CN114672426B

CN114672426B - Saccharomyces cerevisiae engineering bacteria, construction method and application thereof

Info

Publication number: CN114672426B
Application number: CN202210419586.XA
Authority: CN
Inventors: 杜婕; 李志刚; 颜子豪; 王煜轩; 徐可馨; 沈晓露; 刘云
Original assignee: Jiangsu Polytechnic College of Agriculture and Forestry
Current assignee: Jiangsu Polytechnic College of Agriculture and Forestry
Priority date: 2022-04-21
Filing date: 2022-04-21
Publication date: 2023-11-10
Anticipated expiration: 2042-04-21
Also published as: CN114672426A

Abstract

The invention discloses saccharomyces cerevisiae engineering bacteria, a construction method and application thereof. The saccharomyces cerevisiae engineering bacteria are obtained by cloning a gene fragment MrLectin shown in SEQ ID NO.1 into an expression vector to obtain a recombinant expression vector, and integrating the recombinant expression vector with a saccharomyces cerevisiae strain. The invention adopts the saccharomyces cerevisiae to carry out eukaryotic expression of target protein, thereby greatly reducing the generation of inclusion bodies, realizing active expression of protein, simultaneously, being used as the saccharomyces cerevisiae of common probiotics for aquaculture, the active protein expression strain is easier to be applied to the field of aquaculture, and has important significance for improving the organism immunity of shrimp and crab animals, thereby promoting the green, healthy and stable development of aquaculture.

Description

Saccharomyces cerevisiae engineering bacteria, construction method and application thereof

Technical Field

The invention relates to the field of biotechnology and aquaculture, in particular to saccharomyces cerevisiae engineering bacteria, a construction method and application thereof.

Background

As an indispensable food and economic source for humans, aquaculture is a significant feature in the world economic system. China is a large country of aquaculture, the aquaculture industry has become an increasing point of agricultural economy in China, and crustaceans are the largest groups of aquatic animals. In recent years, crustacean diseases become serious, and huge economic losses are brought to the aquaculture industry in China.

Crustaceans lack the specific immune function acquired in the acquired days, but they have a relatively perfect innate immune system that can rapidly identify and effectively eliminate invading microorganisms. The innate immunity of crustaceans mainly includes cellular immunity and humoral immunity. Among these, cellular immune responses are mediated by blood cells, mainly including phagocytosis, nodule formation, and coating. The humoral immune response is mainly dependent on haemolymph, and is caused by agglutination reaction, blackening reaction caused by activation of prophenoloxide, and antibacterial peptide. The effective recognition of pathogens by the body is the first step in initiating their innate immune response, and for invertebrates, the differentiation of self and non-hexoses is mainly accomplished by pattern recognition receptors (pattern recognition receptors, PRRs) which are capable of recognizing specific, conserved pathogen-associated molecular patterns (pathogen-associated molecular patterns, PAMPs) on the surface of pathogens such as foreign microorganisms, lectin being a pattern recognition receptor which has a pathogen recognition function and which contains specific glycosyl determinant receptors on its surface, and which is capable of differentiating heterohexoses according to the glycosyl composition on the surface of the xenobiotics, promoting phagocytes in the body to phagocytose foreign substances, thereby inducing an effective immune defense response in the body.

At present, most of researches on immune proteins of crustaceans are adoptedE.coliProkaryotic expression of target protein is easy to occur inclusion body of protein to reduce activity, while Saccharomyces cerevisiae @ is suitable for use in the production of target proteinSaccharomyces cerevisiae) Is a better eukaryotic gene expression system, and the protein product has better expression activity and solubility and is widely used in biological production. However, there are few reports of the expression of the macrobrachium rosenbergii lectin gene in Saccharomyces cerevisiae. And as food-grade safe saccharomyces cerevisiae, it has remarkable effect in aquaculture. Firstly, the saccharomycete can provide nutrition for aquatic livestock such as shrimps and crabs, promote the absorption of nutrient substances, secondly, the saccharomycete can inhibit pathogenic bacteria and regulate intestinal microecological balance, and in addition, the saccharomycete can also be used for regulating the culture water quality. Therefore, how to realize the yeast activity expression of Lectin from crustacean and use the engineering strain as feed immunity microbial inoculum for aquaculture and effectively improve the growth and immunity of shrimp bodies is a problem to be solved.

Disclosure of Invention

The invention aims to: the invention aims at the problems, and constructs saccharomyces cerevisiae engineering bacteria for preparing the giant freshwater prawnMacrobrachium rosenbergii) The important pattern recognition receptor-Lectin is expressed actively. The invention also provides a construction method and application of the saccharomyces cerevisiae engineering bacteria, and the recombinant protein strain is used as a feed immunity microbial inoculum to feed the macrobrachium rosenbergii, and the growth index and immunity index determination and pathogenic bacteria infection experiment prove that the recombinant protein strain effectively promotes the growth of shrimp organisms and the improvement of immunity.

The technical scheme is as follows: the saccharomyces cerevisiae engineering bacteria are obtained by cloning a gene fragment MrLectin shown in SEQ ID NO.1 into an expression vector to obtain a recombinant expression vector, and integrating the recombinant expression vector with a saccharomyces cerevisiae strain.

