CN102337271A - Portunus trituberculatus anti-lipopolysaccharide factor PtALF-2 gene and encoding proteins and application thereof - Google Patents
Portunus trituberculatus anti-lipopolysaccharide factor PtALF-2 gene and encoding proteins and application thereof Download PDFInfo
- Publication number
- CN102337271A CN102337271A CN2011102904577A CN201110290457A CN102337271A CN 102337271 A CN102337271 A CN 102337271A CN 2011102904577 A CN2011102904577 A CN 2011102904577A CN 201110290457 A CN201110290457 A CN 201110290457A CN 102337271 A CN102337271 A CN 102337271A
- Authority
- CN
- China
- Prior art keywords
- ptalf
- portunus trituberculatus
- gene
- coagulogen
- trituberculatus miers
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
Abstract
The invention belongs to the technical field of molecular biology, in particular relates to a Portunus trituberculatus anti-lipopolysaccharide factor PtALF-2 gene and encoding proteins and application thereof. In the invention, a PtALF-2 gene cDNA is amplified from a Portunus trituberculatus by utilizing a cDNA (Complementary Deoxyribonucleic Acid) library and an RACE (Rapid-amplification of cDNA Ends) technology and plays an important role in immune defense of the Portunus trituberculatus. A recombinant PtALF-2 protein has obvious antibacterial activity to Gram-negative Vibrio alginolyticus, P. Aeruginosa, Edwardsiella tarda, Gram-positive Staphylococcus aureus and Micrococcus luteus, and the minimal inhibitory concentrations are respectively 1.02 mu M, 2.04 mu M, 4.07 mu M, 16.30 mu M and 65.19 mu M; but the recombinant PtALF-2 protein has no obvious inhibitory action to fungus Pichia pastoris. The invention lays a foundation for disease prevention and control, gene-assisted selection and development of feed additives of the Portunus trituberculatus.
Description
Technical field
The invention belongs to technical field of molecular biology, a kind of specifically Portunus trituberculatus Miers coagulogen PtALF-2 gene and proteins encoded and application.
Background technology
Advantages such as Portunus trituberculatus Miers (Portunus trituberculatus) is a kind of important marine products economic crab, and is abundant owing to its nutritive value, that growth is rapid have become the important sea farming kind of China.But along with continuous expansion of breed scale and intensification degree improve constantly; The multiple disease that is caused by bacterium, fungi etc. breaks out in the Portunus trituberculatus Miers cultured population again and again; Cause enormous economic loss, seriously restricted the healthy Sustainable development of Portunus trituberculatus Miers aquaculture industry.
Because the immunity system shortage to Portunus trituberculatus Miers is understood in depth; Traditional antibiotic medicine control is still mainly adopted in the sick control of crab at present, but long-term blindly Drug abuse causes the resistance problem serious day by day; Not only be difficult to disease controlling effectively; Bring the waste of fund on the contrary, the decline of crab quality, environmental pollution reach adverse consequencess such as human health formation potential threats.Therefore, this just presses for from the start with antibacterials of research its disease-resistant mechanism and development of new of the immune defense factor of Portunus trituberculatus Miers self and carries out immune protection.
Coagulogen (ALF) is a kind of small molecules antibacterial peptide that can combine LPS (LPS) and its toxic action that neutralizes; Because of its mechanism of action different with traditional microbiotic; Bacterium is difficult for producing resistance, to normal eukaryotic cell toxicological harmless, receives extensive concern day by day.ALF finds that from limulus polyphemus it can combine LPS, and R type Gram-negative bacteria is had obvious suppression growth effect.Crystal structure analysis shows that the cysteine residues of two high conservatives is arranged in the king crab ALF structure, and they form the βZhe Die zone that disulfide linkage limited and are LPS combination territory.The LPS of external synthetic king crab ALF combines the territory, proves that it can combine with LPS really, can help to protect mouse to avoid endotoxic attack in the secretion of external adjusting cytokine.Subsequently, from crustaceans such as prawn, crayfish, crab, also identify or clone multiple coagulogen.Research shows that the expression level of these crustacean ALF stimulates the back obviously to raise on bacterium, and its recombinant protein can suppress the growth of Gram-negative bacteria and gram-positive microorganism, and prompting ALF plays a significant role in the crustacean inherent immunity.
