CN115161209A

CN115161209A - Saccharomyces cerevisiae engineering strain capable of effectively improving organism immunity of aquatic animals, construction method and application

Info

Publication number: CN115161209A
Application number: CN202210518144.0A
Authority: CN
Inventors: 杜婕; 颜子豪; 王煜轩; 李志刚; 黄颖; 刘庆新; 许俊齐
Original assignee: Jiangsu Polytechnic College of Agriculture and Forestry
Current assignee: Jiangsu Polytechnic College of Agriculture and Forestry
Priority date: 2022-05-13
Filing date: 2022-05-13
Publication date: 2022-10-11

Abstract

The invention discloses a saccharomyces cerevisiae engineering strain for effectively improving the organism immunity of aquatic animals, a construction method and application thereof. The saccharomyces cerevisiae engineering strain is constructed by the following method: cloning the gene segment shown as SEQ ID NO.1 into an expression vector to obtain a recombinant expression vector, and integrating the recombinant expression vector with a saccharomyces cerevisiae strain to obtain the saccharomyces cerevisiae engineering bacteria. The saccharomyces cerevisiae engineering bacteria obtained by the invention can be used as an aquaculture or aquatic animal feed immune microbial inoculum, a feed improvement microbial inoculum or a probiotic microbial inoculum, so that the disease resistance of aquatic animals can be improved, and the immune index of the aquatic animals is obviously improved.

Description

Saccharomyces cerevisiae engineering strain capable of effectively improving organism immunity of aquatic animals, construction method and application

Technical Field

The invention relates to the field of aquaculture, in particular to a saccharomyces cerevisiae engineering strain capable of effectively improving organism immunity of aquatic animals, a construction method and application.

Background

The aquaculture industry is prominent in the world economic system as an indispensable food and economic source for human beings. Crustaceans are the largest group of aquatic animals. In recent years, the diseases of crustaceans become more serious, and huge economic losses are brought to the aquaculture industry. Crustaceans lack the acquired specific immune function, but they have a well-established innate immune system that rapidly recognizes and effectively eliminates invading microorganisms. The innate immune mechanisms of crustaceans include the barrier action of the crustacean and mucus, phagocytosis of the reticuloendothelial system, and nonspecific humoral molecules. During the immune process of the body, superoxide anion is generated in large amount in the body ^. O ^2– ) Hydrogen peroxide (H) ₂ O ₂ ) Hydroxyl ion (OH) ^- ) And singlet oxygen: ( ¹ O ² ) And Reactive Oxygen Species (ROS), including the reactive oxygen species (ROI), which crustaceans need to synthesize in time antioxidant enzymes to scavenge. The most important antioxidant enzyme is Superoxide Dismutase (SOD), which can effectively remove oxygen free radicals and avoid damage to cells. Therefore, SOD is an important immune factor in the innate immunity of crustaceans.

Currently, the research on crustacean immune protein mostly adopts a mode of E.coli prokaryotic expression of target protein, which is easy to generate protein inclusion bodies to cause activity reduction and is difficult to purify, because Escherichia coli lacks a post-translational processing modification system (such as glycosylation, phosphorylation and the like) specific to eukaryotic cells, aiming at the proteins needing modification, active products cannot be obtained by using the Escherichia coli expression system, high-level expression of the proteins often forms inclusion bodies, extraction and purification steps are complicated, the protein renaturation is difficult, and the problems of error folding of peptide chains and the like are easy to occur. Saccharomyces cerevisiae is a good eukaryotic gene expression system, and the protein product has good expression activity and solubility and is widely used for biological production. And the saccharomyces cerevisiae serving as food-grade safe saccharomyces cerevisiae has an obvious effect in aquaculture. Firstly, the microzyme can provide nutrition for aquaculture animals such as shrimps, crabs and the like, promote the absorption of nutrient substances, secondly can inhibit pathogenic bacteria and adjust the intestinal microecological balance, and in addition, the microzyme can also be used for adjusting the aquaculture water quality. Therefore, how to realize the yeast activity expression of superoxide dismutase SOD from crustaceans and apply the engineering strain as a feed immunity microbial inoculum to aquaculture and effectively improve the shrimp organism immunity is a problem to be solved at present.

Disclosure of Invention

The invention aims to: aiming at the problems, the saccharomyces cerevisiae engineering strain for effectively improving the immunity of aquatic animal organisms is constructed, the important immune factor superoxide dismutase SOD of the Macrobrachium rosenbergii (Macrobrachium rosenbergii) is subjected to active expression, meanwhile, the recombinant protein strain is added into the feed as a feed immune microbial agent and fed to the Macrobrachium rosenbergii, and the immune index determination and the pathogenic bacteria infection experiment verify that the recombinant protein strain effectively promotes the improvement of the immunity of the shrimp organisms. The invention also provides a construction method and application of the saccharomyces cerevisiae engineering strain.

The technical scheme is as follows: the invention provides a saccharomyces cerevisiae engineering bacterium, which is constructed by the following method: cloning the gene segment shown as SEQ ID NO.1 into an expression vector to obtain a recombinant expression vector, and integrating the recombinant expression vector with a saccharomyces cerevisiae strain to obtain the saccharomyces cerevisiae engineering bacteria.

The invention adopts food-grade safe biological saccharomyces cerevisiae, constructs saccharomyces cerevisiae engineering bacteria capable of expressing superoxide dismutase SOD, performs eukaryotic expression of target protein, greatly reduces the generation of inclusion bodies, realizes the active expression of the protein, simultaneously, the saccharomyces cerevisiae engineering bacteria are taken as saccharomyces cerevisiae of common probiotics for aquaculture, and active protein expression strains are more easily applied to the field of aquaculture, and have important significance for improving the organism immunity of shrimps and crabs, thereby promoting the green, healthy and stable development of aquaculture.