The invention adopts food-grade safe organism-saccharomyces cerevisiae to carry out eukaryotic expression of target protein, thereby greatly reducing the generation of inclusion bodies, realizing active expression of protein, simultaneously, being used as saccharomyces cerevisiae of common probiotics for aquaculture, the active protein expression strain is easier to be applied to the field of aquaculture, and has important significance for improving organism immunity of shrimp and crab animals, and promoting green, healthy and stable development of aquaculture.

As a preferred embodiment of the present invention, the expression vector is pHAC181.

As a preferred embodiment of the invention, the recombinant expression vector is integrated into a strain of Saccharomyces cerevisiaeGAL1Downstream of the promoter.

The invention expresses a macrobrachium rosenbergii Lectin (Lectin) gene through a saccharomyces cerevisiae eukaryotic expression system, and constructs a saccharomyces cerevisiae engineering strain for expressing macrobrachium rosenbergii Lectin. The cDNA CDS region of macrobrachium rosenbergii super lectin MrLectin is cloned to an expression plasmid pHAC181 to obtain a recombinant plasmid pHAC181-MrLectin with correct sequence, then homologous recombination primers are designed, and the homologous recombination technology is utilized to integrate the target gene MrLectin into a saccharomyces cerevisiae host strainGAL1Downstream of the promoter. Under the induction of galactose, the engineering strain can be used for expressing a large amount of target protein MrLectin in activity.

The construction method of the saccharomyces cerevisiae engineering bacteria comprises the following steps:

(1) Cloning the MrLectin gene fragment shown in SEQ ID NO.1 onto an expression plasmid pHAC181 to obtain a recombinant expression plasmid pHAC181-MrLectin;

(2) Amplifying plasmid pHAC181-MrLectin to obtain a nucleotide fragment containing the MrLectin gene, and integrating homologous recombination of the nucleotide fragment into the Saccharomyces cerevisiae strain downstream of the GAL1 promoter.

As a preferred embodiment of the present invention, in step (2), the amplification primers are shown in SEQ ID NO.2 and SEQ ID NO. 3.

The invention also provides a recombinant plasmid which contains the gene fragment shown as SEQ ID NO. 1.

The invention further provides a method for expressing the protein by the saccharomyces cerevisiae engineering bacteria, which comprises the following steps: and inoculating single bacterial colony of the saccharomyces cerevisiae engineering bacteria into an SD-LEU culture medium for overnight culture, transferring the culture into a YPG culture medium the next day, and extracting bacterial strain proteins after galactose induction culture.

The invention further provides a feed containing the saccharomyces cerevisiae engineering bacteria.

As a preferable implementation mode of the invention, the addition amount of the saccharomyces cerevisiae engineering bacteria in the feed is 0.2-0.5%. As a preferred embodiment of the invention, the addition amount of the saccharomyces cerevisiae engineering bacteria in the feed is 0.3 percent.

The invention further provides application of the saccharomyces cerevisiae engineering bacteria in a feed immune microbial inoculum.

The feed immune microbial inoculum disclosed by the invention can be used for improving the immunity of shrimps.

In the present invention, "%" is mass% unless otherwise indicated.

The beneficial effects are that: (1) The saccharomyces cerevisiae engineering bacteria constructed by the invention can realize the mass expression of the macrobrachium rosenbergii lectin MrLectin and the active expression without inclusion bodies; the MrLectin obtained by fermenting the engineering bacteria has activity, and 0.064mg of protein can be obtained per mL of fermentation broth after 6h of induction culture. (2) The invention successfully constructs the saccharomyces cerevisiae engineering bacteria MrLectin, realizes the mass expression of the macrobrachium rosenbergii Lectin, concentrates and compounds the engineering strains into pellet feed after mass culture, and carries out pathogen infection after feeding, so that the engineering strains can effectively reduce the death rate of aeromonas hydrophila infection, and the death rate is reduced by 25.16% compared with other groups, and the expression quantity of organism immunity index enzyme activity (SOD, CAT, ACP, AKP) and immune genes (SOD, CAT, ACP, AKP, lectin) of the macrobrachium rosenbergii in the feed pellet group fed and compounded with the saccharomyces cerevisiae engineering strains is obviously higher than that of other groups. (3) The constructed saccharomyces cerevisiae engineering strain MrLectin effectively promotes the organism immunity of the shrimps, and the development of novel feed protein sources and immune feed probiotics become key technologies for promoting the healthy development of the modern aquaculture industry at present.

Drawings

FIG. 1 is a schematic diagram of the construction strategy of an engineering strain of Saccharomyces cerevisiae.

FIG. 2 shows the amplification band (990 bp) of the macrobrachium rosenbergii lectin MrLectin cDNA.

FIG. 3 shows that colony PCR verifies positive transformants when macrobrachium rosenbergii lectin MrLectin cDNA is cloned onto vector pHAC 181; wherein Line 21 in panel a is the correct transformant; line2, 6, 7 in panel b are the correct transformants.

FIG. 4 shows the restriction enzyme verification of positive transformants when the macrobrachium rosenbergii lectin MrLectin cDNA was cloned into vector pHAC181, lines 10, 12, 13, 14, 15, 16 being correct transformants;

FIG. 5 shows the amplification of recombinant plasmid pHAC181-MrLectin by the enzyme PrimeSTAR GXL (5348 bp).

