CN110747136A

CN110747136A - Pichia pastoris strain KM71 and application

Info

Publication number: CN110747136A
Application number: CN201911163532.6A
Authority: CN
Inventors: 左志晗; 孙金生; 李艳红; 张晶晶; 张晓月
Original assignee: Tianjin Normal University
Current assignee: Tianjin Normal University
Priority date: 2019-11-25
Filing date: 2019-11-25
Publication date: 2020-02-04
Anticipated expiration: 2039-11-25
Also published as: CN110747136B

Abstract

The invention belongs to the field of bioengineering, and particularly relates to a Pichia pastoris (Pichia pastoris) strain KM71 and application, wherein the strain is preserved in the common microorganism center of China Committee for culture Collection of microorganisms, the preservation number is CGMCC No.14575, the strain, fermentation broth or a product thereof is lipopolysaccharide polypeptide, has obvious antibacterial activity, especially has obvious inhibition effect on various pathogenic bacteria such as escherichia coli, vibrio anguillarum, vibrio parahaemolyticus, Edwardsiella, staphylococcus aureus and the like, can be used for preparing a feed additive for aquatic animal culture for disease control, improving the immunity of aquatic animals and improving a microecological preparation of a culture water body, and has the characteristics of safety, high efficiency, no residue, no drug resistance and no toxic or side effect, and has the potential of replacing feed antibiotics.

Description

Pichia pastoris strain KM71 and application

Technical Field

The invention belongs to the field of bioengineering, and particularly relates to a Pichia pastoris (Pichia pastoris) strain KM71 and application thereof.

Background

Anti-Lipopolysaccharide factor (ALF) is a Lipopolysaccharide binding protein, is a type of antibacterial peptide widely existing in crustacean bodies, is firstly separated and identified from amebocyte of American horseshoe crab, and can be cloned to ALF genes with different fragment sizes and base sequences in crustacean bodies of the same species. The innate immune defense system of crustaceans can discover harmful exogenous microorganisms entering the body and eliminate the harmful exogenous microorganisms in time, protect the organism from being damaged, and has particularly strong defense capacity. Therefore, the anti-lipopolysaccharide factor cloned in the crustacean body with various shapes and functions can play a role in enhancing the immune defense capability of the organism.

Based on the fact that ALF has good bacteriostatic activity, and the ALF directly neutralizes lipopolysaccharide on bacterial cell walls and dissolves bacteria, and the action mechanism of ALF is different from that of traditional antibiotics, so that ALF does not generate residue or generate drug resistance in animals, and ALF is expected to replace the traditional antibiotic therapy as an effective new way for controlling diseases, improving immunity and controlling water quality. The antibacterial product produced by the anti-lipopolysaccharide factor has a very considerable development prospect in both aquaculture industry and medical field.

At present, 7 forms of ALF factors (FcALF1, FcALF2, FcALF3, FcALF4, FcALF5, FcALF6 and FcALFc) are cloned and obtained in Chinese prawns (Guo Shuyue et al, research on polymorphism and functional activity of anti-lipopolysaccharide factors of Chinese prawns [ D ]. Qingdao: Zhongkoyao institute of oceanic research, 2014.) the documents only disclose polypeptides corresponding to main functional regions of the 7 genes, and more importantly, the synthesized polypeptide ALF4 functional region only has an inhibition effect on escherichia coli in gram-negative bacteria, and cannot inhibit gram-negative bacteria vibrio anguillarum, gram-positive bacteria micrococcus luteus and clitococcus, which indicates that the synthesized polypeptide ALF4 functional region has a narrow inhibition spectrum and a poor inhibition effect.

Disclosure of Invention

Therefore, the technical problem to be solved by the invention is to provide a pichia pastoris (Pichiapastoris) strain KM71 and application, wherein the strain, fermentation liquor or a product thereof has a wide antibacterial spectrum against lipopolysaccharide polypeptides, can inhibit gram-negative pathogenic bacteria and gram-positive pathogenic bacteria such as vibrio anguillarum, vibrio parahaemolyticus, edwardsiella, escherichia coli, staphylococcus aureus and the like, has an obvious inhibiting effect on various pathogenic bacteria, has obvious antibacterial activity, and can be used for preparing feed additives for aquatic animal culture to prevent and treat diseases, improve the immunity of aquatic animals and improve microecologics of water body culture.

Therefore, the invention provides the following technical scheme:

the invention provides a Pichia pastoris (Pichia pastoris) strain KM71, which is preserved in China general microbiological culture Collection center (CGMCC) in 2017 for 5 days in 9 years, and the CGMCC is adopted as the address of No.3 of West Lu No.1 of the Korean area in Beijing, and the preservation number is CGMCC No.14575 by the institute of microbiology in the China academy of sciences.

The invention provides a bacteriostatic agent, which comprises the bacterial strain, the bacterial strain fermentation liquor or the product of the bacterial strain anti-lipopolysaccharide polypeptide; the anti-lipopolysaccharide polypeptide has an amino acid sequence shown as SEQ ID NO. 1.

The invention provides a feed additive, which comprises the strain, the strain fermentation liquor or the product of the strain, namely anti-lipopolysaccharide polypeptide; the anti-lipopolysaccharide polypeptide has an amino acid sequence shown as SEQ ID NO. 1.

The invention provides a feed composition, which comprises the bacterial strain, the fermentation liquor of the bacterial strain or the anti-lipopolysaccharide polypeptide product of the bacterial strain and a physiologically acceptable excipient or diluent; the anti-lipopolysaccharide polypeptide has an amino acid sequence shown as SEQ ID NO. 1.

The feed composition comprises 15-25 parts by volume of fermentation liquor of the strain, 100 parts by weight of prawn feed and 5-15 parts by weight of sodium alginate; the final concentration of the strain in the feed composition is 3-6 multiplied by 10⁷CFU/g; the ratio of the parts by weight to the parts by volume is g/ml.

