CN113322223A - Selenium-enriched yeast genetically engineered bacterium, surface display system thereof and construction method thereof - Google Patents

Abstract

The invention belongs to the field of molecular biology, and particularly relates to a selenium-enriched yeast genetically engineered bacterium, a surface display system thereof and a construction method thereof. Culturing the yeast genetic engineering bacteria by using a culture medium, and then adding sodium selenite to continue culturing to obtain the selenium-enriched yeast genetic engineering bacteria. Inserting goat gamma-interferon into a His tag, and constructing pYD 1-CapiFN-gamma by taking a pYD1 shuttle plasmid as a framework; and then introducing the pYD 1-CapIFN-gamma into the selenium-enriched yeast genetic engineering bacteria to obtain the goat gamma-interferon selenium-enriched yeast display system. The system carries out selenium-rich modification on yeast in the goat, and widens the application range of the goat gamma-interferon yeast expression system; and the yeast surface display of the goat gamma-interferon is realized, so that the antiviral activity of the goat gamma-interferon can be better exerted; lays a foundation for developing a novel yeast feed additive which is safer, more effective and cheaper and has the functions of resisting virus and enhancing the immunity of the organism.

Description

Selenium-enriched yeast genetically engineered bacterium, surface display system thereof and construction method thereof

Technical Field

The invention belongs to the field of molecular biology, and particularly relates to a selenium-enriched yeast genetically engineered bacterium, a surface display system thereof and a construction method thereof.

Background

Interferon (IFN) is a cell secreted, non-specific broad-spectrum antiviral inducer protein, mainly glycoproteins, whose major biological functions include: broad-spectrum antivirus, immunoregulation, immunity enhancement, anti-tumor and the like. The interferon for animals becomes a research hotspot by virtue of unique antiviral activity and immunoregulation action, relatively more researches are carried out on human, pig, cattle, poultry, dog and other interferons, and the interferon produced by utilizing genetic engineering is widely applied to prevention, control and treatment of epidemic diseases of poultry, pig, dog and other animals. The natural interferon is only produced under specific induction conditions, the content is low, the purification and the storage are extremely difficult, the interferon obtained by the genetic engineering technology mainly has the defects of low expression quantity, inclusion bodies, high production cost and the like, and the large-scale popularization and application of the interferon in the livestock and poultry breeding industry has limitations. Currently, emerging technologies for microbial surface display, mainly including bacterial surface display systems, phage display systems, and yeast surface display systems, have been applied in a number of fields: the method is used for researching the mutual recognition and interaction among proteins, preparing antibodies, producing oral vaccines, producing whole cell catalysts and cell adsorbents and the like. Wherein, only the yeast surface display technology is a eukaryotic expression system, and the other 2 technologies all utilize a prokaryotic expression system, lack of protein post-translational modification and are not suitable for displaying eukaryotic proteins. The selection of a proper system by utilizing the genetic engineering technology to enable the interferon to be efficiently expressed is undoubtedly an effective way for promoting the popularization and the application of the interferon in veterinary clinic.

Selenium mainly exists in two forms of organic selenium and inorganic selenium, has important biological functions on human and animal bodies and mainly comprises: antioxidant, immunity enhancing, nutritious, cancer cell inhibiting, animal fertility improving, and heavy metal poisoning antidote. At present, most areas in China have the phenomenon of selenium deficiency, and the content of selenium in natural foods is generally less, so that selenium supplement is a very interesting problem. The saccharomyces cerevisiae has good selenium enriching capability, can absorb and convert extracellular inorganic selenium into organic selenium through a biological adsorption and active transportation mode, and can be enriched in a large amount in cells to become selenium-enriched yeast, and the selenium-enriched yeast is the most efficient, safest and most balanced nutritional selenium supplement preparation at home so far. But the research of using the genetic engineering bacteria for selenium enrichment is less at present.