Up to the present, less about the report of Portunus trituberculatus Miers coagulogen.Therefore, identification, qualitative antimicrobial effect molecule-coagulogen are to the immune defence mechanism of research Portunus trituberculatus Miers and carry out disease control and have important theory and practice significance.
Summary of the invention
The purpose of this invention is to provide a kind of Portunus trituberculatus Miers coagulogen PtALF-2 gene and proteins encoded and application.
For realizing above-mentioned purpose, the technical scheme that the present invention adopts is:
A kind of Portunus trituberculatus Miers coagulogen PtALF-2 gene: Portunus trituberculatus Miers coagulogen PtALF-2 gene is shown in the base sequence among the sequence table SEQ ID No.1.
Portunus trituberculatus Miers coagulogen PtALF-2 gene coded protein: said PtALF-2 gene coded protein is among the sequence table SEQ ID No.2 shown in the aminoacid sequence.
The application of Portunus trituberculatus Miers coagulogen PtALF-2 gene coded protein: the recombination expression product of said Portunus trituberculatus Miers coagulogen PtALF-2 gene can be prepared as antibacterials, immunostimulant, fodder additives, sanitas or preservation agent.
The recombination expression product of said Portunus trituberculatus Miers coagulogen PtALF-2 gene can be used as the antibacterial medicines of Gram-negative bacteria, gram-positive microorganism.Said Gram-negative bacteria is vibrio alginolyticus, Pseudomonas aeruginosa, tarda, and gram-positive microorganism is streptococcus aureus, micrococcus luteus.
The advantage that the present invention had:
The present invention utilizes expressed sequence tagging method (EST), RACE technology from Portunus trituberculatus Miers, to be cloned into PtALF-2 gene cDNA full length sequence; Be cloned in pET32a (+) expression vector through the gene fragment of round pcr amplification coding PtALF-2 mature peptide and with it, realize in-vitro recombination expression at e. coli bl21 (DE3)-plysS.Recombinant protein is after TALON column purification and dialysis renaturation; Gram-negative bacteria vibrio alginolyticus, Pseudomonas aeruginosa, Edwardsiella tarda, gram-positive microorganism streptococcus aureus and micrococcus luteus are had significant bacteriostatic activity, and minimal inhibitory concentration is respectively 1.02 μ M, 2.04 μ M, 4.07 μ M, 16.30 μ M, 65.19 μ M; And the fungi pichia spp is not had the obvious suppression effect.
The application in drug manufacture, immunostimulant, fodder additives and sanitas and preservation agent production of gene of the present invention and recombinant protein thereof; Can also further study the Portunus trituberculatus Miers immune defence mechanism in addition the basis is provided, and be disease control, gene assist-breeding and the fodder additives of Portunus trituberculatus Miers.
Description of drawings
Gene amplification product (wherein, M:DNA marker, 1: the gene amplification product of mature peptide) of the Portunus trituberculatus Miers coagulogen PtALF-2 encoding mature peptide of the purifying that Fig. 1 provides for instance of the present invention.
Fig. 2 is the Portunus trituberculatus Miers coagulogen PtALF-2 recombinant protein of inducing of providing of instance of the present invention and purifying (M wherein: albumen marker; 1: do not induce expressed proteins in the thalline; 2:IPTG induces the back expressed proteins; 3: purified recombinant albumen).
Embodiment
Among the following embodiment the present invention is done further elaboration, but the invention is not restricted to this.
The cDNA sequence clone of Portunus trituberculatus Miers coagulogen PtALF-2 among the present invention comprises the following steps:
A) purifying of the extraction of the total RNA of Portunus trituberculatus Miers and mRNA;
B) Portunus trituberculatus Miers cDNA library construction;
C) the extensive mensuration of Portunus trituberculatus Miers cDNA library est sequence;
D) screening of the homology analysis of Portunus trituberculatus Miers est sequence and PtALF-2 gene fragment;
E) the RACE amplification obtains the complete sequence of PtALF-2 and the checking of complete sequence.