The invention provides the following application of a1-a3 in bacteriostasis, wherein the a1-a3 is as follows:

a1, the above strains;

a2, the bacteriostatic agent; and/or

a3, the feed additive.

In the use, the inhibiting includes inhibiting gram-positive and/or gram-negative bacteria;

in said use, said gram-positive bacteria comprise staphylococcus aureus; the gram-negative bacteria comprise escherichia coli, vibrio anguillarum, vibrio parahaemolyticus or edwardsiella.

The application comprises the application of preparing a preparation for inhibiting the infection of the prawn vibrio parahaemolyticus.

The application comprises the application of preparing a preparation for improving the immunity, the body length or the body weight of the prawns.

Preferably, the method comprises the application of preparing a preparation or feed for improving the immunity or survival rate of the cynoglossus semilaevis; more preferably, the preparation method comprises the application of preparing a preparation or feed for improving the resistance of the cynoglossus semilaevis to the ascites disease.

The technical scheme of the invention has the following advantages:

1. the Pichia pastoris strain KM71 provided by the invention is preserved in the China general microbiological culture Collection center (CGMCC No. 14575), the preservation number is CGMCC No.14575, the strain can highly express the anti-lipopolysaccharide polypeptide, so the fermentation broth of the strain also has obvious bacteriostatic action, in-vitro bacteriostatic tests show that the strain has obvious inhibitory action on various pathogenic bacteria such as escherichia coli, vibrio anguillarum, vibrio parahaemolyticus, edwardsiella, staphylococcus aureus and the like, the strain, the fermentation broth or the product thereof has wide bacteriostatic spectrum, can inhibit gram-negative pathogenic bacteria and gram-positive pathogenic bacteria, has obvious bacteriostatic effect, and can be used for preparing feed additives for aquatic animal culture to prevent and treat diseases, improve the immunity of aquatic animals and improve the microecological preparation of culture water, and simultaneously has the characteristics of safety, high efficiency, no residue, no drug resistance and no toxic or side effect, and can replace feed antibiotics.

2. The feed additive provided by the invention comprises the Pichia pastoris strain KM71, fermentation liquor or a product thereof, and can promote the rapid growth of the small shrimps and provide the immunity of the small shrimps in the growth period: test results show that the activities of specific and non-specific immunoenzymes such as polyphenol oxidase, peroxidase, acid phosphatase, superoxide dismutase SOD, catalase and lysozyme of prawns fed with the feed added with the Pichia pastoris KM71 strain fermentation liquor are improved to different degrees relative to control prawns, the enzyme activity level proves that the immunity of the prawns fed with the feed added with the Pichia pastoris KM71 strain fermentation liquor is obviously improved, the death rate of the prawns is greatly reduced, the safety is high, the raw material source is wide, the price is low, and most importantly, the configuration of the feed is more green and safe compared with the purchase of finished feed, and the cost is low;

the survival rate and the weight gain rate of the prawns can be obviously improved while the growth of the prawns is ensured: the test results show that the weight of the prawns fed with the Pichia pastoris KM71 strain fermentation broth feed is remarkably increased compared with that of a control group, and the weight of an experimental group fed with the litopenaeus vannamei feed is increased by 11.23% compared with that of the control group, so that the litopenaeus vannamei feed has a certain promotion effect on increasing the weight of the prawns;

in addition, the feed additive has obvious effect on improving the disease resistance of prawns. In experiments of infecting prawns by intramuscular injection of pathogenic vibrio parahaemolyticus, the survival rate of prawns fed with the feed additive is obviously higher than that of a control group by 28.71 +/-6.31 percent, and the experimental results show that the resistance of the prawns to pathogenic vibrio parahaemolyticus improved by adding Pichia pastoris KM71 strain fermentation liquor in the feed is obviously enhanced.

The feed additive provided by the invention is used for feeding prawns, so that the propagation of pathogenic vibrio in aquaculture water can be inhibited, the growth of the prawns is promoted, the related activity of the immunoenzyme of the prawns is improved, the disease resistance of the prawns is improved, the occurrence of diseases of the prawns is reduced, and particularly, the feed additive has good effects on the prevention and treatment of the vibrio diseases of the prawns and the increase of the yield of the.

Furthermore, the feed additive provided by the invention is used for feeding the cynoglossus semilaevis diseased fish suffering from the ascites disease, and the feed additive provided by the invention is found to have an immunoprotection effect on the cynoglossus semilaevis diseased fish suffering from the ascites disease, obviously enhance the resistance of the cynoglossus semilaevis to the ascites disease and carry out immunoprotection on the cynoglossus semilaevis.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 is a PCR detection electrophoresis diagram of recombinant plasmid pMD18-T-FcALF in example 1 of the present invention, wherein M is Marker, 4, 5, 6 are PCR products of pMD18-T-FcALF4, and "negative" is a negative control PCR result using pMD18-T empty vector as a template;

FIG. 2 is a PCR detection electrophoresis diagram of pPIC9K-FcALF4 in example 1 of the present invention, wherein M is Marker, and EcoRI-NotI double-restriction digestion pPIC9K-FcALF4 recombinant plasmid is 1, 2, 3;

FIG. 3 is the PCR detection electrophoresis chart of the recombinant strain pPIC9K-FcALF4 in example 2 of the present invention, wherein M is Marker, 1, 2, 3 are positive transformants, and "positive" is pPIC9K-FcALF4 vector positive control;

FIG. 4 is a graph showing the results of high-copy transformant screening using G418 YPD plates in example 2 of the present invention;

FIG. 5 is a morphological diagram of a colony of Pichia pastoris KM71 in example 2 of the present invention;

FIG. 6 shows the detection of the bacteriostatic activity of fermentation broth (the indicator bacteria used are Escherichia coli) at different times in example 3 of the present invention;

FIG. 7 is a diagram showing the results of SDS-PAGE in example 3 of the present invention;

FIG. 8 is a graph showing the results of the detection of the bacteriostatic activity in example 4 of the present invention;

FIG. 9 is a graph showing the results of measurement of immunological indicators of shrimps in example 6 of the present invention, wherein (a) is measurement of superoxide dismutase; (b) measuring the activity of polyphenol oxidase; (c) is the determination of catalase activity; (d) measuring the activity of the peroxidase; (e) the activity of the lysozyme is measured; (f) measuring the activity of the acid phosphatase;

FIG. 10 is a graph showing the measurement of body length and body weight gain of prawns in example 6 of the present invention, wherein (a) is the measurement of body length gain and (b) is the measurement of body weight gain;

FIG. 11 is a graph showing the results of the determination of the mortality of prawn after infection with Vibrio parahaemolyticus in example 6 of the present invention.