In recent years, the goat breeding industry in China develops rapidly, the breeding scale is continuously expanded, the variety and the harm of epidemic diseases are gradually enlarged, and the epidemic diseases become one of the important factors for limiting the development of the disease. The conditional pathogenic bacteria and the virus diseases are the most serious, and are mostly generated when the goat is low in immunity or immune system is disordered, once the disease is generated, the goat is often secondarily infected with various epidemic diseases, and the serious goat is died, so that great trouble is brought to the prevention and control of the goat epidemic diseases. At present, the prevention and control of goat diseases mainly depend on antibiotic medicines and vaccines, but with the advent of the age of reducing resistance and limiting resistance, the clinical antibiotic medicines are very limited. Meanwhile, the ministry of agriculture has mandated that the use of anti-viral drugs such as amantadine and ribavirin in livestock and poultry breeding production is prohibited. In addition, a plurality of defects of quality problems, timeliness problems and the like exist in partial vaccine products, even partial epidemic diseases do not have proper medicines or vaccines for use, particularly, the epidemic diseases caused by continuously-appearing new strains and variant strains of pathogenic microorganisms have severe prevention and control situation of goat epidemic diseases, and therefore, the improvement of the goat immunity and the disease resistance is particularly important.

Disclosure of Invention

In view of the above, the present invention aims to provide a selenium-enriched yeast genetically engineered bacterium. At present, the yeast used for enriching the selenium mainly comprises conventional strains such as saccharomyces cerevisiae, saccharomyces rouxii, saccharomyces uvarum, phaffia rhodozyma, hansenula, torulopsis, candida and the like, and the research on the genetic engineering bacteria for enriching the selenium is less.

The preparation method of the selenium-rich yeast genetic engineering bacteria comprises the following steps: culturing the yeast genetic engineering bacteria by using a culture medium, and adding sodium selenite to continue culturing when the yeast genetic engineering bacteria are cultured to a logarithmic phase.

Preferably, the genetically engineered yeast strain comprises saccharomyces cerevisiae, pichia pastoris, or yarrowia lipolytica; the Saccharomyces cerevisiae comprises EBY100, INVSC1 or AH 109; the pichia pastoris comprises GS115, KM71, MC100-3, SMD1168, SMD1165 or SMD 1163; said yarrowia lipolytica comprises Polf, Polg or Polh.

Preferably, the concentration of the sodium selenite is 60 mug/mL.

In some embodiments, the preparation method of the selenium-enriched yeast genetically engineered bacterium comprises the following steps: (1) selecting saccharomyces cerevisiae EBY100, streaking and inoculating the saccharomyces cerevisiae EBY100 in a YPD solid culture medium, placing the YPD solid culture medium in a 30 ℃ constant temperature incubator for culture, after single colony grows out, selecting the single colony to inoculate in 10mL of YPD liquid culture, placing the YPD liquid culture medium in the 30 ℃ constant temperature incubator, carrying out 250r/min shaking culture for 24h, then inoculating in 200mL of YPD fresh culture medium according to 10% inoculation amount, sampling 1mL every 12h, determining the content of saccharomycetes, continuously culturing for 72h, and drawing a growth curve according to the content of thalli at each time point. The result shows that the cell content of the saccharomyces cerevisiae EBY100 reaches the peak value after being cultured for 36 hours, and the cell content reaches 210 multiplied by10⁶CFU·mL^-1. (2) According to the Saccharomyces cerevisiaeThe characteristic of long curve, determining that sodium selenite with different contents is added when the culture is carried out for 36h, and the final concentrations are respectively: 0 mu g/mL, 20 mu g/mL, 40 mu g/mL, 60 mu g/mL, 80 mu g/mL, 100 mu g/mL, and after 72h of culture, the total selenium content was determined. According to measurement, when the optimum addition amount of the sodium selenite is 60 mug/mL, the unit selenium content of the saccharomyces cerevisiae is 5.61 mg/g.

The invention aims to further provide a selenium-enriched yeast surface display system. The yeast surface display system comprises an expression vector, engineering bacteria and target protein.

The engineering bacteria of the selenium-enriched yeast surface display system are the selenium-enriched yeast genetic engineering bacteria, and the selenium-enriched yeast genetic engineering bacteria comprise saccharomyces cerevisiae EBY100, pichia pastoris GS115, pichia pastoris KM71, pichia pastoris X-33 or yarrowia lipolytica Polg.

The target protein of the selenium enriched yeast surface display system can be any target protein that can be expressed in the selenium enriched yeast display system.

Preferably, the target protein is goat gamma-interferon (CapIFN-gamma), and the nucleic acid Sequence of the goat gamma-interferon comprises the Sequence shown in Sequence No. 1. Based on the selenium-rich characteristic of yeast, a yeast surface display system is innovatively subjected to selenium-rich transformation, people are synthesized into a goat gamma-interferon gene sequence containing a His label, the selenium-rich yeast is converted by electric shock by virtue of a pYD1 shuttle plasmid, and the goat gamma-interferon is displayed on the surface of the selenium-rich yeast in a covalent bond form under the action of GPI (general purpose protein) anchoring protein, so that the goat gamma-interferon recombinant selenium-rich yeast with antiviral and immune activities is obtained, a new thought is provided for yeast surface display, and a foundation is laid for developing a safer, effective and cheap novel yeast feed additive with antiviral and organism immunity enhancing functions.