FIG. 6 shows the detection of pHAC181-MrLectin and the detection of the presence of the detection primerGAL1The strain of the promoter carries out homologous recombination, and the band of successful homologous recombination is 1276bp; wherein Line2 in panel a is the correct transformant; line7, 9 in panel b are the correct transformants.

FIG. 7 shows that the Western blot detects Gal-pHAC181-MrLectin protein expression, and the target protein is 42KD.

Fig. 8 shows that the pathogenic bacteria (aeromonas hydrophila) infection experiments and the statistics of mortality are carried out on the macrobrachium rosenbergii fed with different feeds for one month, and the PBS is used as an injection control group, so that the result shows that the mortality of the macrobrachium rosenbergii fed with the saccharomyces cerevisiae-MrLectin strain pellet feed is the lowest in the aeromonas hydrophila infection group.

FIG. 9 shows the changes in relative immunoenzymatic activity in the hepatopancreas of 0, 2, 6, 12, 24 and 36 small Shi Luoshi macrobrachium nipponensis after aeromonas hydrophila, injected with PBS as a control; wherein, the A graph is an AKP enzyme activity change result graph;b is an ACP enzyme activity change result graph; c is graph of SOD enzyme activity change result; d is a CAT enzyme activity change result diagram; bar values in the figure represent the average of six determinations, with standard error, asterisks indicate significant differences (.)P<0.05，**P<0.01）。

FIG. 10 shows the detection of the expression level of immune genes in the hepatopancreas of Macrobrachium rosenbergii by RT-PCR after infection of Macrobrachium rosenbergii with Aeromonas hydrophila 0, 2, 6, 12, 24 and 36 h, and the beta-actin gene as an internal reference gene; wherein, the A graph is the expression quantity of the Lectin gene; panel B shows AKP gene expression level; panel C shows the ACP gene expression level; graph D shows SOD gene expression level; e graph is CAT gene expression quantity; bar values represent the average of six determinations, with standard error, asterisks indicate significant differences (.)P<0.05，**P< 0.01）。

Description of the embodiments

Composition of LA medium: peptone 10 g/L, yeast extract 5 g/L, naCl 10 g/L, agar 12g/L, pH adjusted to 7.0, amp antibiotic 100mg/mL (120deg.C, 20 min).

Composition of SD-Leu medium: contains yeast nitrogen source (no AA) 1.7g/L, ammonium sulfate 5 g/L, glucose 20 g/L, 10xAA mix (-ura, -leu, -his) 100mL,100xUra 10mL,100xHis 10mL, agar 20 g/L (120deg.C, 20 min).

Composition of YPG medium: d-galactose 20/g/L, peptone 20/g/L, yeast extract 10/g/L (115 ℃ C., 20 min).

Example 1: construction of Saccharomyces cerevisiae Gene engineering bacterium (Gene cloning and homologous recombination)

By constructing the high expression plasmid pHAC181-MrLectin, the specific method is to extract the RNA of the Macrobrachium rosenbergii tissue by using a Trizol method, and reverse transcribing the RNA into cDNA by using a reverse transcription kit (figure 2).

And (3) carrying out PCR amplification on the target gene fragment MrLectin by using high-fidelity enzyme, wherein the CDS region (not including a stop codon) of the amplified MrLectin gene fragment is 990bp, and the amplified MrLectin gene fragment is shown as SEQ ID NO. 1. The fragment shown in SEQ ID No.1 was then cloned into the high expression plasmid pHAC181 multiple cloning site (FIG. 1), the ligation vector was transferred into E.coli competent cell TransT1, and plated onto LA plates for overnight culture at 37 ℃. The positive transformant obtained on the LA plate is subjected to colony PCR and enzyme digestion to verify the positive transformant (shown in figures 3 and 4), the correct recombinant is selected for DNA sequencing, and the sequence is verified to be free from mutation, so that the recombinant high-expression plasmid pHAC181-MrLectin is obtained.

Designing homologous recombination primers (shown as SEQ ID NO.2 and SEQ ID NO. 3) according to the constructed recombinant high-expression plasmid pHAC181-MrLectin, amplifying plasmid pHAC181-MrLectin by using high-fidelity PrimeSTAR GXL enzyme, and integrating the amplified long fragment into Saccharomyces cerevisiae strain, wherein the amplified long fragment is 5348bp (figure 5)GAL1Downstream of the promoter (FIG. 1), the Gal-pHAC181-MrLectin engineering strain was obtained.

F1：caaatgtaataaaagtatcaacaaaaaattgttaatatacctctatactttaacgtcaaggagaaaaaacccggatctcaaa

atgtggcattcaaggggc（SEQ ID NO.2）；

R1：tatggacgaggtaataaggaaactcagaaccagaatagtggcatgagctctccaatttaacatatttgccattagtgacc

cgatgataagctgtcaaacatg（SEQ ID NO.3）；

The specific steps of gene homologous recombination (integration) are:

1. the single colony of the activated GAL1-ScRCH1 strain was inoculated into 3mL of YPD medium and cultured overnight at 30℃at 220 rpm.

