as medicine behind centrifugal, ultrafiltration, ion exchange column purifying.Above-mentioned carrier is described identical with embodiment 1 with host bacterium feature, method for transformation, fermentation and purification step.
Embodiment 7
Express the method for " blood sugar reducing peptide 2-human lysozyme " fusion rotein in pichia spp, the employed primer, all the other steps are all identical with embodiment 6 described technical scheme steps in step (1).
Be G-A-F1 and G-R2 in order to obtain the primer that blood sugar reducing peptide 2 genes are adopted in the present embodiment:
G-A-F?1：5’tactcgagaaaagacatgctgaagggacctttaccagtgatgtaagttcttatttggaaggccaagctgcc?3’；(SEQ?ID?NO.9)
G-R2：5’ctcacacctttcaaagacctttcggcctttcaccagccaagcaatgaattccttggcagcttggccttccaaataag?3’；(SEQ?ID?NO.18)
Accordingly, be G-A-F1 and hly pr1 for obtaining the employed primer of fusion gene in the step (3).
Embodiment 8
Express the method for " blood sugar reducing peptide 3-human lysozyme " fusion rotein in pichia spp, the employed primer, all the other steps are all identical with embodiment 6 described technical scheme steps in step (1).
Be G-G-F1 and G-R2 in order to obtain the primer that blood sugar reducing peptide 3 genes are adopted in the present embodiment:
G-G-F?1：5’tactcgagaaaagacatggtgaagggacctttaccagtgatgtaagttcttatttggaaggccaagctgcc?3’(SEQ?ID?NO.11)；
G-R2：5’ctcacacctttcaaagacctttcggcctttcaccagccaagcaatgaattccttggcagcttggccttccaaataag?3’(SEQ?ID?NO.18)；
Accordingly, be G-G-F1 and hly pr1 for obtaining the employed primer of fusion gene in the step (3).
Embodiment 9
Express the method for " blood sugar reducing peptide 4-human lysozyme " fusion rotein in pichia spp, the employed primer, all the other steps are all identical with embodiment 6 described technical scheme steps in step (1).
Be G-G-F1 and G-26-R2 in order to obtain the primer that blood sugar reducing peptide 4 genes are adopted in the present embodiment:
G-G-F?1：5’tactcgagaaaagacatggtgaagggacctttaccagtgatgtaagttcttatttggaaggccaagctgcc?3’(SEQ?ID?NO.11)；
G-26-R2：5’ctcacacctttcaaagaccttcagccaagcaatgaattccttggcagcttggccttccaaataag3’(SEQ?ID?NO.19)；
Accordingly, be G-G-F1 and hly pr1 for obtaining the employed primer of fusion gene in the step (3).
Embodiment 10
Express the method for " blood sugar reducing peptide 5-human lysozyme " fusion rotein in pichia spp, the employed primer, all the other steps are all identical with embodiment 6 described technical scheme steps in step (1).
Be G-G-F1 and G-TS-R2 in order to obtain the primer that blood sugar reducing peptide 5 genes are adopted in the present embodiment:
G-G-F?1：5’tactcgagaaaagacatggtgaagggacctttaccagtgatgtaagttcttatttggaaggccaagct?gcc?3’(SEQ?ID?NO.11)；
G-TS-R2：5’ctcacacctttcaaagacctt?actagttcggcctttcaccagccaagcaatgaactccttggcagcttggcc?3’(SEQ?ID?NO.20)；
Accordingly, be G-G-F1 and hly pr1 for obtaining the employed primer of fusion gene in the step (3).
Embodiment 11
In pichia spp, express the method for " human lysozyme-connection peptides-blood sugar reducing peptide 1 " fusion rotein, may further comprise the steps:
(1) obtain the gene of blood sugar reducing peptide 1, comprising:
1. synthetic primer EX-F2 and EX-R3
EX-F2：5’taggatcccatggtgaaggaacatttaccagtgacttgtcaaaacagatggaagaggaggcagtgcgg?3’(SEQ?ID?NO.21)；
EX-R3：5’atgcggccgcttacgatggcggaggtgccccgctacttggtcctccgttcttaagccactcaataaataaccgcactgcctcctcttcc?3’(SEQ?ID?NO.22)；
2. obtained the gene of blood sugar reducing peptide 1 after EX-F2 primer and EX-R3 primer annealing, the extension, 5 ' end of gene comprises BamH I restriction enzyme site, and 3 ' end comprises Not I restriction enzyme site.
The condition method of annealing, extension is described with step (1) among the embodiment 1.
(2) make up " human lysozyme-GGSGGS " gene, comprising:
1. synthetic primer hly pf3 and hly pr2:
hly?pf3：5’tactcgagaaaagaaaggtctttgaaaggtgtgag?3’(SEQ?ID?NO.28)；
hly?pr2：5’atgcggccgcatcggatccacctgagccacccactccacaaccttgaacatac3’(SEQ?ID?NO.29)；
2. 5 ' of upstream primer hly pf3 end has been introduced Xho I restriction enzyme site; 5 of downstream primer hly pr2, end is introduced BamH I and Not I restriction endonuclease sites and GGSGGS connection peptides sequence; With this a pair of primer amplification human lysozyme gene, obtained 5 ' end band Xho I restriction enzyme site, the human lysozyme gene sequence of 3 ' end band GGSGGS and BamH I and Not I restriction enzyme site.
(3) " human lysozyme-GGSGGS-blood sugar reducing peptide 1 " fusion gene obtaining and transforming;
Use Xho I and Not I double digestion rear clone to Yeast expression carrier the human lysozyme-GGSGGS gene that obtains in the above-mentioned steps (2), confirm that human lysozyme gene is the downstream that is cloned in the carrier alpha factor signal peptide.The carrier BamH I and the Not I double digestion that contain human lysozyme gene, be connected respectively with the incretin peptide gene that obtains in the same double digestion step (1), transformed into escherichia coli, obtained the plasmid of Target Fusion gene clone in Yeast expression carrier, sequencing adds their confirmation, and the positive colony of affirmation extracts plasmid, after Sal I enzyme is cut into linearity, transform the GS115 Pichia yeast, do the G418 resistance screening again, obtain the Yeast engineering bacteria of anti-4mg/ml G418.