Specifically, the advantages of interferon and selenium-enriched yeast in the aspects of antivirus and immunoregulation are combined, selenium-enriched modification is carried out on a yeast surface display system, the recombinant strain obtained after modification has the biological function of the selenium-enriched yeast, a new thought is provided for research and development of novel antivirus and immunity-improving animal feed additives, and technical support is also provided for green and healthy breeding of goats and prevention and control of epidemic diseases. And integrating the goat gamma-interferon with a yeast genome by using the pYD1 shuttle plasmid as a framework through electric shock transformation and homologous recombination, and displaying the integrated goat gamma-interferon on the surface of the yeast in a covalent bond form after induction expression to obtain the recombinant yeast. The biological activity based on the gamma-interferon has the characteristic of depending on a receptor on a target cell membrane, and the display of the gamma-interferon on the surface of the yeast is more favorable for the exertion of the function of the gamma-interferon. Further, the preparation method of the selenium-enriched yeast surface display system with the target protein of goat gamma-interferon (CapiFN-gamma) comprises the following steps: (1) inserting the goat gamma-interferon into a His tag, and constructing the recombinant plasmid pYD 1-CapiFN-gamma by taking a pYD1 shuttle plasmid as a framework; (2) introducing the pYD 1-CapiFN-gamma recombinant plasmid into the selenium-enriched yeast genetic engineering bacteria.

Preferably, in the step (2), the method for introducing the pYD 1-CapiFN-gamma recombinant plasmid into the yeast expression engineering bacteria is an electric conversion method.

Preferably, before the pYD 1-CapIFN-gamma recombinant plasmid is introduced into the selenium-enriched yeast genetically engineered bacterium, the selenium-enriched yeast genetically engineered bacterium is prepared into a competent cell, and a method for changing a yeast expression engineered cell into the competent cell is a conventional method in the technical field.

Preferably, the His tag Sequence comprises a Sequence as shown in Sequence No. 2.

In certain embodiments, the method for preparing the selenium-enriched yeast surface display system with the target protein being goat gamma-interferon comprises the following steps: (1) artificially synthesizing a goat gamma-interferon gene sequence according to the codon preference of saccharomyces cerevisiae, inserting a His label, constructing a recombinant expression plasmid pYD 1-CapiFN-gamma by taking a pYD1 shuttle plasmid as a framework, and performing enzyme digestion identification; (2) based on the selenium-rich characteristic of the saccharomyces cerevisiae, adding sodium selenite in the logarithmic phase of growth of the saccharomyces cerevisiae, optimizing the culture condition of the saccharomyces cerevisiae EBY100, measuring the selenium content by using a spectrophotometry method to obtain the saccharomyces cerevisiae with the selenium-rich function, and preparing selenium-rich yeast EBY100 competent cells for later use; (3) electrically transforming the correctly identified recombinant plasmid pYD 1-CapIFN-gamma into selenium-enriched yeast EBY100, coating the selenium-enriched yeast EBY100 in an MD (MD plate), screening surface display type selenium-enriched yeast EBY100/pYD 1-CapIFN-gamma, and primarily screening a positive recombinant strain by using a PCR (polymerase chain reaction) method; (4) and (3) carrying out induced expression on the positive recombinant yeast strain with correct molecular identification by using galactose for 72h, centrifuging at 3000r/min for 10min, removing supernatant, and collecting precipitate.

The invention aims to further provide a method for improving the expression of the goat gamma-interferon, wherein the method is used for preparing the goat gamma-interferon into the goat gamma-interferon selenium-enriched yeast surface display system by using the preparation method, so that the expression of the goat gamma-interferon is improved.

The invention aims to further provide a preparation containing the selenium-enriched yeast surface display system, wherein the preparation is one or more of an antibody, an oral vaccine and a feed additive.

Further, the invention also provides a primer pair, the primer pair is used for identifying the goat gamma-interferon by PCR, and the sequences of the primer pair are shown as Sequence No.3 and Sequence No. 4:

Sequence NO.3(F)：CAGATGTTGCTAAAGGTGGTCC；

Sequence NO.4(R)：AGAAGCTCTTCTACCTCTAAACAA。

the invention has the beneficial effects that:

the yeast display system of the goat gamma-interferon provided by the invention realizes the yeast surface display of the goat gamma-interferon, and is more favorable for the exertion of the antiviral activity of the goat gamma-interferon.