2. Inoculating 300uL of overnight culture into 4.7mL of 2 XYPD, and culturing at 30 ℃ for 4-5 h (reaching OD600 = 0.6-1.0);

3. the 5mL bacterial solution was separated into 3 tubes, centrifuged at 4000 rpm at room temperature for 1min, the supernatant was discarded, resuspended in 1mL of water and combined into 1 EP tube, centrifuged at 3000rpm for 1min, and the supernatant was discarded.

4. 100uL of 0.1M LiAc solution was added, the mixture was blown and sucked, centrifuged at 12000rpm for 10s, and the supernatant was discarded.

5. And (4) repeating the step 4.

6. Sequentially adding the following substances, and after adding, mixing gently:

240μL PEG(50% w/v)

36μL 1.0 M LiAc

10 mu L ssDNA (10 mg/mL, boiled for 5min before use, put on ice for 5-10 min)

5-10ug pcr fragment DNA

7. Mixing, and incubating in a water bath at 30 ℃ for 30min;

incubating in a 9.42℃water bath for 30min (heat shock);

the supernatant was removed by centrifugation at 10.3000 rpm, the cells were resuspended in 1mL of sterile water, the supernatant was discarded by centrifugation at 3000rpm for 1min, and 100ul of the supernatant was reserved and spread on a selection plate (SD-LEU) and incubated at 30℃for 3 to 5 days.

11. The grown transformants were streaked on SD-LEU plates. The single colony is inoculated in YPD culture medium for overnight culture, the genome of the transformant is extracted, PCR detection is carried out by using detection primers DF and DR, and the transformant amplified by the target fragment is the strain Gal1-pHAC181-MrLectin with successful homologous recombination.

The detection primers of homologous recombination are DF and DR, and the sequences are shown as follows:

DF: cctggccccacaaaccttc（SEQ ID NO.4）；

DR: taggttgtatctgctgacc（SEQ ID NO.5）；

colony PCR detection is carried out on positive transformants after homologous recombination by using detection primers (shown as SEQ ID NO.4 and SEQ ID NO. 5), and the target band amplification successful (1276 bp) is a plasmid with successful homologous recombination (FIG. 6).

Colony PCR preparation system and steps:

rTag enzyme (2X) 4. Mu.L

Upstream primer DF (10. Mu.M) 0.5. Mu.L

Downstream primer DR (10. Mu.M) 0.5. Mu.L

Colony DNA 1. Mu.L

dd H ₂ O up to 10.0 μL

Uniformly mixing the above systems, centrifuging briefly to enable the solution to be gathered at the bottom of a tube, and adopting the PCR reaction procedure: 95. pre-denaturation at 30s at 95 ℃, denaturation at 5 s, annealing at 60 ℃, extension at 72 ℃ for 30s,40 cycles, 10min at 72 ℃, preservation at 4 ℃.

Example 2: engineering strain protein expression and Western blot detection

The GaL1-pHAC181-MrLectin strain with successful homologous recombination is inoculated into 5mL SD-LEU culture medium for overnight culture, the culture is transferred into 45mLYPG culture medium the next day, and after galactose induction culture for 6h (OD detection is 1.2-1.5), the strain protein is extracted. The extracted protein is used for Western blot detection.

The method comprises the following specific steps:

extraction of Total protein in cells

1. Picking single colony and culturing in a required liquid culture medium (SD-LEU culture medium) at 30 ℃ overnight until the single colony is saturated;

2. 5mL of the overnight cultured broth was added to 45mL of fresh liquid medium (YPG medium) and cultured with shaking in a shaker at 30℃for about 6 hours (OD=1.2 to 1.5) (rotation speed 220 rmp);

3. collecting thallus at 8000rpm/1min, and removing upper liquid;

4. re-suspending the thallus with pre-cooled double distilled water and centrifuging to eliminate supernatant;

5. PEB (Protein Extraction Buffer), which is equal to the amount of the bacterial cells and precooled, was added, and 100×pmsf was added to PEB;

6. adding acid-washed glass beads with the same volume as the thalli;

7. oscillating the EP tube on an oscillating mixer for 10x 30s, and putting on ice for 1min after each oscillation;

8. centrifuging at 12000rpm for 10min, collecting supernatant, preserving on ice, and discarding precipitate;

9. concentration (OD) was measured by Coomassie Brilliant blue method ₅₉₅ ) Adjusting the concentration of the sample to be consistent;

10. adding 5 XSB, and decocting at 95deg.C for 5min.

Detection of protein concentration by Coomassie Brilliant blue method

1. Preparation of standard protein solution: 10mg of BSA solid was weighed and dissolved in 1mL of water to give a 10mg/mL solution as a standard stock solution. Serial dilutions of standard protein solutions were made with standard stock solutions at concentrations of 1.2mg/mL, 1.0mg/mL, 0.8mg/mL, 0.6 mg/mL, 0.4 mg/mL, 0.2 mg/mL, 0.1mg/mL, respectively.

2. Preparation of the protein solution to be tested: the sample to be tested is diluted to a concentration of between 0.1mg/mL and 1.2 mg/mL.

3. 4 mu L of dye solution and 200 mu L of protein solution are mixed uniformly and left to stand for 3min. Protein concentration was determined following the "protein" procedure of the nucleic acid protein analyzer.