Detailed Description

The invention is described below by means of specific embodiments. Unless otherwise specified, the technical means used in the present invention are well known to those skilled in the art. In addition, the embodiments should be considered illustrative, and not restrictive, of the scope of the invention, which is defined solely by the claims. It will be apparent to those skilled in the art that various changes or modifications in the components and amounts of the materials used in these embodiments can be made without departing from the spirit and scope of the invention. The raw materials and reagents used in the present invention are commercially available.

LB solid medium was purchased from Biotechnology Ltd;

pMD18-T vector was purchased from Dalibao Bio;

coli DH5 α competent cells were purchased from Biotechnology Ltd;

pichia pastoris KM71 was supplied by the university of china ocean;

the MD plate formula and the preparation method comprise the following steps: 15g agar dissolved in 800mL water, 121 degrees C sterilization for 15min, cooling to 60 degrees C after adding 100mL 10X YNB, 100mL 10X D (20% glucose solution), 2mL 500X B (0.02% biotin), mixing, and then plate.

The YPD flat plate formula and the preparation method comprise the following steps: preparing an aqueous mixture containing 10g/L yeast extract, 20g/L glucose and 20g/L peptone, and sterilizing at 115 deg.C for 15 min.

The BMGY culture medium formula and the preparation method are as follows: 10g yeast extract, 20g peptone dissolved in 700mL water and sterilized at 121 ℃ for 15min, after cooling to room temperature 100mL 1M potassium phosphate buffer, 100mL10 XYNB, 100mL10 XGY (10% glycerol), 2mL500 XB;

the formula and the preparation method of the BMMY culture medium comprise the following steps: 10g of yeast extract and 20g of peptone were dissolved in 700mL of water and sterilized at 121 ℃ for 15min, and 100mL of 1M potassium phosphate buffer, 100mL of 10 XYNB, 100mL of 10 XM (5% methanol), 2mL of 500 XB (0.02% biotin) were added after cooling to room temperature

The prawn feed is Guangdong sea prawn feed provided by Hanstan district prawn breeding base in Tianjin;

the cynoglossus semilaevis feed is provided by a sea-developing treasure industry development limited company in Tianjin;

the Litopenaeus vannamei is purchased from a Hangu district prawn culture base in Tianjin;

the cynoglossus semilaevis diseased fish with ascites disease is provided by Shanghai treasure industry development Limited company in Tianjin; \ u

Prawn anticoagulant formulaTable

5 below shows：

TABLE 5 anticoagulant formulation for prawns

Prepared according to the formulation of the above table 5,adjusting pH to 7.45 with concentrated hydrochloric acidTo obtain the prawn anticoagulant。

The penaeus chinensis is provided by a Bohai sea aquatic resource proliferation station of the research institute of aqueous production in Tianjin city.

Example 1 construction of recombinant expression plasmid pPIC9K-FcALF4

(1) Designing a primer: designed according to the nucleotide sequence shown in SEQ ID NO.2

The nucleotide sequence of the amino acid sequence shown as SEQ ID NO.1 for encoding the anti-lipopolysaccharide polypeptide is shown as SEQ ID NO.1 Shown in NO.2, the 5 'end and the 3' end in the sequence shown in SEQ ID NO.2 are respectively provided with an initiation codon (ATG) and a stop codon (TGA)。Designing primers according to a nucleotide sequence (FcALF4 gene) shown in SEQ ID NO.2, respectively introducing enzyme cutting sites Not I and EcoR I into 5' ends of designed upstream and downstream primers, designing a 6 × his label for the downstream primer so as to facilitate the purification of later-period recombinant protein (the primers are synthesized by Beijing Jinwei science and technology, Inc.), wherein the sequences of the primers are as follows or as shown in SEQ ID NO. 3-4:

FcALF4-F：GCGAATTCCAAGGCGTGCAGGACC；

FcALF4-R：AAGGAAAAAAGCGGCCGCTCAATGATGATGATGATGATGGTGTTCAAGCCAAATC；

(2) obtaining of Penaeus chinensis cDNA

① RNA extraction of Chinese prawn

1) Hemolymph is extracted from abdominal hemosinus of prawn, and anticoagulant of prawn with equal volume is added. Centrifuging hemolymph at 4 deg.C and 800g for 10 min;

2) the supernatant was removed and blood cells were collected and 1000. mu.L of LTrizal was added in large excess (Trizal, 4 ℃ C.). Centrifuging at 12000g for 10min at 4 deg.C (to remove excessive protein, fat and polysaccharide);

3) taking the supernatant, standing for 5min to completely crack the supernatant;

4) chloroform (stored at normal temperature, dedicated to RNA) was added at a ratio of 1mL Trizal: 200 μ L of chloroform;

5) adding 200 μ L chloroform, shaking for 15 s (manually), standing at room temperature for 2-3 min;

6) centrifuging at 4 deg.C and 12000g for 15min to obtain three layers, wherein the upper layer (colorless water phase) is RNA, the middle layer (floccule) is DNA, and the lower layer (light red, phenol chloroform phase) is protein, etc.;