In a preferred embodiment of the present invention, the expression vector is pHAC181.

As a preferred embodiment of the present invention, the recombinant expression vector is integrated into the Saccharomyces cerevisiae strain downstream of the GAL1 promoter.

Specifically, the invention expresses macrobrachium rosenbergii superoxide dismutase (SOD) genes through a saccharomyces cerevisiae eukaryotic expression system to construct saccharomyces cerevisiae engineering bacteria for expressing the macrobrachium rosenbergii SOD, a cDNA CDS region of the macrobrachium rosenbergii superoxide dismutase MrSOD is cloned to an expression plasmid pHAC181 to obtain a recombinant plasmid pHAC181-MrSOD with correct sequencing verification, then a homologous recombination primer is designed, and the target gene MrSOD is integrated to the downstream of a GAL1 promoter of a saccharomyces cerevisiae host strain by utilizing a homologous recombination technology. The engineering strain can express a large amount of target protein MrSOD under the induction of galactose.

The nucleotide sequence of the CDS region of the MrSOD cDNA of the invention is shown as follows:

atggcgaagtgcttacaagtcgtctgcttcgtggtgggagccatttgtttcgcagctgtcggtgcaggcttcgctgtgctcttcatgaactactcacacgatggctcgcctaacgaggaggttcatgcggagtgcgttctgactcaaaatcctgatgaagccggagatgtggctgggacaatcgtttttcaccacatgagaggctctaccaccattcatatcgaaggcaacgtcacaggtctgactccgggactccacggcttccacattcacacctatggcgtcgttggtggcgactgcggggcagccgccgcgcattacaaccccgacggattcgtccatggcgggcctgatgccgaaataagacacgttggtgatttgggaaacatcgagagcgatgaagagggaattgctcatgttgacattcatgatgaaatagtgtcactgtacggggacagagcagttgtaggtcgaagcgtggttgtccatgccaaagaggacgacttaggactaggtggtgacgaaggttccctaacaactggcaatgctggagctagattggcttgctgcaccattttcttggcgccccacgacttagaaaat(SEQ ID NO.1)。

the invention also provides a construction method of the saccharomyces cerevisiae engineering bacteria, which comprises the following steps:

(1) Cloning a gene fragment MrSOD shown as SEQ ID NO.1 onto an expression plasmid pHAC181 to obtain a recombinant expression plasmid pHAC181-MrSOD, transferring the obtained recombinant expression plasmid pHAC181-MrSOD into an escherichia coli competent cell transT1, and coating the escherichia coli competent cell transT1 on a LA (lactic acid) plate for overnight culture;

(2) Integrating the nucleotide fragment containing the MrSOD gene into the downstream of the GAL1 promoter in the saccharomyces cerevisiae strain by using a homologous recombination technology for the positive transformant obtained in the step (1).

As a preferred embodiment of the invention, the saccharomyces cerevisiae engineering bacteria are constructed according to the following method: (1) Performing PCR amplification synthesis by using cDNA of Macrobrachium rosenbergii as a template to obtain MrSOD gene fragment with a nucleotide sequence shown as SEQ ID NO. 1; (2) Cloning the MrSOD gene fragment onto an expression plasmid pHAC181 to obtain a recombinant expression plasmid pHAC181-MrSOD; (3) Designing a homologous recombination primer, amplifying plasmid pHAC181-MrSOD to obtain a nucleotide fragment containing the MrSOD gene, and integrating the nucleotide fragment into the downstream of the GAL1 promoter in the saccharomyces cerevisiae strain by using a homologous recombination method.

In addition, after the strain constructed above was induced and cultured in YPG medium for 6 hours, strain proteins were extracted.

Further, western blot detection verifies that the strain expressed by the target protein is a yeast engineering strain successfully constructed.

As a preferred embodiment of the present invention, in the step (2), the amplification primers are shown as SEQ ID NO.2 and SEQ ID NO. 3.

The recombinant plasmid contains a gene segment shown as SEQ ID NO. 1.

The method for expressing the protein by using the saccharomyces cerevisiae engineering bacteria comprises the following steps: inoculating the single bacterial colony of the saccharomyces cerevisiae engineering bacteria into an SD-Leu culture medium for overnight culture, transferring the culture into an YPG culture medium the next day, and extracting bacterial strain proteins after galactose induction culture.

The invention also provides a feed immune microbial inoculum containing the saccharomyces cerevisiae engineering bacteria.

The constructed saccharomyces cerevisiae engineering bacteria (saccharomyces cerevisiae SOD engineering strains) can be well applied to aquaculture, so that the death rate of infected pathogenic bacteria is effectively reduced, and the immunity of the shrimp body is improved. The specific application method comprises the following steps: after the saccharomyces cerevisiae engineering bacteria are subjected to expanded culture, thalli are concentrated and collected, the thalli are uniformly mixed with feed after being dried in the shade, after the saccharomyces cerevisiae engineering bacteria are fed to macrobrachium rosenbergii as a feed additive for one month, a pathogenic bacteria infection experiment and the detection of the death rate of a feed individual fed with the compounded engineering strain, the determination of enzyme activity of immune indexes (SOD, CAT, ACP, AKP, LGBP and Lectin) and the expression quantity of immune genes (SOD, CAT, ACP, AKP, LGBP and Lectin) are carried out, and the disease resistance and the immune indexes of the shrimp individual fed with the saccharomyces cerevisiae engineering strain are found to be obviously improved compared with those of other groups.