(4) fermentation expression and product extract purifying
Yeast engineering bacteria adopts ordinary method to carry out fermentation expression under methanol induction.Fermentation is carried out in Germany ' Bei Lang ' 30-L fermentor tank, and fermented liquid calculates that through protein electrophoresis scanning expression amount is about 1mg/ml (1000mg/l).Fermented liquid is behind centrifugal, ultrafiltration, ion exchange column purifying, as biological activity assay experiment subsequently.
Carrier involved in the present embodiment is described identical with embodiment 1 with host bacterium feature, method for transformation, fermentation and purification step.
Embodiment 12
Express the method for " human lysozyme-connection peptides-blood sugar reducing peptide 2 " fusion rotein in pichia spp, the employed primer, all the other steps are all identical with embodiment 11 described technical scheme steps in step (1).
Be G-A-F2 and G-R3 in order to obtain the primer that blood sugar reducing peptide 2 genes are adopted in the present embodiment:
G-A-F2：5’taggatcccatgctgaagggacctttaccagtgatgtaagttcttatttggaaggccaagctgcc?3’(SEQ?ID?NO.23)；
G-R3：5’atgcggccgcttatcggcctttcaccagccaagcaatgaattccttggcagcttggccttccaaataag3’(SEQ?ID?NO.24)；
Embodiment 13
Express the method for " human lysozyme-connection peptides-blood sugar reducing peptide 3 " fusion rotein in pichia spp, the employed primer, all the other steps are all identical with embodiment 11 described technical scheme steps in step (1).
Be G-G-F2 and G-R3 in order to obtain the primer that blood sugar reducing peptide 3 genes are adopted in the present embodiment:
G-G-F2：5’taggatcccatggtgaagggacctttaccagtgatgtaagttcttatttggaaggccaagctgcc?3’(SEQ?ID?NO.25)；
G-R3：5’atgcggccgcttatcggcctttcaccagccaagcaatgaattccttggcagcttggccttccaaataag3’(SEQ?ID?NO.24)；
Embodiment 14
Express the method for " human lysozyme-connection peptides-blood sugar reducing peptide 4 " fusion rotein in pichia spp, the employed primer, all the other steps are all identical with embodiment 11 described technical scheme steps in step (1).
Be G-G-F2 and G-26-R3 in order to obtain the primer that blood sugar reducing peptide 4 genes are adopted in the present embodiment:
G-G-F2：5’taggatcccatggtgaagggacctttaccagtgatgtaagttcttatttggaaggccaagctgcc?3’(SEQ?ID?NO.25)；
G-26-R3：5’atgcggccgcttacagccaagcaatgaattccttggcagcttggccttccaaataag?3’(SEQ?ID?NO.26)；
Embodiment 15
Express the method for " human lysozyme-connection peptides-blood sugar reducing peptide 5 " fusion rotein in pichia spp, the employed primer, all the other steps are all identical with embodiment 11 described technical scheme steps in step (1).
Be G-G-F2 and G-TS-R3 in order to obtain the primer that blood sugar reducing peptide 5 genes are adopted in the present embodiment:
G-G-F2：5’taggatcccatggtgaagggacctttaccagtgatgtaagttcttatttggaaggccaagctgcc3’(SEQ?ID?NO.25)；
G-TS-R3：5’atgcggccgcttaactagttcggcctttcaccagccaagcaatgaactccttggcagcttggcc3’(SEQ?ID?NO.27)；
Embodiment 16
In pichia spp, express the method for " human lysozyme-blood sugar reducing peptide 1 " fusion rotein, comprise following concrete steps:
(1) obtain the gene of blood sugar reducing peptide, comprising:
1. synthetic primer EX-F3 and EX-R3
EX-F3：5’cagtatgttcaaggttgtggagtgcatggtgaaggaacatttaccagtgacttgtcaaaacagatggaagaggaggcagtgcgg3’(SEQ?ID?NO.30)；
EX-R3：5’atgcggccgcttacgatggcggaggtgccccgctacttggtcctccgttcttaagccactcaataaataaccgcactgcctcctcttcc?3’(SEQ?ID?NO.22)；
2. after above-mentioned two kinds of primer annealings, the extension, obtained the gene of blood sugar reducing peptide 1, and 5 ' end of gene comprises back 24 bases of human lysozyme gene.
The condition method of annealing, extension is described with step (1) among the embodiment 1.
(2) obtain human lysozyme gene, comprising:
1. synthetic primer hly pf3 and hly pr3
hly?pf3：5’tactcgagaaaagaaaggtctttgaaaggtgtgag?3’(SEQ?ID?NO.28)；
hly?pr3：5’cactccacaaccttgaacatac?3’(SEQ?ID?NO.31)；
2. above hly pf3 and hly pr3 are primer, and human lysozyme gene is a template, the pcr amplification human lysozyme gene.The reaction conditions of PCR is with described in embodiment 1 step (2).
(3) acquisition of fusion gene
The human lysozyme gene that blood sugar reducing peptide gene that step (1) is obtained and step (2) are obtained mixes the back for template, is primer with hly pf3 and EX-R3, and amplification obtains the fusion gene of human lysozyme-blood sugar reducing peptide 1.5 ' end of gene comprises Xho I restriction enzyme site and alpha factor signal peptide end sequence, and 3 ' end contains Not I restriction enzyme site.The pcr amplification condition is described with embodiment 6 steps (3).
(4) fusion gene transforms
Use Xho I and Not I double digestion rear clone to Yeast expression carrier the fusion gene that obtains in the step (3), the preliminary positive colony of confirming carries out sequencing, confirm that human lysozyme-blood sugar reducing peptide gene is the downstream that is cloned in the carrier alpha factor signal peptide, transformed into escherichia coli, the positive colony that order-checking is confirmed extracts plasmid, after the SalI enzyme is cut into linearity, transforms the GS115 Pichia yeast, do the G418 resistance screening again, obtain the Yeast engineering bacteria of anti-4mg/mlG418.
(5) the proteic extraction purifying of the fermentation expression of transformant and Target Fusion
Yeast engineering bacteria adopts ordinary method to carry out fermentation expression under methanol induction.Fermentation is carried out in Germany ' Bei Lang ' 30-L fermentor tank, and fermented liquid calculates that through protein electrophoresis scanning expression amount is about 1mg/ml (1000mg/l).Fermented liquid is behind centrifugal, ultrafiltration, ion exchange column purifying, as biological activity assay experiment subsequently.