7) a small amount of supernatant (less and no more, avoiding DNA aspiration) was taken, and 500 μ L of isopropanol (RNA: isoamyl alcohol 1: 1) gently and slowly mixing, standing for 15min to precipitate RNA;

8) centrifuging at 4 deg.C and 1200g for 10min, discarding supernatant, and draining;

9) adding 1mL of 75% ethanol, and sucking and beating the mixture by a gun head to float the RNA;

10) centrifuging at 4 deg.C and 7500g for 6min, discarding supernatant, placing on filter paper, inverting, draining for about 15min, and sucking off ethanol from side wall of EP tube with small strips cut by scissors;

11) dissolving with appropriate amount of DEPC water (more precipitate is 20 μ LDEPC, less precipitate is 15 μ LDEPC), and dissolving immediately if it is pure RNA;

12) water bath at 55 deg.C for 5min, taking out, storing on ice for subsequent spotting, PCR amplification of cDNA, etc., and storing in-80 deg.C refrigerator;

② Synthesis of Penaeus chinensis cDNA

Taking 2 mu g of total RNA of the penaeus chinensis as a reverse transcription template, taking an upstream primer as a joint primer BDA, taking a downstream primer as AOLP, and taking a primer sequence: BDA-AAGCAGTGGTATCAACGCAGAGTACGCGGG; AOLP-GGCCACGCGTCGACTAGTAC(T)16(A/C/G)

1) Denaturation of RNA

The PCR instrument is started to preheat for 20min, simultaneously the reagents are sequentially added on ice according to the table 1, the temperature is kept at 70 ℃ for 5min, and then the mixture is rapidly cooled on ice for more than 2min to remove DNA denatured RNA.

TABLE 1 reagents for RNA denaturation

2) Reverse transcription of cDNA

According to the system shown in the table 2, the reagents are sequentially added into the system 1, and then the reaction is carried out for 2 hours at 42 ℃; keeping the temperature at 70 ℃ for 15min, and cooling on ice.

TABLE 2 reagents used for RT-PCR

In conclusion, the reaction program of the PCR instrument is set to be 37 ℃ and 30 min; 5min at 70 ℃; at 42 ℃ for 2 h; 15min at 70 ℃; 4 ℃ for 10 min. The cDNA was stored at-20 ℃ for 2min on ice.

(3) Cloning of FcALF4 Gene

Taking the cDNA of the penaeus chinensis obtained in the steps as a template, sequentially adding the reagents into a 200 mu L EP tube according to a PCR amplification system shown in the following table 3, uniformly mixing, and amplifying according to the following amplification program: pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ for 40s, annealing at 58 ℃ for 40s, extension at 72 ℃ for 1min, and 35 cycles; total extension at 72 ℃ for 10 min; keeping the temperature at 4 ℃ for 5 min.

TABLE 3 PCR amplification System

(4) FcALF4 gene connection pMD18-T vector

And (3) recovering the PCR product obtained in the step (3) by using an electrophoresis gel, connecting the recovered PCR product with a pMD18-T vector (according to the specification of a productive pMD18-T vector), connecting the PCR product at 16 ℃ overnight, transforming the Escherichia coli DH5 α competent cells by using the connecting product, coating the transformed Escherichia coli DH5 α competent cells on an LB-Amp100 solid culture medium, culturing the Escherichia coli DH5 α competent cells at 37 ℃ overnight, detecting grown transformants by using a PCR method by using FcALF4-F and FcALF4-R as primers, and sequencing clones which are positive in PCR detection to obtain pMD18-T-FcALF4, wherein the detection results are shown in a figure 1.

(5) Construction of recombinant expression plasmid pPIC9K-FcALF4

The pMD18-T-FcALF4 plasmid in the step (4) is subjected to double digestion by EcoRI and NotI, the target gene is recovered, then T4DNA ligase is carried out on the recovered pMD18-T-FcALF4 plasmid and the recovered pMD18-T-FcALF plasmid and the recovered pMD-FcALF plasmid and pPIC9K vector subjected to double digestion by EcoRI and NotI at 16 ℃ overnight, the ligation product is transformed into escherichia coli DH5 α competent cells, and the cells are coated¹⁰⁰Culturing on solid medium at 37 deg.C overnight with 5 'AOX 1 and 3' AOX1 as primers and PCThe grown transformants were verified by the R method, the detection results are shown in FIG. 2, and the clones that were positive for PCR detection were sequenced to obtain the recombinant expression plasmid pPIC9K-FcALF 4.

Example 2 construction of recombinant Strain pPIC9K-FcALF4

(1) The recombinant expression plasmid pPIC9K-FcALF4 is transformed into pichia pastoris KM71

The recombinant plasmid pPIC9K-FcALF4 prepared in example 1 was linearized with Sac I, and the cleavage products were detected by 1% agarose gel electrophoresis and purified using a DNA gel recovery kit (supplied by Dalibao Biotech).

(2) Transformed yeast competent cells

And (2) converting the enzyme cutting product purified in the step (1) into yeast competent cells. Firstly, preparing competent cells of Pichia pastoris KM71, transferring linearized recombinant plasmid pPIC9K-FcALF4 (an enzyme cutting product purified in the step (1)) into the Pichia pastoris KM71 competent cells by adopting an electric shock transformation method, coating the competent cells on an MD plate until a single clone grows out, then carrying out PCR detection on positive transformants by adopting primers 5 'AOX and 3' AOX, respectively spotting the screened positive transformants on G418 YPD plates with different concentrations to screen high Copy yeasts, wherein the screening result is shown in figure 4, and the specific method refers to the specification of Invitrogen company (Multi-Copy Pichia pastoris Expression transformant Kit, Version F) to name the obtained high Copy transformants as Pichia pastoris KM 71.