In this experiment, the concentration of MrLectin protein expressed by Saccharomyces cerevisiae was measured to be 16 ug/uL. The protein concentration obtained by conversion is 0.064 mg/mL, namely 0.064mg of protein is obtained per mL of fermentation broth.

(III) SDS-PAGE

1. Assembling the device; 2. preparing glue; 3. preparing a protein sample; 4. and (3) loading, namely, pre-dyeing markers and electrophoresis. Concentrate the gel 80V and isolate the gel 100V.

(IV) transfer printing (dipping method).

And fifthly, adding a sealing liquid for sealing, and gently shaking for 1-4 h by using a shaking table.

Adding primary antibody, 1, gently transferring off the sealing liquid, 2, adding primary antibody hybridization liquid, and standing at room temperature for 2h or at 4 ℃ overnight.

Adding secondary antibody 1, lightly transferring primary antibody hybridization solution (reusable), washing 3 times with TBST for 10min each time, 2, adding secondary antibody hybridization solution, gently shaking at room temperature for 2h, 3, washing film 3 times with TBST for 10min each time.

(eighth) reaction.

Ninth exposure development-dark operation

After development, according to the comparison of protein markers, gal1-pHAC181-MrLectin target protein expression is detected, the molecular weight is 42KD (shown as SEQ ID NO. 6), and the strains are successfully constructed Saccharomyces cerevisiae MrLectin immune protein engineering strains (FIG. 7).

Example 3: saccharomyces cerevisiae MrLectin engineering strain effectively improves shrimp organism immunity

(1) Expansion culture and concentration of yeast engineering strain

And carrying out laboratory expansion culture on the constructed saccharomyces cerevisiae MrLectin engineering strain. Firstly, culturing the engineering strain by using a 500 mL triangular flask (the culture medium for expansion culture is YPG culture medium), then carrying out expansion culture until the volume of the engineering strain reaches 1L, 3L and 5L, centrifugally filtering the cultured engineering strain, and naturally drying the thalli at room temperature. And mixing the dried thalli with shrimp pellet feed, feeding the feed mixed with the yeast engineering strain to the macrobrachium rosenbergii after the shrimp pellet feed is dried in the air, setting a control group at the same time, and observing the influence of the feed containing the recombinant engineering strain and the common feed on the macrobrachium rosenbergii during feeding. The feeding period is one month.

(2) Determination of pathogenic bacteria infection and mortality of Macrobrachium rosenbergii organism

300 macrobrachium rosenbergii with uniform size (about 20 g) are purchased from the local aquatic market. Different feeds are fed to the feed in groups: experimental group: the general shrimp pellet feed (Bada feed, nantong) is compounded with yeast MrLectin engineering strain (0.3 percent); control group one: the empty saccharomyces cerevisiae strain is compounded in the common shrimp pellet feed; control group two: a general shrimp pellet feed. The feeding amount is 4% of the weight of the fish, and the fish is fed for 2 times in the morning and evening for 4 weeks. After 1 month, the mixture was treated with Aeromonas hydrophila 3.0X10 ⁵ cfu 50 ul shrimp bodies were infected by injection, while 50 μlpbs injection was set as a control group. The cumulative mortality rate is counted at 0, 2, 6, 12, 24 and 36 h after aeromonas hydrophila infection, and the result shows that after 4 weeks of feeding, the death rate of the macrobrachium rosenbergii fed with saccharomyces cerevisiae MrLectin particles is the lowest (the cumulative mortality rate value is 66.9%), the death rate of a common feed feeding group is the highest, 36 h reaches 92.06% after infection, and the death rate of a no-load feed group mixed with yeast in the feed is higher than that of a recombinant protein group and is smaller than that of a common feed group (figure 8), so that the death rate of the recombinant saccharomyces MrLectin engineering strain can be effectively reduced after pathogen infection.

(3) Macrobrachium rosenbergii liver and pancreas tissue immunity enzyme activity and immune gene expression quantity determination

The hepatopancreatic tissues are taken at 0, 2, 6, 12, 24 and 36 h after aeromonas hydrophila infection for the determination of immune indexes, including the determination of the immunoenzymatic activity and the change of the expression level of immune genes. Wherein the measured immunoenzymatic activity comprises: alkaline phosphatase (AKP); acid phosphatase (ACP); superoxide dismutase (SOD) and Catalase (CAT).

The method comprises the following specific steps: the liver pancreas of about 0.1. 0.1 g was homogenized in 1mL of 0.6% physiological saline (ice working), and the homogenized liver tissue sample was centrifuged at 4℃for 10min at 3500 g, and the supernatant was used for measuring the immunoenzymatic activity.

Determination of alkaline phosphatase (AKP):

alkaline phosphatase decomposes disodium phosphate to generate free phenol and phosphoric acid, phenol reacts with 4-amino-imidacloprid in alkaline solution to generate red quinone derivative through potassium ferricyanide oxidation, and the absorbance of the red quinone derivative is measured by a visible light spectrophotometer according to the red shade, so that the enzyme activity can be measured. The results show that: the AKP activity of macrobrachium rosenbergii fed to the Saccharomyces cerevisiae MrLectin group increased from 2 hours after infection and reached the highest value of 75.33U/g at 12 hours, and the empty feeding group of Saccharomyces cerevisiae was similar to the normal pellet feeding group in that the enzyme activity level was lower than that of the target protein group (shown in FIG. 9, panel A).