Portunus trituberculatus Miers coagulogen PtALF-2 gene is the base sequence shown in the SEQ ID No.1.
Sequence table SEQ ID No.1 is:
ggggagtcac?tatccgaggt?accccaaaga?gggacatcaa?aagcattgaa
gactacgcaa?ctaaacttcg?ctcaag?atg?cgg?aaa?ggg?gtg?gtg
acc?ggc?ctg?ttc?gtg?gcg?ctg?gtg?gtg?atg?tgt?ctg?tac?ttg
ccc?cag?ccc?tgc?gag?gct?cag?tat?gaa?gct?ctg?acg?gct?gct
att?ttg?aca?aag?ctg?tca?aaa?atg?tgg?cac?agt?gac?act?ctg
aat?ttc?ttg?ggc?cac?acc?tgc?cac?gtc?agc?cgt?act?ccg?acg
gtc?aag?cgc?ttt?aag?ctg?tac?tgg?aag?ggc?aag?ttt?tgg?tgt
cct?ggt?tgg?gcg?cct?ttc?agt?ggc?act?tcg?agg?acc?aag?agc
agg?tca?gga?tca?gcc?aga?gag?gcc?acc?aag?agt?ttt?gtg?gac
caa?gct?tta?cag?cgc?aga?ctt?atc?acg?cag?caa?gaa?gcg?gac
ctc?tgg?ctg?aag?ggg?taa?tgggtgctca?cgccgatgca?tggggaggag
gccgagtggg?aggagagtga?agataaagaa?gaaatgactt?gtgtctgatc
taaaacgagt?ttttaaaatt?tttttatttc?cagttataca?accacaacaa
caactgctag?tactgcatta?ttactgattg?taagaagtat?tttgaactaa
aagtaatttc?agataatggc?tgttaatatt?aaggaaatac?atgtaattgt
attggaaagt?atcctaactg?aagcattttc?tattttccta?tccttttctt
tcctctcttt?catgtctgcc?tataacattc?cggattaatg?aacgaaaaaa
tgatagaaag?aaaagtaaaa?tacaactgaa?taaatgtcaa?aggaagcaat
cttgaaattt?agttcaaacg?taaaaaaacg?aaaaatctta?ttttcattat
ttagaataaa?ccaaatatac?aagactcatg?cttgcgttat?tatgaaagtc
tgaagaaaaa?cccgagatga?aaatgaatgc?acgagtctta?attgtgcatg
aaatgttgga?aggaatggat?tgaacgctga?ttgagatctg?aaatattcat
atgactttca?gttgcgaaaa?aaaaaaaaaa?aaaaaaaaaa?aaaaaaaaaa
(a) sequence signature
● length: 1078bp (useful length 77-448)
● type: base sequence
● chain: strand
● topological framework: linearity
(b) molecule type: double-stranded DNA
(c) suppose: not
(d) antisense: not
(e) initial source: Portunus trituberculatus Miers (Portunus trituberculatus)
(f) specificity title: CDS
The structure concrete operations are following:
1. the purifying of the extraction of the total RNA of Portunus trituberculatus Miers and mRNA: utilize the Trizol reagent of Invitrogen company to extract the total RNA of Portunus trituberculatus Miers, utilize the Oligitex mRNA purification kit purified mRNA of QIAGENE company.