In a preferred embodiment of the invention, the addition amount of the saccharomyces cerevisiae engineering bacteria in the feed is 0.2-0.5%. As a preferable embodiment, the specific addition amount of the saccharomyces cerevisiae engineering bacteria in the feed is 0.3%.

The invention further provides application of the saccharomyces cerevisiae engineering bacteria in feed immune bacteria, feed improvement bacteria or probiotic. The constructed saccharomyces cerevisiae SOD engineering strain is applied to aquaculture, and the immunity of shrimp organisms is effectively improved.

In the present invention, "%" is a mass% unless otherwise specified.

Has the advantages that: (1) The saccharomyces cerevisiae engineering bacteria constructed by the invention can realize the mass expression of the macrobrachium rosenbergii superoxide dismutase MrSOD and the active expression without inclusion bodies; the MrSOD obtained by the fermentation of the engineering bacteria has activity, and 0.072mg of protein can be obtained in each mL of fermentation liquid after 6 hours of induced culture. (2) The constructed saccharomyces cerevisiae engineering bacteria MrSOD realize the mass expression of the superoxide dismutase MrSOD of the macrobrachium rosenbergii, the engineering strains are cultured in a large amount, concentrated and compounded into the granulated feed, and infected by pathogenic bacteria after being fed, so that the mortality of the infection of vibrio parahaemolyticus can be effectively reduced by the engineering strains, compared with other groups, the mortality is reduced by 21.1 percent, and the expression quantities of organism immunity index enzyme activities (SOD, CAT, ACP, AKP) and immunity genes (SOD, CAT, ACP, AKP, LGBP and Lectin) of the macrobrachium rosenbergii in the feed granulated group compounded with the saccharomyces cerevisiae engineering strains are obviously higher than those of other groups. (3) The successfully constructed saccharomyces cerevisiae engineering strain MrSOD effectively promotes the immunity of shrimp organisms, the research and development of a novel feed protein source and an immune feed probiotic at present become key technologies for promoting the healthy development of modern aquaculture industry, and the saccharomyces cerevisiae engineering strain not only can further research the protein function of important immune genes of crustaceans, but also can provide scientific basis and a novel method for developing healthy and safe novel immune feed microbial or probiotic.

Drawings

FIG. 1 is a schematic diagram of the construction of Saccharomyces cerevisiae MrSOD.

FIG. 2 shows the amplified band (603 bp) of the superoxide dismutase MrSOD cDNA of Macrobrachium rosenbergii.

FIG. 3 shows the colony PCR verification of positive transformants when the Macrobrachium rosenbergii superoxide dismutase MrSOD cDNA was cloned onto the vector pHAC181, wherein

Line

1,3,4,5,6,8,9,10,11,12,13,14,15,17,18,20,22,23 is the correct transformant.

FIG. 4 shows the restriction enzyme digestion verification of positive transformants when the superoxide dismutase MrSOD of Macrobrachium rosenbergii is cloned to the pHAC181, wherein

Line

1,2,3,4,5,6,7,9 is the correct positive transformant.

FIG. 5 shows the result of amplification of recombinant plasmid pHAC181-MrSOD by the high fidelity enzyme PrimeSTAR GXL (4985 bp).

FIG. 6 shows the results of detection of homologous recombination of pHAC181-MrSOD and a strain containing GAL1 promoter by using detection primers, wherein the band of successful homologous recombination is 886bp, wherein

Line

1,8 and 12 are correct transformants.

FIG. 7 shows that the expression of Gal1-pHAC181-MrSOD protein is detected by Western blot, and the target protein is 30KD according to a protein Marker.

FIG. 8 shows the experiment of pathogenic bacteria (Vibrio parahaemolyticus) infection and the statistics of mortality rate of macrobrachium rosenbergii fed with different feeds for one month, wherein PBS is an injection control group, and the experiment shows that the mortality rate of macrobrachium rosenbergii fed with the engineered strain pellet feed compounded with Saccharomyces cerevisiae MrSOD is the lowest in the Vibrio parahaemolyticus infection group.

FIG. 9 shows the relative immunoenzyme activity changes in the hepatopancreas of Macrobrachium rosenbergii at 0,2,6,12,24 and 48 hours after Vibrio parahaemolyticus infection, in which Macrobrachium rosenbergii injected with PBS was used as a control and the A-diagram shows the SOD enzyme activity measurement results; the result of CAT enzyme activity determination is shown in the B picture; c picture is AKP enzyme activity determination result; the D picture is the ACP enzyme activity determination result; bar values represent the average of six determinations with standard error, asterisks indicate significant differences (. P.sub.0.05,. P.sub.0.01).

FIG. 10 shows RT-PCR detection of the immune gene expression level in the hepatopancreas of Macrobrachium rosenbergii after 0,2,6,12,24 and 48 hours of Vibrio parahaemolyticus infection, with β -actin as an internal reference gene; wherein, A picture is SOD gene expression level; the B picture is CAT gene expression level; c is AKP gene expression level; FIG. D shows ACP gene expression levels; the E picture is the LGBP gene expression level; f is expression level of Lectin gene; bar values represent the average of six determinations with standard error, asterisks indicate significant differences (. P <0.05,. P < 0.01).

Detailed Description

In the invention, firstly, a gene cloning technology is adopted, and specifically, the method comprises the following steps: extracting RNA of macrobrachium rosenbergii, and performing reverse transcription on the RNA into cDNA by using a reverse transcription kit. The high fidelity PCR enzyme is used to amplify the target gene segment MrSOD. The amplified gene fragment was ligated to vector pHAC181, transferred into competent E.coli cells transT1, and plated on LA plates for overnight culture at 37 ℃. And carrying out enzyme digestion verification and sequencing verification on the positive transformants obtained on the LA plate. Secondly, integrating a plasmid pHAC181 with a target gene MrSOD into the downstream of a GAL1 promoter in a Saccharomyces cerevisiae strain GAL1-ScRCH1 by utilizing a homologous recombination technology, extracting protein after the successfully integrated strain is induced and cultured in a YPG culture medium for 6 hours, and detecting Western blot. The bacterial strain with the successful expression of the target protein is the yeast engineering bacteria with the successful construction.