Morphological identification is carried out on the screened high-copy transformants, and the result is shown as 5, and the morphological characteristics of the strain are as follows: the bacterial colony is milk white, the bacterial colony is wet and sticky, the surface is smooth, the edge is neat, the uplift degree is high, and the colors of the front side and the back side are consistent. The Pichia pastoris KM71 is preserved in China general microbiological culture Collection center (CGMCC) in 2017 for 5 days in 9 years, wherein the CGMCC is No.3 of West Lu No.1 of Beijing university and Chaoyang district, and the preservation number is CGMCC No. 14575.

Example 3 inducible expression and purification assay of anti-lipopolysaccharide polypeptide (rFcALF4)

(1) Inducible expression of anti-lipopolysaccharide polypeptide (rFcALF4)

The recombinant strain Pichia pastoris KM71 obtained in example 2 is picked and cloned into 100mL BMGY medium, cultured at 30 ℃ until OD600 is 2-6, centrifuged to collect cells, precipitated cells are resuspended in 100mL BMMY medium, continuously cultured, 100 muL of 100% methanol is added every 24h for induction, samples are taken at 0h, 24h, 48h, 72h, 96h, 120h and 144h, the bacteriostatic activity of the induced product is detected, the optimal induction time is determined, the detection result is shown in FIG. 6, and the recombinant anti-lipopolysaccharide polypeptide rFcALF4 has the largest bacteriostatic circle at 84 h of methanol induction, which indicates the maximum expression level.

(2) Purification assay for anti-lipopolysaccharide polypeptide (rFcALF4)

And (3) preparing fermentation liquor by the Pichia pastoris KM71 according to the induction expression method in the step (1) with the optimal induction time of 84 hours, and sampling to detect the activity of the fermentation liquor and determine the protein content. By Capturem^TMThe detection result is shown in figure 7, after purification, the hybrid protein is effectively removed, the size of the recombinant anti-lipopolysaccharide polypeptide rFcALF4 is close to 17KDa, and the amino acid sequence of the purified recombinant anti-lipopolysaccharide polypeptide rFcALF4 is shown in SEQ ID No.1 after sequencing.

Example 4 bacteriostatic assay

The supernatant of the fermentation liquid in (2) in example 3 was subjected to bacteriostatic activity analysis, which included the following steps:

respectively inoculating indicator bacteria such as escherichia coli, vibrio anguillarum, vibrio parahemolyticus, edwardsiella and staphylococcus aureus into an LB liquid culture medium, and shaking at the constant temperature of 37 ℃ for 16-18 h; measuring the OD600 value of the activated indicator bacterium by using a spectrophotometer, wherein the OD value is preferably 0.6-0.8;

taking 150 mu L of indicator bacterial suspension to be evenly coated in an LB solid culture medium, clamping a sterile filter paper sheet by using a sterile forceps, putting the sterile filter paper sheet into the supernatant of a fermentation liquid to be detected for soaking, putting the sterile filter paper sheet into the corresponding position of a culture dish of the LB solid culture medium, culturing for 24h at the constant temperature of 37 ℃, observing and recording the generation condition of antagonistic plaques, and displaying that the bacteriostatic circle of the supernatant of the fermentation liquid of a recombinant strain Pichia pastoris KM71 is obvious and clear, wherein the bacteriostatic effect graph is as shown in figure 8, and a: staphylococcus aureus b: e, Escherichia coli c: vibrio anguillarum d: vibrio parahaemolyticus e: edwardsiella f: vibrio harveyi has obvious inhibiting effect on the growth of 6 common pathogenic bacteria of Escherichia coli, Vibrio anguillarum, Vibrio parahaemolyticus, Edwardsiella, Vibrio harveyi and Staphylococcus aureus.

Example 5 feed additive

The embodiment provides a feed additive, an activated recombinant strain Pichia pastoris KM71 is inoculated into a fermentation tank containing a BMGY culture medium, the culture is carried out at 30 ℃, the culture is carried out until OD600 is 2-6, cells are collected by centrifugation, precipitated cells are suspended in the fermentation tank containing the BMMY culture medium, the culture is continued, 100 mu L of 100% methanol is added every 24 hours for induction, 84 hours are carried out, fermentation liquor of the recombinant strain Pichia pastoris KM71 is obtained, and the final concentration of the recombinant strain Pichia pastoris KM71 in the fermentation liquor is 3-5 x 10⁸CFU/mL, namely the feed additive.

Example 6 immunoprotection of feed additives against prawn

(1) Feed additive and prawn feeding management

Experimental groups: the feed additive prepared in the embodiment 5 is fully mixed with prawn feed, wherein 10g of sodium alginate and 20mL of fermentation liquor of Pichia pastoris KM71 strain are added into each 100g of prawn feed, and the final concentration of recombinant strain Pichia pastoris KM71 in the mixture is 3-6 × 10⁷CFU/g；

Blank control group: the prawn feed is the same prawn feed without adding fermentation liquor.

The feeding method comprises the following steps: 2 breeding ponds in the same breeding workshop are selected, and 2000 litopenaeus vannamei boone with the initial weight of about 3.9g and the body length of about 5.3cm are respectively thrown in the breeding ponds. Feeding the feed according to 5 wt% of the weight of the litopenaeus vannamei, and feeding the litopenaeus vannamei for 4 times every day. The change of water in the culture pond is observed and the water is changed in time, so that the problem that the prawn grows slowly or is infected by diseases due to over turbid water or deteriorated residual feed is avoided.