Carrier involved in the present embodiment is described identical with embodiment 1 with host bacterium feature, method for transformation, fermentation and purification step.
Embodiment 17
Express the method for " human lysozyme-blood sugar reducing peptide 2 " fusion rotein in pichia spp, the employed primer, all the other steps are all identical with embodiment 16 described technical scheme steps in step (1).
Be G-A-F3 and G-R3 in order to obtain the primer that blood sugar reducing peptide 2 genes are adopted in the present embodiment:
G-A-F3：5’cagtatgttcaaggttgtggagtgcatgctgaagggacctttaccagtgatgtaagttcttatttggaaggccaagctgcc?3’(SEQ?ID?NO.32)；
G-R3：5’atgcggccgcttatcggcctttcaccagccaagcaatgaattccttggcagcttggccttccaaataag3’(SEQ?ID?NO.24)；
Accordingly, be hly pf3 and G-R3 for obtaining the employed primer of fusion gene in the step (3).
Embodiment 18
Express the method for " human lysozyme-blood sugar reducing peptide 3 " fusion rotein in pichia spp, the employed primer, all the other steps are all identical with embodiment 16 described technical scheme steps in step (1).
Be G-G-F3 and G-R3 in order to obtain the primer that blood sugar reducing peptide 3 genes are adopted in the present embodiment:
G-G-F3：5’cagtatgttcaaggttgtggagtgcatggtgaagggacctttaccagtgatgtaagttcttatttggaaggccaagctgcc?3’(SEQ?ID?NO.33)；
G-R3：5’atgcggccgcttatcggcctttcaccagccaagcaatgaattccttggcagcttggccttccaaataag3’(SEQ?ID?NO.24)；
Accordingly, be hly pf3 and G-R3 for obtaining the employed primer of fusion gene in the step (3).
Embodiment 19
Express the method for " human lysozyme-blood sugar reducing peptide 4 " fusion rotein in pichia spp, the employed primer, all the other steps are all identical with embodiment 16 described technical scheme steps in step (1).
Be G-G-F3 and G-26-R3 in order to obtain the primer that blood sugar reducing peptide 4 genes are adopted in the present embodiment:
G-G-F3：5’cagtatgttcaaggttgtggagtgcatggtgaagggacctttaccagtgatgtaagttcttatttggaaggccaagctgcc3’(SEQ?ID?NO.33)；
G-26-R3：5’atgcggccgcttacagccaagcaatgaattccttggcagcttggccttccaaataag3’(SEQ?ID?NO.26)；
Accordingly, be hly pf3 and G-26-R3 for obtaining the employed primer of fusion gene in the step (3).
Embodiment 20
Express the method for " human lysozyme-blood sugar reducing peptide 5 " fusion rotein in pichia spp, the employed primer, all the other steps are all identical with embodiment 16 described technical scheme steps in step (1).
Be G-G-F3 and G-TS-R3 in order to obtain the primer that blood sugar reducing peptide 5 genes are adopted in the present embodiment:
G-G-F3：5’cagtatgttcaaggttgtggagtgcatggtgaagggacctttaccagtgatgtaagttcttatttggaaggccaagctgcc3’(SEQ?ID?NO.33)；
G-TS-R3：5’atgcggccgcttaactagttcggcctttcaccagccaagcaatgaactccttggcagcttggcc3’(SEQ?ID?NO.27)；
Accordingly, be hly pf3 and G-TS-R3 for obtaining the employed primer of fusion gene in the step (3).
Embodiment 21
Recombinant protein to the foregoing description 1～20 resulting GLP and analogue and human lysozyme fusion carries out the SDS-PAGE electrophoresis detection: the acrylamide gel that adopts 15% concentration, Xylene Brilliant Cyanine G R-250 dyeing, the result as shown in Figure 1 after the scanning of gel imaging instrument, the molecular weight of these 20 kinds of fusion roteins is consistent as can be seen, all in the position of about 18KD size.
Embodiment 22
On SDS-PAGE electrophoresis detection result's basis, adopt anti-human lysozyme monoclonal antibody that the above-mentioned fusion rotein that is transferred on the nitrocellulose filter is carried out the western-blot detection, first antibody is with anti-human lysozyme monoclonal antibody, the two anti-rabbit anti-mouse antibodies that adopt alkali phosphatase enzyme mark, the fluorogenic substrate colour developing, the result is as shown in Figure 2 after X-ray sheet exposure is developed again, albumen in about 18KD position can play special immunity with anti-human lysozyme monoclonal antibody and combines as can be seen, confirmed that these fusion roteins are the fusion rotein of N,O-Diacetylmuramidase, this result has given further support and affirmation to the SDS-PAGE result of front.
Embodiment 23
The recombinant protein biological activity assay that GLP-1 and analogue thereof and human lysozyme merge.
One, the recombinant protein of blood sugar reducing peptide and human lysozyme fusion is used for the treatment experiment of GK type ii diabetes rat model as medicine
(every body weight is at 230g ± 10g), be divided into 22 groups, 10 every group for 220 of GK type ii diabetes rats; First group is the GLP-1 positive controls, and second group is physiology saline control group, the 3rd to the 22 group of experimental group that is respectively embodiment 1～20 described 20 kinds of fusion roteins.
All extract blood before 220 GK rat experiments, separation of serum, stored frozen is to be measured.Every rat abdominal cavity of each experimental group of fusion rotein is inoculated the fusion rotein of 15 μ g: in fusion rotein, blood sugar reducing peptide only accounts for the about 1/5 of whole fusion protein molecule amount, so also only be equivalent to the GLP-1 of 3 μ g in the fusion rotein of 15 μ g; Every rat abdominal cavity of GLP-1 positive controls is inoculated the GLP-1 of 3 μ g; The physiological saline of every rat abdominal cavity inoculation of control group 0.5ml; Every day injection once, inject 10 days continuously after, blood drawing immediately, separation of serum, stored frozen is to be measured.After the drug withdrawal 3 days, blood sampling respectively again, separation of serum together with front stored frozen serum to be measured, detects the concentration of blood sugar, the results are shown in Table 1.