The yeast display system of the goat gamma-interferon provided by the invention is subjected to selenium-rich transformation, so that the application range of the goat gamma-interferon yeast expression system is widened.

The yeast display system of the goat gamma-interferon lays a foundation for researching and developing a novel yeast feed additive which is safer, more effective and cheaper and has the functions of resisting viruses and enhancing the immunity of organisms.

Drawings

FIG. 1 is a schematic diagram of the construction process of recombinant plasmid pYD 1-CapiFN-gamma.

FIG. 2 is a diagram showing the results of double restriction enzyme identification of the recombinant plasmid pYD 1-CapiFN-gamma.

FIG. 3 is a diagram of the identification result of recombinant selenium-enriched yeast.

FIG. 4 is a diagram showing the result of SDS-PAGE analysis of the CapIFN- γ recombinant protein.

FIG. 5 is a Western blot analysis result chart of the CapIFN-gamma recombinant protein.

FIG. 6 is a graph of IFA identification results of recombinant selenium-enriched yeast.

Wherein the content of the first and second substances,

in FIG. 2, 1 is a double-restriction enzyme product, expected bands appear at about 469bp and 5000bp, respectively, and M is DNA markerDL 5000;

in FIG. 3, 1 is the PCR product of selenium-enriched yeast transferred into pYD1 empty vector, 2 is the PCR product of selenium-enriched yeast transferred into pYD 1-CapiFN-gamma recombinant plasmid, and M is DNA markerDL 2000;

in FIG. 4, 1-3 are respectively the expression conditions of CapIFN-gamma recombinant protein induced by selenium-enriched yeast transferred into recombinant plasmid pYD 1-CapIFN-gamma for 24h, 48h and 72h, a specific protein band appears at the position of about 25kDa, 4 is a selenium-enriched yeast negative control transferred into an empty vector, no target protein band is seen at the position of 25kDa, and M is protein Marker;

in FIG. 5, 1 is a selenium-enriched yeast negative control, no specific band appeared, 2 is a selenium-enriched yeast strain transformed into the recombinant plasmid pYD 1-CapiFN-gamma, and the expected band appeared at about 25 kDa;

in FIG. 6, A is the selenium-enriched yeast strain transformed with recombinant plasmid pYD 1-CapiFN-gamma and shows green fluorescence signal, and B is the selenium-enriched yeast negative control transformed with empty vector pYD1 and shows fluorescence signal.

Detailed Description

The examples are given for the purpose of better illustration of the invention, but the invention is not limited to the examples. Therefore, those skilled in the art should make insubstantial modifications and adaptations to the embodiments of the present invention in light of the above teachings and remain within the scope of the invention.

Example 1 design and Synthesis of CapIFN-gamma target Gene

(1) Design of target Gene

Because the pYD1 plasmid still keeps the inherent expression tags of V5 epitope and His tag after being subjected to Kpn I/EcoR I double enzyme digestion, in order to enable the subsequent better investigation of the expression site and the expression quantity of the target protein, a His tag sequence is added to a downstream primer of a CapIFN-gamma mature peptide gene sequence, and a termination codon TAA is designed, so that the V5 epitope and the His tag are not expressed, and the target protein can be screened and identified based on the His tag. Therefore, the target gene sequence mainly comprises Kpn I, CapiFN-gamma, His tag and EcoR I gene sequences, the total length of the gene is 469bp, and the target gene is optimized and designed according to the preference of yeast codons.

Sequence information of the mature peptide CapiFN-gamma gene:

the size is 440bp, and a Kpn I restriction endonuclease gene (CGGGTACC) is inserted into 5' of a CapIFN-gamma mature peptide gene sequence (shown as a sequence 1).