2. Portunus trituberculatus Miers cDNA library construction: the Creator Smart cDNA Library Construction Kit test kit operation instruction construction cDNA library that utilizes Clontech company.With the mRNA behind the purifying is template, SMART IV Oligonucleotide (5 ' AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG 3 ') and CDS III/3 ' PCR Primer (5 ' ATTCTAGAGGCCGAGGCGGCCGACATG-d (T) 30N_
1N 3 ') is primer, under ThermoScript II (MMLV reverse transcriptase) effect, transcribes synthetic cDNA first chain.With 5 ' PCRPrimer (5 ' AAGCAGTGGTATCAACGCAGAGT 3 ') and CDSIII/3 ' PCR Primer (5 ' ATTCTAGAGGCCGAGGCGGCCGACATG-d (T) 30N_
1N 3 ') be that primer is through synthetic cDNA second chain of long distance (LD-PCR).Double-stranded cDNA (ds cDNA) digests 20min through Proteinase K (0.8mg/ml) under 45 ℃ of conditions; Carrying out enzyme with the SfiI enzyme then cuts; Enzyme is cut product through 1.5% agarose gel electrophoresis, utilizes the QIAEX II Agarose Gel Extraction Kit of QIAGEN company to reclaim the fragment of 1-3kb.The fragment that reclaims is connected the back purifying with carrier pDNR-LIB, transforms through electricity and import competent escherichia coli cell, 220rpm/min cultivates 1h under 37 ℃ of conditions, adds the glycerine of final volume 20%, is the original library of full-length cDNA.
3. the extensive mensuration of Portunus trituberculatus Miers cDNA library est sequence: screening positive clone in the library; Use carrier universal primer M13F (5 ' TGTAAAACGACGGCCAGT 3 ') on the ABI3730xl sequenator, to carry out sequencing; The parent mass peak map file that obtains (* .ab1, * .abd file) data are converted into sequential file (* .seq) and quality document (* .seq.qual) through the Phred routine processes, and the numerical value that provides according to quality document confirms to obtain the word error probability of sequence; Remove low-quality base; With the carrier sequence in the cross-match program mask data, from the data that obtain, choose continuous base quality greater than Q13 (accuracy rate is greater than 95%) and length greater than the sequence of 100bp as the EST data, concrete " expressed sequence (EST) data analysis handbook (Hu Songnian work; Press of Zhejiang University, 2005).
4. the screening of the homology analysis of Portunus trituberculatus Miers est sequence and PtALF-2 gene fragment: whole effectively EST data that will obtain are carried out the cluster splicing; Generate Contigs and Singletons; Respectively Contigs that is obtained and Singletons are carried out BLASTn and BLASTx analysis in DB; The result is presented at the sequence of having found in the est sequence with Scylla paramamosain coagulogen similarity higher (69%), has confirmed the est sequence of Portunus trituberculatus Miers coagulogen PtALF-2 gene according to the similarity analysis result.
5. the clone of Portunus trituberculatus Miers PtALF-2 gene cDNA full length sequence: according to the est sequence design special primer F1 (5 ' CCAGTTATACAACCACAACA 3 ') and R1 (5 ' TTCAGTTAGGATACTTTCCA 3 ') of PtALF-2 dna homolog, utilize carrier universal primer M13F (5 ' TGTAAAACGACGGCCAGT 3 ') and M13R (5 ' CAGGAAACAGCTATGACC 3 ') to carry out 3 ' and the amplification of 5 ' end respectively.The PCR product detects with 1.5% agarose gel electrophoresis; Reclaim test kit with Axygen glue and carry out recovery of PCR product and purifying; Be connected with pMD-18T carrier (the precious biotechnology in Dalian ltd) again; Transformed into escherichia coli competence Trans1-T1 (Beijing Quanshijin Biotechnology Co., Ltd) then; Select positive colony and check order with carrier primer M13-47 and RV-M, the gained result is spliced through Phred/Phrap software, obtains Portunus trituberculatus Miers PtALF-2 full length gene cDNA sequence and sees SEQ ID No.1.
6. the checking of Portunus trituberculatus Miers PtALF-2 gene cDNA total length: design a pair of primers F 2 (5 ' GCATTGAAGACTACGCAACTAAAC 3 ') and R2 (5 ' ATCAGCGTTCAATCCATTCCTTCC 3 ') on the PtALF-2 full length sequence of order-checking splicing are the checking that template is carried out total length with cDNA.Order-checking and analysis are with 5.