Composition of LA medium: 10g/L peptone, 5g/L, naCl g/L yeast extract, and 12g/L agar, and adjusting pH to 7.0, 100mg/mL Amp antibiotic (120 ℃,20 min).

Composition of SD-Leu Medium: it contained 1.7g/L yeast nitrogen source (without AA), 5g/L ammonium sulfate, 20g/L glucose, 10 × AA mix (-Ura, -leu, -His) 100mL,100 × Ura 10mL,100 × His 10mL, and agar 20g/L (120 ℃,20 min).

Composition of YPG medium: 20g/L D-galactose, 20g/L peptone and 10g/L yeast extract (115 ℃,20 min).

Example 1: construction of Saccharomyces cerevisiae genetically engineered bacteria (Gene cloning and homologous recombination)

The overall construction strategy of the saccharomyces cerevisiae gene engineering bacteria is shown in figure 1. The high expression plasmid pHAC181-MrSOD is constructed by extracting the RNA of the macrobrachium rosenbergii tissue and reversely transcribing the RNA into cDNA by a reverse transcription kit (figure 2). PCR amplification is carried out on the target gene segment MrSOD by using high fidelity PCR enzyme, the CDS region (not containing a stop codon) of the amplified MrSOD gene segment is 603bp in total, then the segment is cloned to a multiple cloning site of the high expression plasmid pHAC181, positive transformants are verified by colony PCR and enzyme digestion (the result is shown in figure 3 and figure 4), correct recombinants are selected for DNA sequencing, the sequence is verified to be not mutated, and the recombinant high expression plasmid pHAC181-MrSOD is obtained.

Designing a homologous recombination primer according to the constructed recombinant high expression plasmid pHAC181-MrSOD, amplifying the plasmid pHAC181-MrSOD by using high fidelity PrimeSTAR GXL enzyme, wherein the successfully amplified long fragment is 4985bp (figure 5), and integrating the successfully amplified long fragment into the downstream of a GAL1 promoter in the saccharomyces cerevisiae strain.

The homologous recombination primers are F1 and R1, and the sequences are shown as follows:

F1：caaatgtaataaaagtatcaacaaaaaattgttaatatacctctatactttaacgtcaaggagaaaaaacccggatctcaaaatggcgaagtgcttacaagtc(SEQ ID NO.2)

R1：tatggacgaggtaataaggaaactcagaaccagaatagtggcatgagctctccaatttaacatatttgccattagtgacccgatgataagctgtcaaacatg(SEQ ID NO.3)

the specific steps of gene homologous recombination (integration) are as follows:

1. activated GAL1-ScRCH1 strain was picked as a single colony, inoculated into 3mL of YPD medium, and cultured at 30 ℃ and 220rpm overnight.

2. Inoculating 300uL of overnight culture into 4.7mL of 2 × YPD, and culturing at 30 deg.C for 4-5 h (OD 600= 0.6-1.0);

3. 5mL of the resulting suspension was divided into 3 tubes, centrifuged at 4000rpm for 1min at room temperature, the supernatant was discarded, resuspended in 1mL of water and pooled in 1 EP tube, centrifuged at 3000rpm for 1min, and the supernatant was discarded.

4. 100uL of 0.1M LiAc solution was added, mixed by pipetting, centrifuged at 12000rpm for 10s, and the supernatant was discarded.

5. And (4) repeating the step.

6. The following materials were added in sequence, gently mixed after addition:

7. mixing, and incubating in 30 deg.C water bath for 30min;

incubating in water bath at 9.42 deg.C for 30min (heat shock);

5363 and centrifuging at 10.3000 rpm to remove supernatant, re-suspending the thallus with 1mL of sterile water, centrifuging at 3000rpm for 1min, discarding supernatant, reserving 100uL of bacterial liquid, spreading on a selection plate (SD-LEU), and culturing at 30 ℃ for 3-5 days.

11. The grown transformants were streaked out on SD-LEU plates. Inoculating the single colony in YPD culture medium for overnight culture, extracting transformant genome, performing PCR detection by using detection primers DF and DR, wherein the transformant amplified by the target fragment is the strain GAL1-pHAC181-MrSOD successfully recombined homologously.

The detection primers for homologous recombination are DF and DR, and the sequences are shown as follows:

DF:cctggccccacaaaccttc(SEQ ID NO.4)

DR:attttctaagtcgtggggcg(SEQ ID NO.5)

colony PCR detection is carried out on the positive transformant after homologous recombination by using a detection primer, and the successfully amplified target band (886 bp) is the successfully homologous recombination plasmid (figure 6).

A colony PCR preparation system and steps:

the system is mixed evenly and centrifuged for a short time to lead the solution to gather at the bottom of the tube, and the PCR reaction procedure adopts: pre-denaturation at 95 ℃ for 30s, denaturation at 95 ℃ for 5s, annealing at 60 ℃, extension at 72 ℃ for 30s,40 cycles, preservation at 72 ℃ for 10min and 4 ℃.

Example 2: protein expression of engineering strain and Western blot detection

The single colony of the Gal1-pHAC181-MrSOD strain successfully recombined in the homologous way is inoculated in 5mL of SD-LEU culture medium for overnight culture, the culture is transferred to 45mLYPG culture medium the next day, and after galactose induction culture for 6h (OD detection is 1.2-1.5), the strain protein is extracted. The extracted protein is used for Western blot detection.