Table 1 fusion rotein treatment GK type ii diabetes rat experiment result
| The experiment grouping | Blood glucose value (mmol/L) before the abdominal injection | Blood glucose value (mmol/L) after 10 days is injected in the abdominal cavity continuously | Stop to inject back 3 days blood glucose values (mmol/L) |
| GLP-1 positive controls physiological saline control group P1-L-hlz group P2-L-hlz group P3-L-hlz group P4-L-hlz group P5-L-hlz group P1-hlz group P2-hlz group P3-hlz group P4-hlz group P5-hlz group hlz-L-P1 group hlz-L-P2 group hlz-L-P3 group hlz-L-P4 group hlz-L-P5 group hlz-P1 group hlz-P2 group hlz-P3 group hlz-P4 group hlz-P5 group | 9.6±0.3 9.4±0.6 9.7±0.5 9.5±0.3 9.3±0.3 9.4±0.4 9.4±0.2 9.3±0.4 9.5±0.5 9.2±0.4 9.2±0.4 9.3±0.3 9.5±0.3 9.6±0.5 9.6±0.3 9.4±0.4 9.4±0.5 9.1±0.3 9.4±0.5 9.3±0.3 9.5±0.3 9.4±0.5 | 5.4±0.5 9.3±0.3 5.6±0.6 5.7±0.5 5.9±0.4 5.5±0.4 5.3±0.3 5.4±0.3 5.5±0.2 5.4±0.3 5.8±0.4 5.6±0.3 5.7±0.6 5.7±0.3 5.6±0.5 5.4±0.5 5.8±0.4 5.6±0.3 5.4±0.3 5.5±0.5 5.6±0.4 5.9±0.4 | 8.2±0.4 9.6±0.4 6.3±0.2 6.9±0.5 6.6±0.4 6.3±0.4 6.3±0.3 7.2±0.4 7.6±0.4 6.8±0.4 6.2±0.5 7.6±0.5 7.3±0.6 7.3±0.5 6.9±0.4 6.8±0.5 7.5±0.5 7.1±0.4 7.4±0.4 7.5±0.5 7.2±0.4 7.0±0.3 |
As can be seen from Table 1 blood sugar reducing peptide and human lysozyme fusion protein experimental group and GLP-1 positive controls successive administration after 10 days blood glucose value all dropped to the level (normal rat blood glucose value 4.9-6.2) of normal value, the activity of blood sugar reducing peptide-human lysozyme fusion protein and GLP-1 is identical.But the blood glucose value of drug withdrawal GLP-1 positive controls after 3 days has been returned to outlier again, and the blood glucose value of blood sugar reducing peptide and human lysozyme fusion protein experimental group is still at normal value, the activity that blood sugar reducing peptide and human lysozyme fusion protein be described can keep the longer time promptly in vivo specific activity GLP-1 prolong 3 days approximately.
Two, blood sugar reducing peptide and human lysozyme fusion protein stimulation in rats beta Cell of islet excreting insulin and stimulation beta Cell of islet proliferative effect
The external primary cell culture of carrying out: get rat Langerhans islet β cell, tryptic digestion is counted after becoming individual cells.Every hole adds 10 in 24 orifice plates
5Individual cell, every group 4 hole.' blood sugar reducing peptide and human lysozyme fusion protein ' group (is divided 22 groups, every group 4 hole) final concentration of every hole adding corresponding ' blood sugar reducing peptide and human lysozyme fusion protein ' is 5 μ g/ml, the final concentration that GLP-1 organizes every hole adding GLP-1 is 1 μ g/ml, and the final concentration that the every hole of negative control group adds bovine serum albumin is 20 μ g/ml.Cell is put in 37 ℃ of carbonic acid gas incubators and is cultivated, and nutrient solution is the DMEM/F2 nutrient solution that contains low sugar.Cultivate after 4 hours, every hole continues to cultivate after taking out a small amount of supernatant.
Regular Insulin detected result in 4 hours supernatants sees Table 2, the amount of Regular Insulin obviously will be higher than negative control group in ' blood sugar reducing peptide and human lysozyme fusion protein ' each group and the GLP-1 positive controls supernatant as can be seen, illustrate that ' blood sugar reducing peptide and human lysozyme fusion protein ' is the same with GLP-1, have the function that stimulates the beta Cell of islet excreting insulin.Cultivate after 7 days the cell dissociation in the hole is also counted, the results are shown in Table 2.The result shows that ' blood sugar reducing peptide and human lysozyme fusion protein ' and GLP-1 have the outgrowth effect of stimulation in rats beta Cell of islet.
Three, blood sugar reducing peptide and human lysozyme fusion protein glucose tolerance effect:
220 of normal Kunming kind small white mouses, (every body weight is at 22g ± 2g), be divided into 22 groups, 10 every group; One group is the GLP-1 control group, and another group is physiology saline control group; All the other 20 groups is ' blood sugar reducing peptide and human lysozyme fusion protein ' group; Hunger is 16 hours before 220 mouse experiments, and afterbody is gathered blood, separation of serum.' blood sugar reducing peptide and human lysozyme fusion protein ' respectively organizes every mouse peritoneal inoculation 0.5ml, contains ' blood sugar reducing peptide and the human lysozyme fusion protein ' of 25 μ g; 0.5ml is inoculated in every abdominal cavity of GLP-1 control group, contains the GLP-1 of 5 μ g; The physiological saline of every abdominal cavity inoculation of negative control group 0.5ml; Glucose 0.2ml in back 2 hours every abdominal injections 40% of injection measured blood sugar after 30 minutes.Blood sugar detection result such as table 3, as can be seen from the table, injected in mice GLP-1 and ' blood sugar reducing peptide and human lysozyme fusion protein ' sugar tolerance reaction is preferably all arranged, and ' blood sugar reducing peptide and human lysozyme fusion protein ' effect are better than the GLP-1 positive controls.