Sequence NO.1：

ATGCAAGGTCCATTCTTTAAAGAAATTGAAAATTTGAAAGAATATTTTAATGCTTCTAATCCAGATGTTGCTAAAGGTGGTCCATTGTTTTCTGAAATTTTGAAAAATTGGAAAGAAGAATCTGATAAAAAGATTATTCAATCTCAAATTGTTTCTTTTTATTTTAAATTGTTTGAAAATTTGAAAGATAATCAAGTTATTCAAAGATCTATGGATATTATTAAGCAAGATATGTTTCAAAAATTTTTGAATGGTTCATCTGAAAAATTAGAAGATTTTAAAAAATTGATTCAAATTCCAGTTGATGATTTGCAAATTCAAAGAAAAGCTATTAATGAATTGATTAAGGTTATGAATGACTTATCTCCAAAATCTAATTTGAGAAAAAGAAAAAGATCTCAAAATTTGTTTAGAGGTAGAAGAGCTTCTATG

His tag sequence information:

1-18bp is His label gene Sequence, 19-21bp is stop codon gene Sequence, 22-29bp is EcoRI restriction endonuclease gene Sequence, Sequence NO. 2: CATCATCACCATCACCATTAAGAATTCCG are provided.

(2) Synthesis of the Gene of interest

The total length of the artificially synthesized gene is 469bp, and the gene sequence is optimized and synthesized by Shanghai biological engineering technology Limited company according to the preference of yeast codons.

(3) Construction of pUC 57-CapiFN-gamma recombinant plasmid

The synthesized target gene sequence is directionally inserted into a pUC57 cloning plasmid after KpnI/EcoRI double enzyme digestion, and the recombinant plasmid is constructed by Shanghai biological engineering technology, Inc.

Example 2 construction of pYD 1-CapIFN-gamma recombinant shuttle plasmid

(1) Extraction and digestion of plasmids

Referring to FIG. 1, the plasmid miniprep-miniprep kit is used to extract pYD1 shuttle plasmid and pUC 57-CapiFN-gamma recombinant clone plasmid, and the plasmid is double digested with KpnI and EcoRI restriction enzymes, and 20. mu.L of the restriction enzyme system is: KpnI/EcoRI is 1 mu L of each, Buffer2 mu L, plasmid 12 mu L, ddH2O 4 mu L, water bath at 37 ℃ for 1.5h, electrophoresis analysis is carried out on the mixture by 1.0% agarose gel after the reaction is finished, the digested pYD1 plasmid and the target fragment are recovered according to the instruction of a DNA agarose gel recovery kit, and the plasmid and the target fragment are stored at-20 ℃ for standby after dephosphorylation.

(2) Ligation and transformation

And (3) connecting the target fragment and the pYD1 plasmid by using T4DNA ligase, wherein the 10 mu L of the connecting system is as follows: t4DNA ligase 1 uL, Buffer5 uL, target fragment 3 uL, pYD11 uL and ddH2O, mixing uniformly, connecting overnight at 16 ℃, and transforming the connection product into escherichia coli DH5a by a heat shock method.

(3) Positive transformant identification

Screening positive transformants by using an ampicillin resistance plate, designing a specific primer gamma F/gamma R (Sequence NO.3/Sequence NO.4) to carry out PCR identification on the recombinant strains, wherein a 20-mu-L reaction system is as follows: DNA template 3. mu.L, primers 0.5. mu.L each, 2 XTaq MasterMix 10. mu.L, ddH2O 6. mu.L, reaction conditions were: 5min at 95 ℃, 35s at 95 ℃, 30s at 58 ℃, 30s at 72 ℃ for 35 cycles, 10min at 72 ℃. A single band appears after electrophoresis through 1% agarose gel, and the PCR product is sent to Shanghai bio-factory, Inc. for sequencing analysis, and the size of the product is 368bp (Sequence NO.5), which is consistent with the expected result. Meanwhile, recombinant plasmids are extracted according to the specification of the plasmid miniprep and medium-volume kit, restriction enzymes KpnI and EcoRI are used for double enzyme digestion identification, an expected band (shown in figure 2) appears, and the identified correct recombinant plasmids are named as: pYD 1-CapiFN-gamma, stored at-20 ℃ for further use.

Sequence NO.3：CAGATGTTGCTAAAGGTGGTCC

Sequence NO.4：AGAAGCTCTTCTACCTCTAAACAA

Sequence NO.5：

CAGATGTTGCTAAAGGTGGTCCATTGTTTTCTGAAATTTTGAAAAATTGGAAAGAAGAATCTGATAAAAAGATTATTCA

ATCTCAAATTGTTTCTTTTTATTTTAAATTGTTTGAAAATTTGAAAGATAATCAAGTTATTCAAAGATCTATGGATATT

ATTAAGCAAGATATGTTTCAAAAATTTTTGAATGGTTCATCTGAAAAATTAGAAGATTTTAAAAAATTGATTCAAATTC

CAGTTGATGATTTGCAAATTCAAAGAAAAGCTATTAATGAATTGATTAAGGTTATGAATGACTTATCTCCAAAATCTAA

TTTGAGAAAAAGAAAAAGATCTCAAAATTTGTTTAGAGGTAGAAGAGCTTCT

Example 3 selenium enrichment modification and competent cell preparation of Saccharomyces cerevisiae