The method comprises the following specific steps:

(I) extraction of Total protein from cells

1. Picking single colony to be cultured in required liquid culture medium overnight at 30 ℃ until saturation;

2. 5mL of overnight-cultured broth was added to 45mL of fresh liquid medium and shake-cultured in a shaker at 30 ℃ for about 6h (OD = 1.2-1.5) (rotation speed 220 rmp);

3. collecting thallus at 8000rpm/1min, and removing the upper liquid;

4. resuspending the cells with pre-cooled double distilled water, and centrifuging to remove the supernatant;

5. adding a precooled PEB (Protein Extraction Buffer) which is equal to the thallus, and adding 100 times PMSF into the PEB;

6. adding acid-washed glass beads with the same volume as the thalli;

7. oscillating the EP tube for 10 × 30s on an oscillating mixer, and putting on ice for 1min after each oscillation;

8. centrifuging at 12000rpm for 10min, sucking supernatant, storing on ice, and discarding precipitate;

9. detecting the concentration (OD 595) by a Coomassie brilliant blue method, and adjusting the concentration of the sample to be consistent;

10. adding 5 XSB, decocting at 95 deg.C for 5min.

Detection of protein concentration by Coomassie brilliant blue method

1. Preparation of standard protein solution: 10mg of BSA solid was weighed and dissolved in 1mL of water to obtain a 10mg/mL solution as a standard stock solution. Serial dilutions of the standard protein solutions were prepared using standard stock solutions at concentrations of 1.2mg/mL, 1.0mg/mL, 0.8mg/mL, 0.6mg/mL, 0.4mg/mL, 0.2mg/mL, and 0.1mg/mL, respectively.

2. Preparing a protein solution to be detected: the sample to be tested is diluted to a concentration between 0.1mg/mL and 1.2 mg/mL. (dilution 15 times according to experience)

3.4 uL of dye solution and 200uL of protein solution are mixed evenly and kept stand for 3min. Protein concentrations were determined according to the "protein" program of the nucleic acid protein analyzer.

In the experiment, the concentration of the MrSOD protein expressed by the saccharomyces cerevisiae is measured to be 18ug/uL. The protein concentration is 0.072mg/mL after conversion, namely 0.072mg protein is obtained per mL fermentation liquid.

(III) SDS-PAGE

1. Assembling the device; 2. preparing glue; 3. preparing a protein sample; 4. and (4) loading, pre-staining a Marker in a spot manner, and carrying out electrophoresis. 80V of concentrated gel and 100V of separation gel.

(IV) transfer printing (dipping method)

(V) sealing, namely adding sealing liquid for sealing, and slightly shaking for 1-4 h by using a shaking table

Sixthly, adding primary antibody 1, and slightly transferring the confining liquid; 2. adding primary antibody hybridization solution, and standing overnight at room temperature for 2h or 4 deg.C

Seventhly, adding the secondary antibody 1, gently transferring the primary antibody hybridization solution (which can be repeatedly used), and washing for 3 times by using TBST (tert-butyl ether-trimethyl ammonium bromide), wherein each time lasts for 10min; 2. adding a second antibody hybridization solution, and gently shaking at room temperature for 2h; 3. the membrane was washed 3 times with TBST for 10min each time.

(eighth) reaction

(nine) Exposure development-operation in dark light

After the development, gal1-pHAC181-MrSOD target protein expression is detected according to the comparison of a protein Marker, the molecular weight is 30KD, and the strains are the saccharomyces cerevisiae MrSOD immune protein engineering strains which are successfully constructed (the result is shown in figure 7).

The target protein has the amino acid sequence as follows: met Ala Lys Cys Leu Gln Val Val Cys Phe Val Val Gly Ala Ile Cys Phe Ala Ala Val Gly Ala Gly Phe Ala Val Leu Phe Met Asn Tyr Ser His Asp Gly Ser Pro Asn Glu Glu Val His Ala Glu Cys Val Leu Thr Gln Asn Pro Asp Glu Ala Gly Asp Val Ala Gly Thr Ile Val Phe His His Met Arg Gly Ser Thr Thr Ile His Ile Glu Gly Asn Val Thr Gly Leu Thr Pro Gly Leu His Gly Phe His Ile His Thr Tyr Gly Val Val Gly Gly Asp Cys Gly Ala Ala Ala Ala His Tyr Asn Pro Asp Gly Phe Val His Gly Gly Pro Asp Ala Glu Ile Arg His Val Gly Asp Leu Gly Asn Ile Glu Ser Asp Glu Glu Gly Ile Ala His Val Asp Ile His Asp Glu Ile Val Ser Leu Tyr Gly Asp Arg Ala Val Val Gly Arg Ser Val Val Val His Ala Lys Glu Asp Asp Leu Gly Leu Gly Gly Asp Glu Gly Ser Leu Thr Thr Gly Asn Ala Gly Ala Arg Leu Ala Cys Cys Thr Ile Phe Leu Ala Pro His Asp Leu Glu Asn

Example 3: saccharomyces cerevisiae MrSOD engineering strain for effectively improving shrimp organism immunity

(1) Expanding culture and concentration of yeast engineering strain

And carrying out laboratory amplification culture on the constructed saccharomyces cerevisiae MrSOD engineering strain successfully. The engineering strain is cultured by a 500mL triangular flask, then is subjected to amplification culture to 1L,3L and 5L, the cultured engineering strain is subjected to centrifugal filtration, and the thalli are placed at room temperature for natural drying. The dried thalli and shrimp pellet feed are mixed, after the shrimp pellet feed is dried in the air, the feed mixed with the recombinant yeast strain is fed to the macrobrachium rosenbergii (the addition amount is 0.3 percent), and a control group is set at the same time. Observing the influence of the feed containing the recombinant engineering strain and the common feed on the macrobrachium rosenbergii when the feeds are fed. The feeding period is one month.