Determination of acid phosphatase (ACP):

the acid phosphatase decomposes disodium phosphate to generate free phenol and phosphoric acid, the phenol reacts with 4-amino-imidacloprid in alkaline solution to generate red quinone derivative through potassium ferricyanide oxidation, and the absorbance of the red quinone derivative is measured by a visible light spectrophotometer according to the red shade, so that the enzyme activity can be measured. The results show that: the activity of 6h ACP of macrobrachium rosenbergii fed with Saccharomyces cerevisiae MrLectin group is obviously higher than that of other two groups, and the highest activity reaches 52.6U/g at 12 h. The empty s.cerevisiae pellet feed and the normal pellet feed fed groups showed similar results in which the ACP enzyme activity level was lower than that of the target protein group and there was no significant change during this period (shown in panel B of fig. 9).

Determination of superoxide dismutase (SOD):

production of superoxide anion radical (O) by xanthine and xanthine oxidase reaction systems ^2-. ) The latter oxidizes hydroxylamine to form nitrite, which is reddish under the action of a developer, and the absorbance is measured by a visible light spectrophotometer. When the measured sample contains SOD, the SOD has specific inhibition effect on superoxide anion free radical, so that the formed nitrite is reduced, and the absorbance of the measuring tube is lower than that of the control tube in colorimetric processThe SOD activity in the tested sample can be obtained through a calculation formula. The results show that: the SOD activity of the Saccharomyces cerevisiae MrLectin pellet fed group was significantly higher than that of the two control groups starting at 2h after challenge with Aeromonas hydrophila and then reached the highest value at 12 (30.3U/g, P<0.05 (shown in fig. 9, C).

Determination of Catalase (CAT)

The experiment adopts a molybdenum ammonium acid colorimetric method to measure the catalase, and the principle is that the catalase catalyzes H ₂ O ₂ Decomposing to generate H ₂ O and O ₂ Residual H of enzymatic reaction ₂ O ₂ A stable yellow complex with molybdic acid was formed, the shade of which was inversely proportional to the enzyme activity, and a colorimetric assay was performed at 405, nm to calculate the enzyme activity. The results show that: CAT activity was significantly increased in the group fed Saccharomyces cerevisiae MrLectin at 2. 2h and 12. 12h post infection, with 12h reaching a maximum of 11.56. 11.56U/g, whereas the group fed Saccharomyces cerevisiae empty pellet and normal feed pellet were below the level of enzyme activity observed for the target protein group (shown in panel D in FIG. 9).

The enzyme activity data show that the macrobrachium rosenbergii fed with the yeast engineering bacteria MrLectin shows stronger immune enzyme activity after being subjected to the infection of pathogenic bacteria aeromonas hydrophila, which indicates that the organism immunity of the macrobrachium rosenbergii in the group is higher than that of the other two groups.

(4) RT-PCR (reverse transcription-polymerase chain reaction) detection of variation of liver and pancreas tissue immune gene expression level of macrobrachium rosenbergii

The effect of the Saccharomyces cerevisiae MrLectin engineering strain on the expression level of the immune genes is detected by measuring the immune genes (Lectin, AKP, ACP, SOD, CAT) in the hepatopancreas tissues infected with the aeromonas hydrophila through real-time quantitative PCR (RT-PCR). The method comprises the following specific steps:

tissue lysis was performed and total RNA was extracted according to Trizol reagent instructions.

(1) 1ml of LTrilzol was added to the collected shrimp body hepatopancreatic tissue sample, and the mixture was sufficiently and rapidly ground in a 2 mL homogenizer and left at room temperature for 5 minutes to allow the shrimp body hepatopancreatic tissue sample to be sufficiently lysed. At this time, the sample can be stored at-70 ℃ for a long period of time. Centrifuge 12,000 g for 5min, collect supernatant in a new centrifuge tube and discard pellet.

(2) Chloroform was added to 200. Mu.L of chloroform/mLTrilol, mixed with shaking for 15 minutes s, left at room temperature for 12 minutes, centrifuged at 4℃for 15 minutes at 12,000 g.

(3) The upper aqueous phase (about 500-600. Mu.L) was pipetted into another centrifuge tube.

(4) According to 0.5 ml isopropyl alcohol/mlTrizol is added with isopropanol and mixed evenly, and the mixture is left at room temperature for 8 min.

(5) Centrifugation was performed at 12,000 g for 10min at 4℃and the supernatant was discarded, at which time RNA was deposited at the bottom of the tube.

(6) 75% ethanol (DEPC treated) was added to 1mL of 75% ethanol/mL Trizol, the tube was gently shaken and the pellet was gently suspended.

(7) Centrifuge at 4℃for 5min at 8,000 g and discard the supernatant.

(8) Air-drying at room temperature or vacuum drying for 5-10 min.

(9) With 20-50. Mu.L DEPC-H ₂ O dissolves RNA samples at 55-60 ℃ for 5-10min, and fully dissolves RNA.

cDNA reverse transcription

RT reaction solution was prepared according to the following composition (reaction solution preparation was performed on ice).