Table 2 fusion rotein stimulation in rats beta Cell of islet excreting insulin and stimulation beta Cell of islet hyperplasia experimental result
| The experiment grouping | Regular Insulin (μ U) in 4 hours supernatants | Cultivate average every porocyte number (* 10 after 7 days 5Individual) |
| GLP-1 positive controls physiological saline control group P1-L-hlz group P2-L-hlz group P3-L-hlz group P4-L-hlz group P5-L-hlz group P1-hlz group P2-hlz group P3-hlz group P4-hlz group P5-hlz group hlz-L-P1 group hlz-L-P2 group hlz-L-P3 group hlz-L-P4 group hlz-L-P5 group hlz-P1 group hlz-P2 group hlz-P3 group hlz-P4 group hlz-P5 group | 3.1±0.3 0.4±0.4 3.8±0.3 3.2±0.4 2.8±0.2 3.6±0.4 3.0±0.3 2.8±0.2 2.9±0.5 3.1±0.5 3.2±0.3 2.9±0.3 2.8±0.5 2.6±0.3 3.1±0.4 3.4±0.6 2.3±0.3 2.8±0.3 2.3±0.3 2.6±0.2 3.4±0.4 3.0±0.4 | 7.9 0.8 8.9 8.2 8.0 8.1 7.9 6.9 7.4 7.7 8.2 7.5 7.5 6.1 6.3 6.0 5.9 7.0 6.1 7.3 6.7 6.6 |
Table 3 fusion rotein glucose tolerance effect experimental result
| The experiment grouping | Blood glucose value (mmol/L) before the administration | Abdominal injection glucose is blood glucose value (mmol/L) after 30 minutes |
| GLP-1 positive controls physiological saline control group P1-L-hlz group P2-L-hlz group P3-L-hlz group P4-L-hlz group P5-L-hlz group P1-hlz group P2-hlz group P3-hlz group P4-hlz group P5-hlz group hlz-L-P1 group hlz-L-P2 group hlz-L-P3 group hlz-L-P4 group hlz-L-P5 group hlz-P1 group hlz-P2 group hlz-P3 group hlz-P4 group hlz-P5 group | 5.2±0.3 5.1±0.3 5.3±0.3 5.2±0.3 5.5±0.5 5.3±0.4 5.4±0.4 4.9±0.2 5.2±0.3 5.5±0.3 5.0±0.4 5.4±0.6 5.2±0.3 5.1±0.2 5.6±0.4 5.7±0.5 5.4±0.3 5.4±0.3 5.6±0.2 5.1±0.3 5.0±0.3 5.3±0.4 | 14.6±1.5 22.5±1.8 10.0±1.2 11.6±1.5 11.8±1.4 12.9±1.5 12.3±1.2 12.1±2.2 11.4±1.0 11.5±1.2 10.3±1.0 12.9±1.3 11.6±1.1 12.3±1.3 11.1±1.6 10.4±1.0 13.0±1.1 11.1±1.3 12.5±1.4 10.5±1.5 12.1±1.1 13.0±1.2 |
Four, the anti-infectious function of blood sugar reducing peptide and human lysozyme fusion protein
A certain amount of golden yellow Portugal of picking coccus lawn is inoculated in the 2ml M-H liquid nutrient medium, cultivates after 6 hours for 35 ℃, takes out with sterilization dry yeast liquid to adapt to dilution (10
-1, 10
-2, 10
-3, 10
-4), get the NOD mouse again, random packet, every group of 5 mouse, respectively the different bacterium amounts of abdominal cavity infection tried bacterium liquid, measure the minimum that causes mouse 100% death cause death the bacterium amount (Minimal Lethed dose, MLD).Measure as infection dosage in the body with this bacterium.At once intravenous injection is subjected to reagent liquid after infecting, and (Human Lysozyme, activity unit: 30000 units/mg), dosage 50mg/kg is dissolved in the 0.5ml physiological saline positive control with human lysozyme.The dosage of blood sugar reducing peptide and human lysozyme fusion protein also is by the 50mg/kg administration, is dissolved in the 0.5ml physiological saline.Every mouse mainline 0.5ml of negative control physiological saline.Observe and record dead mouse number, observed continuously 7-14 days.The results are shown in Table 4; The same with the positive control human lysozyme the effect of the blood sugar reducing peptide of recombinating as can be seen from the table with anti-NOD mouse infection with human lysozyme fusion protein.
Table 4 fusion rotein is to the treatment result of septicemia model due to the NOD mouse peritoneal bacterial infection
| The experiment grouping | Number of animals (only) | Death toll (only) | Mortality ratio |
| Human lysozyme control group physiological saline control group P1-L-hlz group P2-L-hlz group P3-L-hlz group P4-L-hlz group P5-L-hlz group P1-hlz group P2-hlz group P3-hlz group P4-hlz group P5-hlz group hlz-L-P1 group hlz-L-P2 group hlz-L-P3 group hlz-L-P4 group hlz-L-P5 group hlz-P1 group hlz-P2 group hlz-P3 group hlz-P4 group hlz-P5 group | 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 | 3 10 3 4 4 4 4 5 5 4 6 4 3 5 4 4 5 4 5 5 4 3 | 30％ 100％ 30％ 40％ 40％ 40％ 40％ 50％ 50％ 40％ 30％ 40％ 30％ 50％ 40％ 40％ 50％ 40％ 50％ 50％ 40％ 30％ |
Five, blood sugar reducing peptide and human lysozyme fusion protein are removed AGEs and are improved the effect of urine protein
220 of NOD mouse, (every body weight is at 22g ± 2g), be divided into 22 groups, 10 every group; One group is the human lysozyme control group, and another group is physiology saline control group; All the other 20 groups is ' blood sugar reducing peptide and human lysozyme fusion protein ' group; Blood sampling and urine are measured AGEs value and albumin/creatinine ratio before 220 mouse experiments.Detect the preparation of the AGEs antibody of usefulness and carry out according to the method for bibliographical information, promptly the AGE-RNase that forms after RNase and the glucose effect is as immunogen, and the antiserum(antisera) that obtains behind the immune rabbit adopts competition inhibition method to measure the AGEs amount then.' blood sugar reducing peptide and human lysozyme fusion protein ' respectively organizes every mouse peritoneal inoculation 0.5ml, contains ' blood sugar reducing peptide and the human lysozyme fusion protein ' of 25 μ g; 0.5ml is inoculated in every abdominal cavity of human lysozyme control group, contains the human lysozyme of 25 μ g; The physiological saline of every abdominal cavity inoculation of negative control group 0.5ml; Injection every day injection is continuously taken a blood sample after 20 days and is urinated and measure AGEs value and albumin/creatinine ratio.Result such as table 5, as can be seen from the table, blood sugar reducing peptide and human lysozyme merge recombinant protein and equally with simple human lysozyme have the discharge that alleviates AGEs level in the NOD mouse blood, promote AGEs in the urine, alleviate albuminuretic effect.