(2) Macrobrachium rosenbergii organism pathogenic bacteria infection and mortality determination

300 macrobrachium rosenbergii with uniform size (about 20 g) are purchased from the local aquatic product market. Feeding different feeds to the feed in groups: experimental groups: the common shrimp pellet feed is compounded with a yeast MrSOD engineering strain (the addition amount of the saccharomyces cerevisiae engineering strain in the feed is 0.3%); control group one: the common shrimp pellet feed is compounded with an unloaded saccharomyces cerevisiae strain; control group two: common shrimp pellet feed. The feeding amount is 4% of the body weight, and the feeding is carried out for 4 weeks in the morning and evening. After 1 month useVibrio parahaemolyticus 3.0X 10 ⁶ cfu 50uL shrimp bodies were infected by injection, while 50uL PBS injection was set as a control group. The cumulative mortality is counted for 0,2,6,12,24 and 48 hours after vibrio parahaemolyticus infection, and the results show that after 4 weeks of feeding, the mortality of the macrobrachium rosenbergii fed with saccharomyces cerevisiae MrSOD granules is lowest (the cumulative mortality value is 68.2%), the mortality of the macrobrachium rosenbergii fed with common granules is highest at 89.3%, and the mortality of the macrobrachium rosenbergii fed with unloaded S.cerevisiae feed is higher than that of the group fed with MrSOD granules but lower than that of the group fed with common granules (figure 8), which shows that the recombinant yeast MrSOD engineering strain can effectively reduce the mortality after pathogenic bacteria infection.

(3) Macrobrachium rosenbergii hepatopancreas tissue immunoenzyme activity and immunogene expression amount determination

The liver pancreas tissue is taken for measurement of immune indexes including the measurement of the activity of the immunoenzyme and the expression change of the immunogene after 0,2,6,12,24 and 48h after vibrio parahaemolyticus infection. Wherein the measured immunoenzyme activities comprise: alkaline phosphatase (AKP); acid phosphatase (ACP); superoxide dismutase (SOD) and Catalase (CAT).

The method comprises the following specific steps: and (3) placing about 0.1g of hepatopancreas into 1mL0.6% physiological saline for homogenization (operation on ice), centrifuging a homogenized hepatic tissue sample for 10min at 4 ℃ under 3500g, and using the supernatant for measuring the activity of the immunoenzyme.

Determination of alkaline phosphatase (AKP):

the alkaline phosphatase decomposes disodium phenylphosphate to generate free phenol and phosphoric acid, the phenol reacts with 4-aminoantipyrine in alkaline solution to generate red quinone derivative through potassium ferricyanide oxidation, and the absorbance of the red quinone derivative is measured by a visible light spectrophotometer according to the red shade, so that the enzyme activity can be measured. The results show that: AKP activity of macrobrachium rosenbergii fed to saccharomyces cerevisiae MrSOD group increased from 2 hours post infection and then increased and peaked at 24 hours (54.27U/g, P < 0.01) (panel a in fig. 9) whereas s. Cerevisiae unloaded pellet fed group exhibited similar enzyme activity level as the normal pellet fed group, less trend change than that observed for target protein group.

Determination of acid phosphatase (ACP):

the acid phosphatase decomposes disodium phenyl phosphate to generate free phenol and phosphoric acid, the phenol reacts with 4-aminoantipyrine in alkaline solution to generate red quinone derivative through potassium ferricyanide oxidation, and the absorbance of the red quinone derivative is measured by a visible light spectrophotometer according to the red shade, so that the enzyme activity can be measured. The results show that: ACP activity began to increase 2 hours after Vibrio parahaemolyticus infection and peaked at 24 hours in the Saccharomyces cerevisiae MrSOD group (53.41U/g, P < 0.01). Higher than the enzyme activity of the remaining two control groups (panel B in FIG. 9).

Determination of superoxide dismutase (SOD):

production of superoxide anion radical (O) by xanthine and xanthine oxidase reaction systems ^2-. ) The latter oxidizes hydroxylamine to form nitrite, and under the action of color-developing agent it can be made into purple red, and its absorbance can be measured by using visible light spectrophotometer. When the tested sample contains SOD, it has specific inhibition action on superoxide anion free radical, so that the formed nitrite is reduced, and the light absorption value of the measuring tube is lower than that of the control tube in the colorimetric process, and the SOD activity in the tested sample can be obtained by means of calculation formula. The results show that: macrobrachium rosenbergii fed the s.cerevisiae MrSOD group showed significant increases in SOD activity at 2, 12 and 48h post-infection, reaching a peak of 82.11U/g at 48h, at which time the other two control groups (the group fed S.cerevisiae empty pellets and normal pellets) also showed increases, but were lower than the s.cerevisiae MrSOD group (panel C in FIG. 9).

Determination of Catalase (CAT)

The experiment adopts a molybdate-ammonium colorimetric method to determine catalase, and the principle is that catalase catalyzes H ₂ O ₂ Decomposition to H ₂ O and O ₂ Enzymatic reaction of residual H ₂ O ₂ And forming a stable yellow compound with the ammonium molybdate, wherein the color intensity of the compound is inversely proportional to the enzyme activity, and performing colorimetric determination at 405nm to calculate the enzyme activity. The results show that: CAT enzyme activity is obviously increased in macrobrachium rosenbergii in a group for feeding saccharomyces cerevisiae MrSOD, the peak value of the enzyme activity is 35.488U/g at 24 hours after vibrio infection, and the amount of the no-load particles and common feed particles for feeding saccharomyces cerevisiae is lower than that of the common feed particlesThe level of enzyme activity observed for the target proteome (panel D in fig. 9).