3 ' RACE amplification reaction system and reaction conditions:
25 μ l reaction systems:
Be reflected among the TaKaRa PCR Thermal Cycler Dice Model TP600 (Takara Bio Inc.) and carry out, reaction conditions is: 94 ℃ of sex change 3min; 94 ℃ of sex change 30s, 58.5 ℃ of annealing 50s, 72 ℃ are extended 1min, 34 circulations; 72 ℃ are extended 10min.
5 ' RACE amplification reaction system and reaction conditions:
25 μ l reaction systems:
Be reflected among the TaKaRa PCR Thermal Cycler Dice Model TP600 (Takara Bio Inc.) and carry out, reaction conditions is: 94 ℃ of sex change 3min; 94 ℃ of sex change 30s, 57 ℃ of annealing 50s, 72 ℃ are extended 1min, 34 circulations; 72 ℃ are extended 10min.
The PCR reaction system and the reaction conditions of total length checking are:
25 μ l reaction systems:
Be reflected among the TaKaRa PCR Thermal Cycler Dice Model TP600 (Takara Bio Inc.) and carry out, reaction conditions is: 94 ℃ of sex change 3min; 94 ℃ of sex change 30s, 55 ℃ of annealing 50s, 72 ℃ are extended 1min, 34 circulations; 72 ℃ are extended 10min.
Sequence table SEQ ID No.1 is cloned into PtALF-2 gene cDNA total length 1078bp from Portunus trituberculatus Miers, ORFs 372bp wherein, and 5 ' non-translational region 76bp, 3 ' non-translational region 618bp has the polyadenylic acid tail.
The said base sequence of Portunus trituberculatus Miers coagulogen PtALF-2 sequence table SEQ ID No.1, described aminoacid sequence such as sequence table SEQ ID No.2 are said.
Sequence table SEQ ID No.2 is:
Met?Arg?Lys?Gly?Val?Val?Thr?Gly?Leu?Phe?Val?Ala?Leu?Val?Val?Met
Cys?Leu?Tyr?Leu?Pro?Gln?Pro?Cys?Glu?Ala?Gln?Tyr?Glu?Ala?Leu?Thr
Ala?Ala?Ile?Leu?Thr?Lys?Leu?Ser?Lys?Met?Trp?His?Ser?Asp?Thr?Leu
Asn?Phe?Leu?Gly?His?Thr?Cys?His?Val?Ser?Arg?Thr?Pro?Thr?Val?Lys
Arg?Phe?Lys?Leu?Tyr?Trp?Lys?Gly?Lys?Phe?Trp?Cys?Pro?Gly?Trp?Ala
Pro?Phe?Ser?Gly?Thr?Ser?Arg?Thr?Lys?Ser?Arg?Ser?Gly?Ser?Ala?Arg
Glu?Ala?Thr?Lys?Ser?Phe?Val?Asp?Gln?Ala?Leu?Gln?Arg?Arg?Leu?Ile
Thr?Gln?Gln?Glu?Ala?Asp?Leu?Trp?Leu?Lys?Gly
It has complete proteins encoded and contains 123 amino acid, and wherein the 1-26 of an encoding sequence amino acid is a signal peptide, and mature peptide comprises 97 amino acid, and the molecular weight of prediction is 11.15kDa, and iso-electric point is 10.24.Mature peptide has typical coagulogen mode configuration: two conserved cysteine residue and conservative unit W (T) CPGWT (A), two conserved cysteine residue form disulfide linkage, constitute a typical beta hairpin structure.