Table 5 blood sugar reducing peptide and human lysozyme fusion protein are removed AGE and are improved the urine protein result
| The experiment grouping | AGE in the blood (U/ml) | AGE in the urine (U/ml) | Urine protein (albumin/creatinine) | |||
| Before the administration | After the administration | Before the administration | After the administration | Before the administration | After the administration | |
| Human lysozyme contrast physiological saline contrast P1-L-hlz group P2-L-hlz group P3-L-hlz group P4-L-hlz group P5-L-hlz group P1-hlz group P1-hlz group P3-hlz group P4-hlz group P5-hlz group hlz-L-P1 group hlz-L-P2 group hlz-L-P3 group hlz-L-P4 group hlz-L-P5 group hlz-P1 group hlz-P2 group hlz-P3 group hlz-P4 group hlz-P5 group | 32.6±6 32.2±5 31.8±7 31.9±5 32.4±6 32.7±6 33.6±5 33.6±7 32.8±7 33.6±8 31.6±4 32.9±8 30.9±3 33.3±4 32.8±7 33.6±8 31.6±6 31.7±5 30.6±7 32.3±5 31.6±9 31.7±7 | ?20.5±4.2?34.1±4.5?21.5±4.4?20.3±5.2?22.2±4.2?23.5±3.7?19.5±4.6?21.3±3.7?22.5±5.2?23.5±4.1?22.8±5.6?21.5±4.4?20.2±3.3?21.5±5.0?22.2±4.6?23.7±3.7?21.3±5.5?20.2±3.2?21.5±3.2?22.1±4.1?20.5±3.6?21.3±3.8 | 215±53 208±55 208±56 210±62 206±60 211±65 218±63 207±55 213±53 205±51 216±63 209±59 210±50 214±60 202±56 200±54 208±52 217±60 215±50 210±58 205±55 212±60 | ?404±64?200±66?405±70?425±60?430±66?435±64?451±60?409±60?404±53?425±55?465±70?450±57?432±56?445±45?438±58?461±63?417±47?451±53?437±57?440±55?437±68?426±56 | 0.9±0.1 0.8±0.2 0.9±0.4 0.9±0.6 1.0±0.5 1.0±0.2 0.9±0.3 1.0±0.7 1.0±0.4 0.9±0.3 0.9±0.5 0.8±0.4 0.9±0.2 0.8±0.4 1.0±0.3 0.9±0.3 0.9±0.5 1.0±0.6 0.9±0.6 0.8±0.2 0.9±0.7 0.9±0.8 | 0.4±0.1 1.0±0.2 0.3±0.1 0.4±0.1 0.4±0.2 0.3±0.2 0.4±0.2 0.4±0.1 0.4±0.2 0.4±0.1 0.4±0.1 0.4±0.1 0.3±0.1 0.5±0.1 0.4±0.2 0.3±0.1 0.4±0.2 0.4±0.1 0.4±0.2 0.3±0.1 0.4±0.2 0.4±0.1 |
Sequence table
＜110〉Dalian Dien Bioengineering Co., Ltd.
＜120〉recombinant protein of GLP-1 and analogue thereof and human lysozyme fusion and uses thereof
<160>33
<170>PatentIn?version?3.3
<210>1
<211>39
<212>PRT
＜213〉artificial sequence
<400>1
His?Gly?Glu?Gly?Thr?Phe?Thr?Ser?Asp?Leu?Ser?Lys?Gln?Met?Glu?Glu
1 5 10 15
Glu?Ala?Val?Arg?Leu?Phe?Ile?Glu?Trp?Leu?Lys?Asn?Gly?Gly?Pro?Ser
20 25 30
Ser?Gly?Ala?Pro?Pro?Pro?Ser
35
<210>2
<211>30
<212>PRT
＜213〉artificial sequence
<400>2
His?Ala?Glu?Gly?Thr?Phe?Thr?Ser?Asp?Val?Ser?Ser?Tyr?Leu?Glu?Gly
1 5 10 15
Gln?Ala?Ala?Lys?Glu?Phe?Ile?Ala?Trp?Leu?Val?Lys?Gly?Arg
20 25 30
<210>3
<211>30
<212>PRT
＜213〉artificial sequence
<400>3
His?Gly?Glu?Gly?Thr?Phe?Thr?Ser?Asp?Val?Ser?Tyr?Leu?Glu?Gly
1 5 10 15
Gln?Ala?Ala?Lys?Glu?Phe?Ile?Ala?Trp?Leu?Val?Lys?Gly?Arg
20 25 30
<210>4
<211>26
<212>PRT
＜213〉artificial sequence
<400>4
His?Gly?Glu?Gly?Thr?Phe?Thr?Ser?Asp?Val?Ser?Tyr?Leu?Glu?Gly
1 5 10 15
Gln?Ala?Ala?Lys?Glu?Phe?Ile?Ala?Trp?Leu
20 25
<210>5
<211>32
<212>PRT
＜213〉artificial sequence
<400>5
His?Gly?Glu?Gly?Thr?Phe?Thr?Ser?Asp?Val?Ser?Ser?Tyr?Leu?Glu?Gly
1 5 10 15
Gln?Ala?Ala?Lys?Glu?Phe?Ile?Ala?Trp?Leu?Val?Lys?Gly?Arg?Thr?Ser
20 25 30
<210>6
<211>130
<212>PRT
＜213〉human lysozyme
<400>6
Lys?Val?Phe?Glu?Arg?Cys?Glu?Leu?Ala?Arg?Thr?Lys?Arg?Leu?Gly
1 5 10 15
Met?Asp?Gly?Tyr?Arg?Gly?Met?Ser?Leu?Ala?Asn?Trp?Met?Cys?Leu?Ala
20 25 30
Lys?Trp?Glu?Ser?Gly?Tyr?Asn?Thr?Arg?Ala?Thr?Asn?Tyr?Asn?Ala?Gly
35 40 45
Asp?Arg?Ser?Thr?Asp?Tyr?Gly?Ile?Phe?Gln?Ile?Asn?Ser?Arg?Tyr?Trp
50 55 60
Cys?Asn?Asp?Gly?Lys?Thr?Pro?Gly?Ala?Val?Asn?Ala?Cys?His?Leu?Ser
65 70 75 80
Cys?Ser?Ala?Leu?Leu?Gln?Asp?Asn?Ile?Ala?Asp?Ala?Val?Ala?Cys?Ala
85 90 95
Lys?Arg?Val?Val?Arg?Asp?Pro?Gln?Gly?Ile?Arg?Ala?Trp?Val?Ala?Trp
100 105 110
Arg?Asn?Arg?Cys?Gln?Asn?Arg?Asp?Val?Arg?Gln?Tyr?Val?Gln?Gly?Cys
115 120 125
Gly?Val
130
<210>7
<211>74
<212>DNA
＜213〉artificial sequence
<400>7
tactcgagaa?aagacatggt?gaaggaacat?ttaccagtga?cttgtcaaaa?cagatggaag 60
aggaggcagt?gcgg 74
<210>8
<211>96
<212>DNA
＜213〉artificial sequence
<400>8
atggatccac?ctgagccacc?cgatggcgga?ggtgccccgc?tacttggtcc?tccgttctta 60
agccactcaa?taaataaccg?cactgcctcc?tcttcc 96
<210>9
<211>71
<212>DNA
＜213〉artificial sequence
<400>9
tactcgagaa?aagacatgct?gaagggacct?ttaccagtga?tgtaagttct?tatttggaag 60