(2) Sample collection and prawn immunity index and weight gain rate determination

a. Collecting a sample: the experimental period is 25 days, sampling is carried out once every 5 days, 30-40 litopenaeus vannamei boone are randomly taken in each group during sampling, hemolymph is extracted from the blood sinuses of the litopenaeus vannamei boone, a prawn anticoagulant is added according to the volume ratio of 1:1, and centrifugation is carried out at 4 ℃ for 10min at 800g, so as to obtain hemocytes and serum. Discarding blood cells, and placing serum on ice for later use; dissecting the litopenaeus vannamei after blood collection, collecting intestinal tracts, removing intestinal tract contents, and adding the following enzyme activity determination kits in proportion: the tissue samples were prepared by grinding and centrifuging enzyme extracts from a polyphenol oxidase kit, a peroxidase kit, an acid phosphatase activity kit, a superoxide dismutase kit, a catalase kit and a lysozyme kit (all of the kits were purchased from Suzhou Ke Ming test biological reagents, Ltd.).

b. Determination of activity of non-specific immune related enzyme in blood plasma of litopenaeus vannamei:

protein content determination in the samples taken was performed using the Coomassie Brilliant blue kit available from Suzhou Ke Ming-test BioAgents, Inc.

Protein content (μ g/mL) × (assay-a blank) ÷ (standard-a blank).

① determination of polyphenol oxidase activity

The measurement of the activity of polyphenol oxidase was carried out using a kit from Suzhou Keming BioLimited, according to the kit instructions. The experiment defines that the change of the absorption value at 525nm of each mg of protein in a reaction system is 0.01 as one enzyme activity unit

Polyphenol oxidase activity (U/mg prot) ═ total reaction volume/sample volume ÷ reaction time ÷ 0.01 × (assay-a control) ÷ protein concentration (mg/mL).

② determination of peroxidase Activity

The peroxidase activity was measured using a kit from Suzhou Keming BioLimited, according to the kit instructions. This experiment defines a change in A470 per minute per mL of serum in the reaction system of 0.01 per minute as a unit of enzyme activity.

Peroxidase activity (U/mL) ═ total reaction volume ÷ sample volume ÷ 0.01 × Δ A

In the above formula,. DELTA.A is the change in the absorbance of the reaction system at a measurement wavelength of 470nm over a measurement time,. DELTA.t- (min).

③ determination of acid phosphatase Activity

The determination of the activity of acid phosphatase was carried out using a kit from Suzhou Keming Bio Inc., according to the kit instructions. This experiment defines the catalytic production of 1. mu. mol phenol per ml of blood per minute at 37 ℃ as one unit of enzyme activity.

Acid phosphatase activity (U/mL) [ C standard × (a assay tube-a control tube) ÷ (a standard tube-a blank tube) × V reaction total volume ]/[ V sample (sample volume) × V sample total volume ÷ T (reaction time) ]

④ determination of SOD activity of superoxide dismutase

The determination of the activity of superoxide dismutase was carried out using a kit from Suzhou Keming BioLimited, according to the kit instructions. The experiment defines that when the inhibition rate in a xanthine oxidase coupling reaction system is 50 percent, the SOD enzyme activity in the reaction is an enzyme activity unit

Percent inhibition ═ a control tube-a assay tube)/a control tube × 100%

SOD activity (U/mL) ═ percent inhibition/(1-percent inhibition)

⑤ determination of Catalase Activity

Determination of catalase activity the kit from Suzhou Keming BioLimited was used, following the kit instructions. This experiment defines the amount of hydrogen peroxide decomposed to 1. mu. mol per second per ml of serum as one unit of activity.

Catalase activity (U/mL) ═ a control-a assay × 271/(60 × sample size) × dilution factor before sample testing.

⑥ determination of the Activity of the lysozyme

Using freeze-dried powder of Micrococcus Lysoleickicus (produced by Nanjing institute of bioengineering) as substrate, and preparing substrate suspension with 0.1M potassium phosphate buffer solution (pH6.4) to make OD_570nmApproximately equals to 0.3-0.5; adding into 96-well plateSerum and bacterial suspension, serum: bacterial suspension 1: 10 (volume ratio), and measuring the absorbance at 570nm to obtain the initial absorbance A₀(ii) a Carrying out water bath at 37 ℃ for 15min, carrying out ice bath for 3min, and determining the light absorption value at 570nm as A; lysozyme activity (U/mL) ═ A₀-A)/A。

Test results show that the activities of specific and non-specific immunoenzymes such as polyphenol oxidase, peroxidase, acid phosphatase, superoxide dismutase SOD, catalase and lysozyme of prawns fed with the feed added with the fermentation liquid of the Pichia pastoris KM71 strain are improved to different degrees compared with the prawns of a Control group, and specific results are shown in figure 9 (ALF 4 in the figure represents the prawns fed with the fermentation liquid of the Pichia pastoris KM71/pPIC9K-FcALF4 strain, and Control represents the Control), and the enzyme activity level proves that the immunity of the prawns fed with the fermentation liquid of the Pichia pastoris KM71 strain is obviously improved.

c. Determination of body length and weight gain rate of Litopenaeus vannamei

Before the experiment begins, 50 litopenaeus vannamei boone are randomly taken out from each group of culture ponds, the body length and the body weight of the litopenaeus vannamei boone are measured, and L is recorded respectively₀、W₀And after the feeding experiment is finished, randomly taking 50 tails from each group of culture ponds to measure the body length and the body weight of the culture ponds, and recording L, W. And calculating the weight gain rate of each group of prawns:

body length increase (%) - (L-L)₀)/L₀×100％

Body weight gain rate (WGR,%) - (W-W)₀)/W₀×100％

Test results show that the body length and the body weight of the prawns fed with the Pichia pastoris KM71 strain fermentation broth feed are remarkably increased compared with those of a Control group, and the results show that the addition of the Pichia pastoris KM71 strain fermentation broth has certain promotion effect on the increase of the body length and the body weight of the prawns, and the specific results are shown in figure 10 (ALF 4 in the figure represents the prawns fed with the Pichia pastoris KM7 strain fermentation broth feed, and Control represents the Control).

d. Determination of mortality rate after challenge test of cultured prawns

After the feeding test is finished, namely the 26 th day of the feeding test, 210 litopenaeus vannamei with uniform size in each group are taken for the toxicity counteracting test, and the 210 litopenaeus vannamei in each group are randomly divided into three groups in parallel. Performing challenge test by intramuscular injection on the second abdominal node of prawn to obtain pathogenic bacteria Vibrio parahaemolyticus with concentration of 3.58 × 10⁷cell/mL, injection volume of 15 u L (this dose through experimental determination). And after the poison attacking is finished, observing the survival condition of the prawns, recording the death number of the prawns, and calculating the death rate of the prawns within 144 h.