5× PrimeScript ^TM Buffer（for Real Time） 4 μL

PrimeScript ^TM RT Enzyme Mix I 1 μL

Oligo dT Primer（50 μM） 1 μL

Random 6 mers*1 1 μL

Total RNA 1 μg

RNase Free ddH ₂ O upto 20 μL

Reverse transcription reaction conditions were 37℃for 15 min,85℃for 5 s.

Fluorescent quantitative RT-PCR detection of immune related genes

Fluorescent quantitative PCR procedures were performed according to the instructions of fluorescent quantitative PCR kit SYBR Premix Ex TagTM KIT. The PCR reaction system is as follows:

SYBR Premix Ex Tag（2×） 10 μL

0.5. Mu.L of upstream primer (10. Mu.M)

Downstream primer (10. Mu.M) 0.5. Mu.L

CDNA template 1. Mu.L

dd H ₂ O up to 20.0 μL

Uniformly mixing the above systems, briefly centrifuging to enable the solution to be gathered at the bottom of a tube, and adopting a two-step method in the RT-PCR reaction procedure: 95. pre-denaturation at C for 30s, denaturation at 95 ℃ for 5 s, annealing at 60 ℃ for 30s,40 cycles. The concentration of the cDNA template was found according to the melting curve drawn. Gene expression relative to each other was 2 ^-ΔΔCt Calculation by the method (ΔΔct= (Ct target gene-Ct housekeeping gene) experimental group- (Ct target gene-Ct housekeeping gene) control), and before using the Ct method, it was confirmed that the amplification efficiencies of the target gene and the housekeeping gene were substantially identical. PBS stimulated group is used as blank control, actin beta-actin gene is used as reference gene, t-test is adopted in data analysis, and whenP<0.01And is determined to be a significant difference.

The results show that: compared with the control group, the expression level of immune genes of the macrobrachium rosenbergii is obviously increased at 6h,12h and 24h, but the expression level reaches the highest value at 12h (51 folds,P<0.01) (panel A in FIG. 10). AKP gene expression reached a maximum at 24h (15 folds,P<0.01) (panel B in FIG. 10). The ACP gene expression level increased significantly at 2h, and the 24h expression level increased to the highest value (52 folds,P<0.01however, the Saccharomyces cerevisiae MrLectin fed group had higher gene expression levels than the two control fed groups (panel C in FIG. 10). SOD gene expression levels were up-regulated within 12h to 24h after infection with aeromonas hydrophila (panel D in fig. 10). The CAT gene expression level was up-regulated at 6h to 12h and reached a maximum peak at 12h (33 folds,P<0.01) (FIG. 10, E). According to the research results, the results show that after the organism is infected by aeromonas hydrophila, the immune gene expression quantity in the organism is higher and obvious after the macrobrachium rosenbergii fed with the pellet feed group compounded with the saccharomyces cerevisiae MrLectin engineering strain is infected by aeromonas hydrophilaThe strain is higher than a compound saccharomyces cerevisiae empty pellet feed group and a common pellet feed group, which shows that the saccharomyces cerevisiae MrLectin engineering strain effectively enhances the organism immunity of the macrobrachium rosenbergii, and can express more immune genes to participate in innate immunity when being infected by pathogenic bacteria. Therefore, the saccharomyces cerevisiae recombinant MrLectin strain is an immune strain with better potential, can improve the organism immunity level of crustaceans, and can increase the resistance to crustacean pathogen-aeromonas hydrophila.

Sequence listing

<110> Jiangsu agricultural and forestry technical college of occupational technology

<120> Saccharomyces cerevisiae engineering bacteria, construction method and application thereof

<140> 202210419586X

<141> 2022-04-21

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 990

<212> DNA

<213> Macrobrachium rosenbergii Lectin gene sequence (Macrobrachium rosenbergii Lectin gene)