(1) Expanding culture of saccharomyces cerevisiae and drawing of growth curve

Selecting saccharomyces cerevisiae EBY100, streaking and inoculating the saccharomyces cerevisiae EBY100 in a YPD solid culture medium, placing the YPD solid culture medium in a 30 ℃ constant temperature incubator for culture, after single colony grows out, selecting the single colony to inoculate in 10mL of YPD liquid culture, placing the YPD liquid culture medium in the 30 ℃ constant temperature incubator, carrying out 250r/min shaking culture for 24h, then inoculating in 200mL of YPD fresh culture medium according to 10% inoculation amount, sampling 1mL every 12h, determining the content of saccharomycetes, continuously culturing for 72h, and drawing a growth curve according to the content of thalli at each time point. It was found that the cell content of Saccharomyces cerevisiae EBY100 reached the peak value after 36 hours of culture, and that the cell content reached 210X 106 CFU.mL-1.

(2) Selenium-rich culture of saccharomyces cerevisiae

According to the characteristics of a growth curve of the saccharomyces cerevisiae, the sodium selenite with different contents is added when the saccharomyces cerevisiae is cultured for 36 hours, and the final concentrations are respectively as follows: 0 mu g/mL, 20 mu g/mL, 40 mu g/mL, 60 mu g/mL, 80 mu g/mL, 100 mu g/mL, and after 72h of culture, the total selenium content was determined. According to measurement, when the optimum addition amount of the sodium selenite is 60 mug/mL, the unit selenium content of the saccharomyces cerevisiae is 5.61 mg/g.

(3) Preparation of selenium-enriched yeast competent cells

A fresh selenium-enriched yeast EBY100 monoclonal was picked from the YPD plate and cultured in 10ml YPD liquid medium at 30 ℃ and 250r/min overnight. OD600 values of the overnight cultures were determined to be between 3.0 and 5.0. 10mLYPD overnight cultures were diluted to OD600 values of 0.2-0.4. Continuously culturing in a constant temperature shaking table at 28-30 deg.C for 3-6h to make OD600 value reach 0.6-1.0. The yeast cells were collected by centrifugation at 1500 rpm for 5min at room temperature, and the supernatant was discarded. The yeast cells were washed with 10mL of wash solution, then centrifuged at 1500r/min at room temperature for 5min to collect the cells, and the supernatant was discarded. Resuspend yeast cells with 1mLTE/LiAc, subpackage 100 μ L per tube, and freeze-store at-80 deg.C when prepared or after preparation.

Example 4 construction and identification of recombinant selenium-enriched Yeast

(1) Electric shock conversion

And adding 100 mu L of prepared selenium-enriched yeast EBY100 competent cells into 5 mu L of plasmid, uniformly blowing and sucking by using a liquid transfer gun, transferring into a 4mm electric transfer cup precooled at 4 ℃, and standing for 5min in ice bath. Wiping an electric revolving cup, and electric shocking: the Bio-rad Gene Pulser Xcell electroporator selects the preset program Fungal 2 at 2.5kV with one shock. After electric shock, 1mL of 1M sorbitol solution precooled at 4 ℃ was added to the cuvette, and the cuvette was blown up evenly with a pipette and placed in an ice bath. The mixture was transferred to a 1.5mL EP tube and allowed to stand in a water bath at 30 ℃ for 1 hour. After 1h, the plate was removed and 100. mu.L of the plate was plated on a leucine MD solid medium and cultured at 30 ℃ until the colony grows to a size of 2-3mm in diameter (about 2-3d of culture). At the same time, pYD1 plasmid is electrotransferred to be used as a negative control.

(2) PCR identification of recombinant selenium-enriched yeast

Single colonies were picked from MD plates and inoculated into 5mLYPD liquid medium and cultured overnight at 30 ℃ at 250 r/min. Recombinant yeast DNA was extracted according to the yeast genome extraction kit instructions, PCR identification was performed using the primers gamma F/gamma R designed in example 2, and the PCR product was analyzed by 1% agarose gel electrophoresis, and the expected band appeared, while the blank control had no band (as shown in FIG. 3), and the correctly identified recombinant strain was named EBY100/pYD 1-CapiFN-gamma.