After the feeding test is finished, the cumulative mortality results of the prawns in the infection experiment period are shown in figure 11 (ALF 4 in the figure represents the prawns fed with the fermentation broth feed of the Pichia pastoris KM71 strain, namely the experimental group and Control represents the Control), as can be seen from the figure, after the prawns in the experimental group and the Control group are infected by pathogenic bacteria for 12 hours, the mortality of the prawns in the experimental group is obviously lower than that of the Control group, the mortality of the prawns in the experimental group and that of the Control group is gradually obvious along with the extension of the infection time, the difference is the most obvious when the prawns in the two groups are infected for 60 hours, the cumulative mortality of the prawns in the experimental group is obviously lower than that of the blank group (P <0.01) in the whole infection period until the sixth day of infection, the mortality of the Control group is 100%, the mortality of the experimental group is 71.29% +/-6.31%, and the experimental results show that the anti-lipopolysaccharide polypeptide added in the feed, the immunoprotection rate of the prawn is 28.71% +/-6.31%.

Example 7 immunoprotection of feed supplement against Cynoglossus semilaevis Gunther suffering from ascites disease

(1) Feed additive addition and feeding management

Experimental groups: mixing the cynoglossus semilaevis feed and the feed additive prepared in the embodiment 5 sufficiently to ensure that the final concentration of the recombinant strain Pichia pastoris KM71 in the mixture is 1-2 × 10⁸CFU/g；

Blank control group: the same cynoglossus semilaevis feed without adding fermentation liquor.

Feeding: selecting and sharing 60 fish of a 9-11 cm-long cynoglossus semilaevis with ascites disease into a blank control group and an experimental group, randomly dividing 30 cynoglossus semilaevis in each group into three parallel fish, and carrying out a feeding experiment for 2 weeks by 10 parallel fish, feeding feed according to 5% of the weight of the cynoglossus semilaevis every day with the feeding frequency of 2 times/day in the feeding process, fishing out uneatened bait after feeding for 1h, observing the survival condition of the cynoglossus semilaevis, recording the survival number of the cynoglossus semilaevis, and calculating the survival rate of the cynoglossus semilaevis within 2 weeks.

The experiment results show that the accumulated survival number and survival rate of the cynoglossus semilaevis are shown in the table 4,calculating average survival from survival The activity rate and standard deviation, the calculated results are asTable 4, in the first week of the feeding experiment, the survival rates of the cynoglossus semilaevis of the experimental group and the control group begin to be different, the survival rate of the cynoglossus semilaevis of the experimental group is 100% and is obviously higher than that of the control group by 76.67% ± 4.71%, the survival rate of the two groups of cynoglossus semilaevis gradually becomes obvious along with the extension of the feeding time, the average survival rate of the control group is 43.33% ± 4.71% and the survival rate of the experimental group is 76.67% ± 4.71% when the feeding experiment is finished, and the experimental result shows that the resistance of the cynoglossus semilaevis to the ascites disease is obviously enhanced by adding the anti-lipopolysaccharide polypeptide of the present invention into the feed, and the immune protection rate of the cynoglossus semilaevis is.

TABLE 4 survival odds of cynoglossus semilaevis in each group after feeding

Example 8 acute toxicity test

The feed additive of example 5 was used for testing

Taking SPF-grade KM mice with the weight of 18-22 g and 10 males and females respectively, performing intragastric gavage by using the feed additive of the embodiment 5, wherein each intragastric gavage is 0.4mL, and the intragastric gavage is performed for 5 times within 24 hours, and each intragastric gavage is 2 mL. The observation was continued for 7 days, and the weight was weighed on day 7. The results show that the experimental mice have no abnormal condition and the weight is normally increased. The feed additive of example 5 is shown to be safe and non-toxic.

Example 9 feed composition

The embodiment of the invention provides a feed composition, which consists of prawn feed, the feed additive in the embodiment 5 and sodium alginate; wherein 10g of sodium alginate and 20mL of the feed additive in the embodiment 5 are added into every 100g of prawn feed, and the prepared feed composition is blended so that the final concentration of the Pichia pastoris KM71 bacterial liquid is 3-6 multiplied by 10⁷CFU/g。

Example 10 feed composition

The embodiment of the invention provides a feed composition, which consists of prawn feed, the feed additive in the embodiment 5 and sodium alginate; wherein 15g of sodium alginate and 25mL of the feed additive in the embodiment 5 are added into every 100g of prawn feed, and the prepared feed composition is blended so that the final concentration of Pichia pastoris KM71 bacterial liquid in the prepared feed composition is 3-6 multiplied by 10⁷CFU/g。

Example 11 feed composition

The embodiment of the invention provides a feed composition, which consists of prawn feed, the feed additive in the embodiment 5 and sodium alginate; wherein 5g of sodium alginate and 15mL of the feed additive in the embodiment 5 are added into every 100g of prawn feed, and the prepared feed composition is blended so that the final concentration of the Pichia pastoris KM71 bacterial liquid is 3-6 multiplied by 10⁷CFU/g。

Example 12

The embodiment provides a method for feeding prawns by using the feed additive in the embodiment 5, which comprises the following steps:

(1) the feed additive of the embodiment 5 is mixed with feed, wherein 10g of sodium alginate and 20mL of fermentation liquor of Pichia pastoris KM71 strain are added into each 100g of prawn feed, and the prepared feed is blended to ensure that the final concentration of Pichia pastoris KM71 bacterial liquid is 3-6 × 10⁷CFU/g。

(2) Feeding the feed according to 5% of the weight of the prawns, feeding the prawns for 4 times every day, observing the change of water in the culture pond, changing the water in time, preventing the prawns from growing slowly or infecting diseases due to excessive turbidity of the water or deterioration of residual feed, and feeding the prawns for 25 days.