gccaagctgc?c 71
<210>10
<211>76
<212>DNA
＜213〉artificial sequence
<400>10
atggatccac?ctgagccacc?tcggcctttc?accagccaag?caatgaattc?cttggcagct 60
tggccttcca?aataag 76
<210>11
<211>71
<212>DNA
＜213〉artificial sequence
<400>11
tactcgagaa?aagacatggt?gaagggacct?ttaccagtga?tgtaagttct?tatttggaag 60
gccaagctgc?c 71
<210>12
<211>64
<212>DNA
＜213〉artificial sequence
<400>12
atggatccac?ctgagccacc?cagccaagca?atgaattcct?tggcagcttg?gccttccaaa 60
taag 64
<210>13
<211>71
<212>DNA
＜213〉artificial sequence
<400>13
atggatccac?ctgagccacc?actagttcgg?cctttcacca?gccaagcaat?gaactccttg 60
gcagcttggc?c 71
<210>14
<211>35
<212>DNA
＜213〉artificial sequence
<400>14
atgaattcgg?atccaaggtc?tttgaaaggt?gtgag 35
<210>15
<211>37
<212>DNA
＜213〉artificial sequence
<400>15
atgcggccgc?ttacactcca?caaccttgaa?catactg 37
<210>16
<211>97
<212>DNA
＜213〉artificial sequence
<400>16
ctcacacctt?tcaaagacct?tcgatggcgg?aggtgccccg?ctacttggtc?ctccgttctt 60
aagccactca?ataaataacc?gcactgcctc?ctcttcc 97
<210>17
<211>21
<212>DNA
＜213〉artificial sequence
<400>17
aaggtctttg?aaaggtgtga?g 21
<210>18
<211>77
<212>DNA
＜213〉artificial sequence
<400>18
ctcacacctt?tcaaagacct?ttcggccttt?caccagccaa?gcaatgaatt?ccttggcagc 60
ttggccttcc?aaataag 77
<210>19
<211>65
<212>DNA
＜213〉artificial sequence
<400>19
ctcacacctt?tcaaagacct?tcagccaagc?aatgaattcc?ttggcagctt?ggccttccaa 60
ataag 65
<210>20
<211>72
<212>DNA
＜213〉artificial sequence
<400>20
ctcacacctt?tcaaagacct?tactagttcg?gcctttcacc?agccaagcaa?tgaactcctt 60
ggcagcttgg?cc 72
<210>21
<211>68
<212>DNA
＜213〉artificial sequence
<400>21
taggatccca?tggtgaagga?acatttacca?gtgacttgtc?aaaacagatg?gaagaggagg 60
cagtgcgg 68
<210>22
<211>89
<212>DNA
＜213〉artificial sequence
<400>22
atgcggccgc?ttacgatggc?ggaggtgccc?cgctacttgg?tcctccgttc?ttaagccact 60
caataaataa?ccgcactgcc?tcctcttcc 89
<210>23
<211>65
<212>DNA
＜213〉artificial sequence
<400>23
taggatccca?tgctgaaggg?acctttacca?gtgatgtaag?ttcttatttg?gaaggccaag 60
ctgcc 65
<210>24
<211>69
<212>DNA
＜213〉artificial sequence
<400>24
atgcggccgc?ttatcggcct?ttcaccagcc?aagcaatgaa?ttccttggca?gcttggcctt 60
ccaaataag 69
<210>25
<211>65
<212>DNA
＜213〉artificial sequence
<400>25
taggatccca?tggtgaaggg?acctttacea?gtgatgtaag?ttcttatttg?gaaggccaag 60
ctgcc 65
<210>26
<211>57
<212>DNA
＜213〉artificial sequence
<400>26
atgcggccgc?ttacagccaa?gcaatgaatt?ccttggcagc?ttggccttcc?aaataag 57
<210>27
<211>64
<212>DNA
＜213〉artificial sequence
<400>27
atgcggccgc?ttaactagtt?cggcctttca?ccagccaagc?aatgaactcc?ttggcagctt 60
ggcc 64
<210>28
<211>35
<212>DNA
＜213〉artificial sequence
<400>28
tactcgagaa?aagaaaggtc?tttgaaaggt?gtgag 35
<210>29
<211>53
<212>DNA
＜213〉artificial sequence
<400>29
atgcggccgc?atcggatcca?cctgagccac?ccactccaca?accttgaaca?tac 53
<210>30
<211>84
<212>DNA
＜213〉artificial sequence
<400>30
cagtatgttc?aaggttgtgg?agtgcatggt?gaaggaacat?ttaccagtga?cttgtcaaaa 60
cagatggaag?aggaggcagt?gcgg 84
<210>31
<211>22
<212>DNA
＜213〉artificial sequence
<400>31
cactccacaa?ccttgaacat?ac 22
<210>32
<211>81
<212>DNA
＜213〉artificial sequence
<400>32
cagtatgttc?aaggttgtgg?agtgcatgct?gaagggacct?ttaccagtga?tgtaagttct 60
tatttggaag?gccaagctgc?c 81
<210>33
<211>81
<212>DNA
＜213〉artificial sequence
<400>33
cagtatgttc?aaggttgtgg?agtgcatggt?gaagggacct?ttaccagtga?tgtaagttct 60
tatttggaag?gccaagctgc?c 81
Claims (4)
1. a fusion rotein is characterized in that it is to merge the recombinant protein that express the back by blood sugar reducing peptide and human lysozyme at gene level;
Described blood sugar reducing peptide is that aminoacid sequence is a kind of in the aminoacid sequence shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 and/or the SEQ ID NO.5;
The aminoacid sequence of described human lysozyme is shown in SEQ ID NO.6;
Blood sugar reducing peptide and human lysozyme are by a kind of connection the in following four kinds of modes:
1. blood sugar reducing peptide-connection peptides-human lysozyme,
2. blood sugar reducing peptide-human lysozyme,
3. human lysozyme-connection peptides-blood sugar reducing peptide,
4. human lysozyme-blood sugar reducing peptide;
Described connection peptides sequence is GGSGGS.