The enzyme activity data show that after being impregnated by pathogenic bacteria, the macrobrachium rosenbergii fed into the group compounded with the yeast engineering bacteria MrSOD shows stronger immunological enzyme activity, which indicates that the body immunity of the macrobrachium rosenbergii in the group is higher than that of the other two groups.

(4) RT-PCR detection of macrobrachium rosenbergii hepatopancreas tissue immune gene expression change

The immune genes (SOD, CAT, AKP, ACP, LGBP and Lectin) in hepatopancreas tissues after a macrobrachium rosenbergii organism is infected with vibrio parahaemolyticus (0 h,2h,6h,12h,24h and 48h) are measured through real-time quantitative PCR (RT-PCR), and the influence of the saccharomyces cerevisiae MrSOD engineering strain on the immune gene expression quantity is detected. The method comprises the following specific steps:

tissue lysis and total RNA extraction were performed according to Trizol reagent instructions.

(1) 1mL Trizol was added to the collected hepatopancreatic tissue sample, ground sufficiently and rapidly in a 2mL homogenizer, and allowed to stand at room temperature for 5min for sufficient lysis. At this time, the sample can be stored at-70 ℃ for a long time. 12,000g for 5min, the supernatant was collected in a new centrifuge tube and the precipitate was discarded.

(2) Chloroform was added to 200. Mu.L of chloroform/mL of Trizol, followed by shaking and mixing for 15 seconds, standing at room temperature for 12min, and centrifuging at 4 ℃ for 12,000g for 15min.

(3) The upper aqueous phase (about 500-600. Mu.L) was pipetted into another centrifuge tube.

(4) 0.5mL of isopropanol/mL of Trizol was added to the mixture and mixed well, and the mixture was left at room temperature for 8min.

(5) Centrifugation is carried out at 12,000g for 10min at 4 ℃ and the supernatant is discarded, at which time the RNA settles to the bottom of the tube.

(6) Add 75% ethanol (DEPC treated) to 1mL of 75% ethanol/mL Trizol, gently shake the tube and gently suspend the pellet.

(7) Centrifuge at 8,000g for 5min at 4 ℃ and discard the supernatant.

(8) Air drying at room temperature or vacuum drying for 5-10min.

(9) Using 20-50 μ L DEPC-H ₂ And dissolving the RNA sample by using O, and fully dissolving the RNA at the temperature of 55-60 ℃ for 5-10min.

Reverse transcription of cDNA

RT reaction solution was prepared according to the following composition (reaction solution was prepared on ice).

The reverse transcription reaction conditions are 15min at 37 ℃ and 5s at 85 ℃.

Fluorescent quantitative RT-PCR detection of immune related genes

The fluorescent quantitative PCR was performed according to the instructions of the fluorescent quantitative PCR KIT SYBR Premix Ex TagTM KIT. The PCR reaction system is as follows:

the system is mixed evenly and centrifuged for a short time to lead the solution to gather at the bottom of the tube, and the RT-PCR reaction program adopts a two-step method: pre-denaturation at 95 ℃ for 30s, denaturation at 95 ℃ for 5s, annealing at 60 ℃ and extension for 30s, and 40 cycles. The concentration of the cDNA template is searched for from the plotted melting curve. Relative expression of genes employed 2 ^-ΔΔCt And (delta. Ct = (Ct target gene-Ct housekeeping gene) experimental group- (Ct target gene-Ct housekeeping gene) control) calculation, and before the CT method is used, the amplification efficiency of the target gene and the housekeeping gene is basically consistent. PBS stimulation group is used as blank control, actin beta-actin gene is used as reference gene, t-test is adopted for data analysis, and when P is detected<0.01 was judged as a significant difference.

The results show that: in the s.cerevisiae MrSOD feeding group, the mRNA expression levels of the immune genes LGBP, AKP, CAT reached a peak 12 hours after infection with Vibrio parahaemolyticus (FIG. 10, panel E, FIG. 10, panel C, and FIG. 10, panel B), whereas the mRNA expression levels of ACP (FIG. 10, panel D) and Lectin reached a peak 24 hours after infection, and SOD mRNA transcription (FIG. 10, panel A) began to increase 6 hours after infection and continued to increase 48 hours to a maximum of 210-fold (P < 0.01). The expression quantity change of the immune genes also indicates that the expression quantity of the immune genes in the macrobrachium rosenbergii fed into the pellet feed group compounded with the saccharomyces cerevisiae MrSOD engineering strain is higher after the organism is infected by vibrio parahaemolyticus, and is obviously higher than that of the compounded saccharomyces cerevisiae no-load pellet feed group and the common pellet feed group, which indicates that the saccharomyces cerevisiae MrSOD engineering strain effectively enhances the immunity of the macrobrachium rosenbergii organism, and the organism can express more immune genes to participate in the innate immunity when being infected by pathogenic bacteria.