(3) Induced expression of recombinant selenium-enriched yeast

Inoculating correctly identified recombinant selenium-enriched yeast into YNB-CAA liquid culture medium containing 2% galactose, culturing at 30 deg.C and 250r/min, sampling 1 time per 24h, inducing expression for 72h, centrifuging at 3000r/min for 10min, discarding supernatant, and collecting precipitate.

(4) SDS-PAGE of recombinant Yeast

Adding 100 μ L of 5 xSDS loading buffer into the precipitate, mixing, water bathing at 100 deg.C for 10min, centrifuging for 5min at 12,000r/min, carefully sucking the supernatant, and discarding the precipitate. 15 μ L of the supernatant was applied and analyzed electrophoretically on 10% SDS-PAGE, and EBY100/pYD1 samples were processed as negative controls. After the electrophoresis, dyeing and decoloring treatment are carried out, and analysis shows that a specific protein band appears at a position of about 25kd, and a negative control has no corresponding band and is consistent with an expected result. The CapIFN-gamma showed the target band 24h after induction of expression (as shown in FIG. 4).

(5) Western blot analysis

After 72h of inducible expression of the positive recombinant yeast strains, the samples were treated according to method 4. After electrophoresis is finished, the electrophoresis product is transferred to a PVDE transfer printing film through a film transfer instrument. Soaking in blocking solution (5% skimmed milk powder) at room temperature for 2 hr, and washing with TBST solution for 10min for 3 times. Putting the PVDE transfer film into a clean plate, adding rabbit anti-His tag polyclonal antibody, performing primary antibody incubation, treating at 4 ℃ for 1h, and repeating the membrane washing operation. After washing, 30000 times of goat anti-rabbit IgG (H + L) antibody (alkaline phosphatase label) diluted with TBST was added, and the above washing was repeated after incubation at 4 ℃ for 1H. And placing the nitrocellulose membrane in BCIP/NBT color development liquid to avoid light for color development, and repeatedly washing with deionized water after a strip appears to terminate the reaction. As a result, the expected band appeared at the position of about 25kDa, and the control well showed no band (as shown in FIG. 5).

(6) IFA analysis

Taking 1mL EBY100/pYD 1-CapiFN-gamma bacterium liquid 12000 r/min after galactose induction for 72h, centrifuging at 4 ℃ for 5min, discarding the supernatant, reserving the precipitate, and taking EBY100/pYD1 after galactose induction for 72h as a negative control. Washing with PBS for 3 times, 2min each time, 6000rpm each time, centrifuging at 4 deg.C for 5min, and discarding the supernatant. Immunizing meat rabbit with CapIFN-gamma prokaryotic expression product to prepare CapIFN-gamma polyclonal antibody, diluting rabbit anti-CapIFN-gamma polyclonal antibody (primary antibody) at a ratio of 1:200 with sterilized PBS, incubating overnight at 4 deg.C with 500 μ L diluted primary antibody, washing with PBS for 3 times, and centrifuging at 6000rpm and 4 deg.C for 5 min. mu.L of FITC-labeled goat anti-rabbit IgG diluted in sterile PBS at a ratio of 1:5000 was added and incubated at 37 ℃ for 1 h. After 3 times of PBS washing, the mixture was centrifuged at 6000rpm and 4 ℃ for 5 min. After resuspending 50. mu.L of sterilized PBS, 10. mu.L of the bacterial solution was dropped onto a clean glass slide, covered with a cover slip, and the edge was coated with transparent nail polish to fix the cover slip. Under a fluorescence microscope, the recombinant selenium-enriched yeast EBY100/pYD 1-CapiFN-gamma excites a green fluorescence signal, and a control group has no fluorescence signal (shown in figure 6).

Finally, the above embodiments are only for illustrating the technical solutions of the present invention and not for limiting, although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions may be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all of them should be covered in the claims of the present invention.