Example 13

The embodiment provides a method for feeding prawns by using the feed additive in the embodiment 8, which comprises the following steps:

the feed composition of the example 8 is taken, the feed is put in according to 5 percent of the weight of the prawns, the prawns are fed for 4 times every day, the change of water in the culture pond is observed, the water is changed in time, the situation that the prawns grow slowly or are infected by diseases due to excessive turbidity or deterioration of residual feed is prevented, and the prawns are fed for 25 days.

The particular embodiments described herein are illustrative only, as the invention may be modified and supplemented by, or substituted in a similar manner by, those skilled in the art without departing from the spirit of the invention or exceeding the scope of the appended claims. Although the present invention has been described in detail and with reference to specific embodiments thereof, it will be apparent to one skilled in the art that various changes and modifications can be made therein without departing from the spirit and scope thereof.

Sequence listing

<110> university of Tianjin

<120> Pichia pastoris strain KM71 and use

<130> case number?

<160>4

<170>SIPOSequenceListing 1.0

<210>1

<211>98

<212>PRT

<213> Artificial Synthesis (artificial Synthesis)

<400>1

Gln Gly Val Gln Asp Leu Leu Pro Ala Leu Val Asp Arg Ile Val Gly

1 5 10 15

Leu Trp His Ser Asp Glu Val Glu Phe Met Gly His Ser Cys Arg Tyr

20 25 30

Ser Gln Arg Pro Ser Phe Tyr Arg Trp Glu Leu Tyr Phe Asn Gly Arg

35 40 45

Met Trp Cys Pro Gly Trp Ala Pro Phe Thr Gly Arg Ser Arg Thr Arg

50 55 60

Ser Pro Ala Gly Ala Val Glu His Ala Thr Arg Asp Phe Val Gln Lys

65 70 75 80

Ala Leu Gln Ser Asp Leu Ile Ser Glu Glu Asp Ala Arg Ile Trp Leu

85 90 95

Glu His

<210>2

<211>363

<212>DNA

<213> Artificial Synthesis (artificial Synthesis)

<400>2

atgcgagtct tggtcagctt tttagtggcc ctcagcctga ttgcacttgt gccacgttgc 60

cagggtcaag gcgtgcagga cctcctccct gccttagtag ataggatcgt tgggttgtgg 120

cactcggatg aggtggagtt catggggcac agttgcaggt acagccagcg cccttccttc 180

tataggtggg agctgtactt caacggcagg atgtggtgtc caggatgggc ccccttcact 240

ggccgatctc ggacccgcag ccccgccggc gccgtagagc acgcgacaag agacttcgtg 300

cagaaggcgc tgcagagtga cctcatctcg gaggaagacg ccaggatttg gcttgaacac 360

tga 363

<210>3

<211>24

<212>DNA

<213> Artificial Synthesis (artificial Synthesis FcALF4-F)

<400>3

gcgaattcca aggcgtgcag gacc 24

<210>4

<211>55

<212>DNA

<213> Artificial Synthesis (artificial Synthesis FcALF4-R)

<400>4

aaggaaaaaa gcggccgctc aatgatgatg atgatgatgg tgttcaagcc aaatc 55

Claims

1. A Pichia pastoris (Pichia pastoris) strain KM71 is preserved in China general microbiological culture Collection center with the preservation number of CGMCC No. 14575.

2. A bacteriostatic agent comprising the strain, fermentation broth, or anti-lipopolysaccharide polypeptide of claim 1; the anti-lipopolysaccharide polypeptide has an amino acid sequence shown as SEQ ID NO. 1.

3. A feed additive comprising the strain, fermentation broth, or product thereof of claim 1, an anti-lipopolysaccharide polypeptide; the anti-lipopolysaccharide polypeptide has an amino acid sequence shown as SEQ ID NO. 1.

4. A feed composition comprising the strain of claim 1, a fermentation broth or a product thereof, an anti-lipopolysaccharide polypeptide, and a physiologically acceptable excipient or diluent; the anti-lipopolysaccharide polypeptide has an amino acid sequence shown as SEQ ID NO. 1.

5. The feed composition of claim 4The feed composition is characterized by comprising 15-25 parts by volume of fermentation liquor of the strain as claimed in claim 1, 100 parts by weight of prawn feed and 5-15 parts by weight of sodium alginate; the final concentration of the strain in the feed composition is 3-6 multiplied by 10⁷CFU/g; the ratio of the parts by weight to the parts by volume is g/ml.

6. The following application of a1-a3 in bacteriostasis, wherein the a1-a3 is as follows:

a1, the strain of claim 1;

a2, the bacteriostatic agent of claim 2; and/or

a3, a feed additive of claim 3.

7. Use according to claim 6, wherein said inhibiting comprises inhibiting gram-positive and/or gram-negative bacteria;

8. the use of claim 7, wherein said gram-positive bacteria comprise staphylococcus aureus; the gram-negative bacteria comprise escherichia coli, vibrio anguillarum, vibrio parahaemolyticus or edwardsiella.

9. The use according to claim 7 or 8, which comprises preparing a preparation or feed for inhibiting the infection of the prawn with vibrio parahaemolyticus.

10. Use according to any one of claims 7 to 9, comprising the preparation of a preparation or feed for enhancing the immunity, body length or body weight of prawns; preferably, the method comprises the application of preparing a preparation or feed for improving the immunity or survival rate of the cynoglossus semilaevis; more preferably, the preparation method comprises the application of preparing a preparation or feed for improving the resistance of the cynoglossus semilaevis to the ascites disease.