Sequence listing

<110> Jiangsu academy of agriculture, forestry, and occupational technology

<120> saccharomyces cerevisiae engineering strain capable of effectively improving organism immunity of aquatic animals, construction method and application

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 603

<212> DNA

<213> Macrobrachium rosenbergii SOD gene (2 AmbystMacrobrachium rosenbergii SOD gene)

<400> 1

atggcgaagt gcttacaagt cgtctgcttc gtggtgggag ccatttgttt cgcagctgtc 60

ggtgcaggct tcgctgtgct cttcatgaac tactcacacg atggctcgcc taacgaggag 120

gttcatgcgg agtgcgttct gactcaaaat cctgatgaag ccggagatgt ggctgggaca 180

atcgtttttc accacatgag aggctctacc accattcata tcgaaggcaa cgtcacaggt 240

ctgactccgg gactccacgg cttccacatt cacacctatg gcgtcgttgg tggcgactgc 300

ggggcagccg ccgcgcatta caaccccgac ggattcgtcc atggcgggcc tgatgccgaa 360

ataagacacg ttggtgattt gggaaacatc gagagcgatg aagagggaat tgctcatgtt 420

gacattcatg atgaaatagt gtcactgtac ggggacagag cagttgtagg tcgaagcgtg 480

gttgtccatg ccaaagagga cgacttagga ctaggtggtg acgaaggttc cctaacaact 540

ggcaatgctg gagctagatt ggcttgctgc accattttct tggcgcccca cgacttagaa 600

aat 603

<210> 2

<211> 103

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

caaatgtaat aaaagtatca acaaaaaatt gttaatatac ctctatactt taacgtcaag 60

gagaaaaaac ccggatctca aaatggcgaa gtgcttacaa gtc 103

<210> 3

<211> 102

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tatggacgag gtaataagga aactcagaac cagaatagtg gcatgagctc tccaatttaa 60

catatttgcc attagtgacc cgatgataag ctgtcaaaca tg 102

<210> 4

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cctggcccca caaaccttc 19

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

attttctaag tcgtggggcg 20

<210> 6

<211> 201

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 6

Met Ala Lys Cys Leu Gln Val Val Cys Phe Val Val Gly Ala Ile Cys

1 5 10 15

Phe Ala Ala Val Gly Ala Gly Phe Ala Val Leu Phe Met Asn Tyr Ser

20 25 30

His Asp Gly Ser Pro Asn Glu Glu Val His Ala Glu Cys Val Leu Thr

35 40 45

Gln Asn Pro Asp Glu Ala Gly Asp Val Ala Gly Thr Ile Val Phe His

50 55 60

His Met Arg Gly Ser Thr Thr Ile His Ile Glu Gly Asn Val Thr Gly

65 70 75 80

Leu Thr Pro Gly Leu His Gly Phe His Ile His Thr Tyr Gly Val Val

85 90 95

Gly Gly Asp Cys Gly Ala Ala Ala Ala His Tyr Asn Pro Asp Gly Phe

100 105 110

Val His Gly Gly Pro Asp Ala Glu Ile Arg His Val Gly Asp Leu Gly

115 120 125

Asn Ile Glu Ser Asp Glu Glu Gly Ile Ala His Val Asp Ile His Asp

130 135 140

Glu Ile Val Ser Leu Tyr Gly Asp Arg Ala Val Val Gly Arg Ser Val

145 150 155 160

Val Val His Ala Lys Glu Asp Asp Leu Gly Leu Gly Gly Asp Glu Gly

165 170 175

Ser Leu Thr Thr Gly Asn Ala Gly Ala Arg Leu Ala Cys Cys Thr Ile

180 185 190

Phe Leu Ala Pro His Asp Leu Glu Asn

195 200

Claims

1. A saccharomyces cerevisiae engineering bacterium is characterized in that a gene segment shown as SEQ ID NO.1 is cloned into an expression vector to obtain a recombinant expression vector, and the recombinant expression vector is integrated with a saccharomyces cerevisiae strain to obtain the saccharomyces cerevisiae engineering bacterium.

2. The engineered saccharomyces cerevisiae strain of claim 1, wherein the expression vector is pHAC181.

3. The engineered saccharomyces cerevisiae strain of claim 1, wherein the recombinant expression vector is integrated into the saccharomyces cerevisiae strain downstream of the GAL1 promoter.

4. The construction method of the saccharomyces cerevisiae engineering bacteria as claimed in claim 1, characterized by comprising the following steps:

(1) Cloning the gene fragment MrSOD shown as SEQ ID NO.1 onto an expression plasmid pHAC181 to obtain a recombinant expression plasmid pHAC181-MrSOD, transferring the obtained recombinant expression plasmid pHAC181-MrSOD into an escherichia coli competent cell transT1, and coating the escherichia coli competent cell transT1 on a LA plate for overnight culture;

(2) Integrating the nucleotide fragment containing the MrSOD gene into the downstream of the GAL1 promoter in the saccharomyces cerevisiae strain by utilizing a homologous recombination technology to obtain the saccharomyces cerevisiae engineering bacteria.

5. The construction method of the saccharomyces cerevisiae engineering bacteria according to claim 4, wherein in the step (2), the amplification primers used by the homologous recombination technology are shown as SEQ ID NO.2 and SEQ ID NO. 3.

6. A recombinant plasmid is characterized in that the recombinant plasmid contains a gene segment shown as SEQ ID NO. 1.

7. The method for expressing protein by using the saccharomyces cerevisiae engineering bacteria as described in claim 1, which comprises the following steps: the single bacterial colony of the saccharomyces cerevisiae engineering bacteria of claim 1 is inoculated in SD-Leu culture medium for overnight culture, the culture is transferred to YPG culture medium the next day, and after galactose induction culture, the bacterial strain protein is extracted.

8. A feed immunization bacterial agent containing the saccharomyces cerevisiae engineering bacteria of claim 1.

9. The feed immune microbial inoculum of claim 8, wherein the addition amount of the saccharomyces cerevisiae engineering bacteria in the feed is 0.2-0.5%.

10. The use of the engineered saccharomyces cerevisiae strain of claim 1 in feed immune, feed improvement or probiotic.