Sequence listing

<110> institute of zootechnics in Chongqing City

<120> selenium-enriched yeast gene engineering bacterium, surface display system thereof and construction method thereof

<130> 2021-5-25

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 432

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgcaaggtc cattctttaa agaaattgaa aatttgaaag aatattttaa tgcttctaat 60

ccagatgttg ctaaaggtgg tccattgttt tctgaaattt tgaaaaattg gaaagaagaa 120

tctgataaaa agattattca atctcaaatt gtttcttttt attttaaatt gtttgaaaat 180

ttgaaagata atcaagttat tcaaagatct atggatatta ttaagcaaga tatgtttcaa 240

aaatttttga atggttcatc tgaaaaatta gaagatttta aaaaattgat tcaaattcca 300

gttgatgatt tgcaaattca aagaaaagct attaatgaat tgattaaggt tatgaatgac 360

ttatctccaa aatctaattt gagaaaaaga aaaagatctc aaaatttgtt tagaggtaga 420

agagcttcta tg 432

<210> 2

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

catcatcacc atcaccatta agaattccg 29

<210> 3

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

catcatcacc atcaccatta agaattccg 29

<210> 4

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

agaagctctt ctacctctaa acaa 24

<210> 5

<211> 368

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cagatgttgc taaaggtggt ccattgtttt ctgaaatttt gaaaaattgg aaagaagaat 60

ctgataaaaa gattattcaa tctcaaattg tttcttttta ttttaaattg tttgaaaatt 120

tgaaagataa tcaagttatt caaagatcta tggatattat taagcaagat atgtttcaaa 180

aatttttgaa tggttcatct gaaaaattag aagattttaa aaaattgatt caaattccag 240

ttgatgattt gcaaattcaa agaaaagcta ttaatgaatt gattaaggtt atgaatgact 300

tatctccaaa atctaatttg agaaaaagaa aaagatctca aaatttgttt agaggtagaa 360

gagcttct 368

Claims (10)

1. The selenium-enriched yeast genetic engineering bacterium is characterized in that the preparation method of the selenium-enriched yeast genetic engineering bacterium comprises the following steps: culturing the yeast genetic engineering bacteria by using a culture medium, and adding sodium selenite to continue culturing when the yeast genetic engineering bacteria are cultured to a logarithmic phase.

2. The selenium-enriched yeast genetically engineered bacterium of claim 1, wherein the yeast genetically engineered bacterium comprises saccharomyces cerevisiae, pichia pastoris, or yarrowia lipolytica; the Saccharomyces cerevisiae comprises EBY100, INVSC1 or AH 109; the pichia pastoris comprises GS115, KM71, MC100-3, SMD1168, SMD1165 or SMD 1163; said yarrowia lipolytica comprises Polf, Polg or Polh.

3. The selenium-enriched yeast genetically engineered bacterium of claim 1, wherein the concentration of the sodium selenite is 60 μ g/mL.

4. The selenium-enriched yeast surface display system is characterized in that the engineering bacteria of the selenium-enriched yeast surface display system are the selenium-enriched yeast genetic engineering bacteria of any one of claims 1 to 3, and the selenium-enriched yeast genetic engineering bacteria comprise saccharomyces cerevisiae EBY100, pichia pastoris GS115, pichia pastoris KM71, pichia pastoris X-33 or yarrowia lipolytica Polg.

5. The selenium-enriched yeast surface display system of claim 4, wherein the target protein of the selenium-enriched yeast surface display system is goat gamma-interferon (CapiFN-gamma), and the nucleic acid Sequence of the goat gamma-interferon comprises the Sequence shown in Sequence No. 1.

6. The method for preparing the goat gamma-interferon yeast surface display system as claimed in claim 5, comprising the steps of: (1) inserting the goat gamma-interferon into a His tag, and constructing the recombinant plasmid pYD 1-CapiFN-gamma by taking a pYD1 shuttle plasmid as a framework; (2) introducing the pYD 1-CapiFN-gamma recombinant plasmid into the selenium-enriched yeast genetic engineering bacteria.

7. The method according to claim 6, wherein the pYD 1-CapiFN-gamma recombinant plasmid is introduced into the yeast expression engineering bacteria by an electric conversion method in the step (2).

8. The method according to claim 6, wherein the selenium-enriched yeast genetically engineered bacterium is prepared into a competent cell before introducing the pYD1-CapIFN- γ recombinant plasmid into the selenium-enriched yeast genetically engineered bacterium.

9. A method for improving the expression of goat gamma-interferon, which is characterized in that the preparation method of any one of claims 6 to 8 is used for preparing the goat gamma-interferon into a goat gamma-interferon selenium-enriched yeast surface display system, so that the expression of the goat gamma-interferon is improved.

10. A formulation comprising the selenium enriched yeast surface display system of claim 4 or 5, wherein the formulation is one or more of an antibody, an oral vaccine, a feed supplement.

Images