<400> 1

atgtggcatt caaggggctt catcctactt ttatgcgctg tgcagttgct gctgccctgt 60

tcagctgcga cctctgactg ggagctgcag atggattccc ctaaactgac atgcccagcc 120

ttctttcaaa atgttggcga tcagtgcctc ttctttagtt tcatggaacc tacagattac 180

aagtcagcga agcaattctg cggcggtcta caagcttcct tgatagttat caatagcact 240

actcagttcg aaaacatcat ccatttcatc tactcgcaag gatacgaatc ctccttctgg 300

gtcgacggtt ccgaccttaa gaatgaaggt gactggagag actcgcacaa caaagcagtc 360

gtcatgaata cccccttctg gttggcttct gagtcacact acaaacctaa caacgacact 420

gaggcaaact gcattgcact cgaaagcacg tacggtttct tcatgaacga cgtcgattgt 480

gaatccgacc acagcgctct ctgcgaatac cccgcgacag tcgaagagag cgttgacgaa 540

gaaaaggcga ctgttgaatg tcctgttttc tttgtggatg tcggtggcac ctgcctggcc 600

ttcgtcattt gggaagaagt tgtgtgggaa gaagccaata tcccctgtat cggcatcgaa 660

ggcgaactgg ctattttgga caacatacaa cagctcagag atatttatga gtacctgcat 720

gaccatgaaa tctatgaaca ttccttctgg atcggaggat cggacacggt aacagaaggg 780

gaatgggtct ggaatgataa cagtactgtt accatgggta gtccttggtg gggttttagc 840

gaatatgaaa cgggcaactg gacccaagag ccagacggta acgacgaaga gaactgcctt 900

gctctaacct cagaggggca tcattacctt agagacaaag actgttctga actactcagt 960

cctctctgca tggtcagcag atacaaccta 990

<210> 2

<211> 100

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

caaatgtaat aaaagtatca acaaaaaatt gttaatatac ctctatactt taacgtcaag 60

gagaaaaaac ccggatctca aaatgtggca ttcaaggggc 100

<210> 3

<211> 102

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

tatggacgag gtaataagga aactcagaac cagaatagtg gcatgagctc tccaatttaa 60

catatttgcc attagtgacc cgatgataag ctgtcaaaca tg 102

<210> 4

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

cctggcccca caaaccttc 19

<210> 5

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

taggttgtat ctgctgacc 19

<210> 6

<211> 330

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 6

Met Trp His Ser Arg Gly Phe Ile Leu Leu Leu Cys Ala Val Gln Leu

1 5 10 15

Leu Leu Pro Cys Ser Ala Ala Thr Ser Asp Trp Glu Leu Gln Met Asp

20 25 30

Ser Pro Lys Leu Thr Cys Pro Ala Phe Phe Gln Asn Val Gly Asp Gln

35 40 45

Cys Leu Phe Phe Ser Phe Met Glu Pro Thr Asp Tyr Lys Ser Ala Lys

50 55 60

Gln Phe Cys Gly Gly Leu Gln Ala Ser Leu Ile Val Ile Asn Ser Thr

65 70 75 80

Thr Gln Phe Glu Asn Ile Ile His Phe Ile Tyr Ser Gln Gly Tyr Glu

85 90 95

Ser Ser Phe Trp Val Asp Gly Ser Asp Leu Lys Asn Glu Gly Asp Trp

100 105 110

Arg Asp Ser His Asn Lys Ala Val Val Met Asn Thr Pro Phe Trp Leu

115 120 125

Ala Ser Glu Ser His Tyr Lys Pro Asn Asn Asp Thr Glu Ala Asn Cys

130 135 140

Ile Ala Leu Glu Ser Thr Tyr Gly Phe Phe Met Asn Asp Val Asp Cys

145 150 155 160

Glu Ser Asp His Ser Ala Leu Cys Glu Tyr Pro Ala Thr Val Glu Glu

165 170 175

Ser Val Asp Glu Glu Lys Ala Thr Val Glu Cys Pro Val Phe Phe Val

180 185 190

Asp Val Gly Gly Thr Cys Leu Ala Phe Val Ile Trp Glu Glu Val Val

195 200 205

Trp Glu Glu Ala Asn Ile Pro Cys Ile Gly Ile Glu Gly Glu Leu Ala

210 215 220

Ile Leu Asp Asn Ile Gln Gln Leu Arg Asp Ile Tyr Glu Tyr Leu His

225 230 235 240

Asp His Glu Ile Tyr Glu His Ser Phe Trp Ile Gly Gly Ser Asp Thr

245 250 255

Val Thr Glu Gly Glu Trp Val Trp Asn Asp Asn Ser Thr Val Thr Met

260 265 270

Gly Ser Pro Trp Trp Gly Phe Ser Glu Tyr Glu Thr Gly Asn Trp Thr

275 280 285

Gln Glu Pro Asp Gly Asn Asp Glu Glu Asn Cys Leu Ala Leu Thr Ser

290 295 300

Glu Gly His His Tyr Leu Arg Asp Lys Asp Cys Ser Glu Leu Leu Ser

305 310 315 320

Pro Leu Cys Met Val Ser Arg Tyr Asn Leu

325 330

Claims

1. Saccharomyces cerevisiae @Saccharomyces cerevisiae) The application of the MrLectin engineering strain in preparing at least one feed immune probiotics is characterized in that the construction method of the Saccharomyces cerevisiae MrLectin engineering strain is that a gene segment MrLectin shown as SEQ ID NO.1 is cloned into a pHAC181 expression vector to obtain a recombinant expression vector, and the recombinant expression vector is integrated into the Saccharomyces cerevisiae strainGAL1The saccharomyces cerevisiae MrLectin engineering bacteria can be obtained at the downstream of the promoter;

a. reducing aeromonas hydrophilaAeromonas hydrophila) Feed immune probiotics for the death rate of the macrobrachium rosenbergii after infection;

b. an immune probiotics for feed, which improves the activity of alkaline phosphatase, acid phosphatase, superoxide dismutase and catalase of macrobrachium rosenbergii after being infected by aeromonas hydrophila;

c. feed immunopotentiator for improving expression level of immune genes of liver and pancreas tissues of macrobrachium rosenbergii after infection of aeromonas hydrophila, wherein the immune genes are Lectin gene, alkaline phosphatase AKP, acid phosphatase ACP, superoxide dismutase SOD and catalase H ₂ O ₂ And (3) a gene.

2. The application of claim 1, wherein the added amount of the saccharomyces cerevisiae mrlecin engineering strain in the feed is 0.2-0.5%.