2. according to the described fusion rotein of claim 1, it is characterized in that this fusion rotein is by the recombinant expressed generation of Pichia yeast expression system.
3. the application of the described fusion rotein of claim 1 in the medicine of preparation treatment diabetes.
4. the application of the described fusion rotein of claim 1 in the medicine of preparation treatment diabetic complication, described diabetic complication comprise infections, by the kidney and the vascular complication of terminal glycosylation dead end product initiation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2006100479632A CN1927888B (en) | 2006-09-30 | 2006-09-30 | Recombination albumen of GLP-1 and analogue thereof and human lysozyme fusion and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2006100479632A CN1927888B (en) | 2006-09-30 | 2006-09-30 | Recombination albumen of GLP-1 and analogue thereof and human lysozyme fusion and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1927888A CN1927888A (en) | 2007-03-14 |
| CN1927888B true CN1927888B (en) | 2011-03-02 |
Family
ID=37858040
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2006100479632A Expired - Fee Related CN1927888B (en) | 2006-09-30 | 2006-09-30 | Recombination albumen of GLP-1 and analogue thereof and human lysozyme fusion and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1927888B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101906156B (en) * | 2010-02-09 | 2012-10-10 | 中国药科大学 | Structures and application of bifunctional protein and derivatives of bifunctional protein |
| CN112175090B (en) * | 2019-07-03 | 2024-04-26 | 深圳市雅臣智能生物工程有限公司 | Human lysozyme conjugate and preparation method and application thereof |
| CN111909955B (en) * | 2020-08-10 | 2021-12-31 | 安徽新熙盟生物科技有限公司 | Preparation and application of recombinant MANNase-GLP-1 and homologues |
-
2006
- 2006-09-30 CN CN2006100479632A patent/CN1927888B/en not_active Expired - Fee Related
Non-Patent Citations (2)
| Title |
|---|
| John Eng et al.Isolation and Characterization of Exendin-4,an Exendin-3Analogue,from Heloderma suspectum Venom.thr jounal of biological chemistry267 11.1992,267(11),全文. |
| John Eng et al.Isolation and Characterization of Exendin-4,an Exendin-3Analogue,from Heloderma suspectum Venom.thr jounal of biological chemistry267 11.1992,267(11),全文. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1927888A (en) | 2007-03-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20190085043A1 (en) | Fusion proteins for treating a metabolic syndrome | |
| CN106220724B (en) | 21 recombinant protein of human fibroblastic growth factor and its preparation method and application | |
| CN109836488B (en) | Glucagon analogues for treating metabolic diseases | |
| CN103491975A (en) | Combination of acylated glucagon analogues with insulin analogues | |
| CN103443122B (en) | Human insulin analogue and acylated derivatives thereof | |
| CN101367873B (en) | Modified glucagon sample peptide-1analogue and modifying matter, and uses thereof | |
| CN107108710A (en) | Polypeptides of FGF 21 of modification and application thereof | |
| CN102282166A (en) | Glucagon analogues | |
| CN102292348A (en) | Glucagon analogues | |
| CN106432509B (en) | A kind of 21 fusion protein of recombinant human fibroblast growth factor and its preparation method and application for treating metabolic disease | |
| CN109836504B (en) | Multi-domain active protein for treating metabolic diseases | |
| CN102282167A (en) | Glucagon analogues | |
| CN109836503B (en) | Multiple active protein for treating metabolic diseases | |
| JP7268202B2 (en) | Fusion proteins for treating metabolic diseases | |
| CN105025919A (en) | Therapeutic agents, compositions, and methods for glycemic control | |
| CN101240033B (en) | Fusion protein of insulin secretion accelerating peptide and human serum albumin, and preparation method thereof | |
| CN102690352A (en) | Fusion protein containing GLP-1, and pharmaceutical compositions and applications thereof | |
| CN101003574B (en) | Recombined expression of peptide for lowering blood sugar in long acting, and application in medication for treating diabetes | |
| CN105367664A (en) | Preparation method for dual-functional fusion protein capable of activating GLP-1 receptor and Amylin receptor and application of fusion protein | |
| CN1927888B (en) | Recombination albumen of GLP-1 and analogue thereof and human lysozyme fusion and application thereof | |
| CN1982336B (en) | Human pancreas glucagon sample peptide-1-derivative, its production and use | |
| CN102443064A (en) | Thrombin activity based chimeric peptide with double targeting effects and application thereof | |
| CN113105561A (en) | Preparation method and application of double-target fusion protein | |
| CN104558198A (en) | Preparation method and application of fusion protein of GLP-1 analogue and amylin analogue | |
| CN101698681B (en) | Chimeric polypeptide with dual-targeting function and applications thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20110302 Termination date: 20210930 |