The acquisition of Portunus trituberculatus Miers coagulogen PtALF-2 recombinant protein, concrete operations are following:
The cDNA sequence corresponding according to SEQ ID No.2; Design contains the Auele Specific Primer F3 (5 ' GGATCCCAGTATGAAGCTCTGACGG 3 ') and the R3 (5 ' CTCGAGTTACCCCTTCAGCCAGAGGTCC 3 ') of restriction enzyme BamHI and XhoI restriction enzyme site; Gene fragment (referring to Fig. 1) through round pcr amplification coding PtALF-2 mature peptide; Be reflected among the TaKaRa PCR Thermal Cycler Dice Model TP600 (Takara Bio Inc.) and carry out, reaction conditions is: 94 ℃ of sex change 3min; 94 ℃ of sex change 30s, 58 ℃ of annealing 50s, 72 ℃ are extended 30s, 34 circulations; Last 72 ℃ are extended 10min.Cut through enzyme then it is cloned in pET32a (+) expression vector, be transformed into e. coli bl21 (DE3)-plysS, after order-checking confirmed that expression cassette is correct, the inoculation positive colony was in the LB substratum, and 37 ℃ of shaking culture are to O.D.
600=0.4-0.6, adding IPTG is that 1mM induces centrifugal collection thalline after 4 hours to final concentration.Thalline is handled 30-60min (each 2s, 2s at interval), the centrifugal supernatant that removes, collecting precipitation (containing the recombinant protein inclusion body) with UW 180W under condition of ice bath.After the urea dissolving of deposition with 8M, utilize the TALON column purification recombinant products of Clontech company.Purified recombinant albumen is transferred in the dialysis tubing; Under 4 ℃ of conditions; Dialysis in containing dialysis renaturation solution (pH=8.0) 2mM reduction Triptide, 0.2mM oxidation Triptide, 1mM EDTA, 50mM Tris-HCl, 50mM NaCl, 10% glycerine and 1% glycocoll and the urea (6M, 5M, 4M, 3M, 2M, 1M, 0M) that gradient reduces; Make the recombinant protein renaturation, dialyse 2 times at the damping fluid of 50mM Tris-HCl (pH=8.0) at last, to remove other composition in the solution.The recombinant protein of dialysis after the renaturation concentrates through the centrifugal evaporating pipe of the Microsep of PALL company Advance ultrafiltration, and the concentration of using the BCA determination of protein concentration test kit of green skies company to record Portunus trituberculatus Miers coagulogen PtALF-2 recombinant protein is 3.76mg/ml (referring to Fig. 2).
The extracorporeal bacteria inhibitor test of Portunus trituberculatus Miers coagulogen PtALF-2 recombinant protein:
1. cultivation of mikrobe and preparation: vibrio alginolyticus is with 28 ℃ of TSB substratum; Pseudomonas aeruginosa is with 37 ℃ of TSB substratum; Edwardsiella tarda is with 28 ℃ of LB substratum, and streptococcus aureus is with 37 ℃ of LB substratum, and micrococcus luteus is with 37 ℃ of LB substratum; Pichia spp is with 28 ℃ of YPD substratum; When above-mentioned each bacterial strain makes bacteria concentration reach logarithmic phase with shaking table 220rpm/min cultivation, use 50mM Tris-HCl (pH=8.0) damping fluid dilution thalline respectively, make its every milliliter colony count in the bacterium liquid be about 1 * 10 respectively
3
2. recombinant protein PtALF-2 bacteriostatic activity is measured: utilize the foregoing description gained recombinant protein PtALF-2 with Tris-HCl (50mM; PH=8.0) behind the gradient dilution (1,1/2,1/4,1/8,1/16,1/32,1/64,1/128,1/256), get 50 μ l be added to aseptic flat 96 orifice plates (Costar, Fisher) in; 50 μ l Tris-HCl (50mM; PH=8.0) be made as contrast, add the good bacteria suspension of 50 μ l dilution then, and mixing.The hole that only adds 50 μ l bacterium liquid is a blank well.96 orifice plates add corresponding substratum 150 μ l after hatching 3 hours under the culture temperature of bacterium liquid, blank well adds substratum 200 μ l, incubated overnight.96 orifice plates of solubilization algae vibrios, Pseudomonas aeruginosa, Edwardsiella tarda, pichia spp are reading under the visible light of 560nm at wavelength, and 96 orifice plates that add streptococcus aureus and micrococcus luteus are reading under the visible light of 600nm at wavelength.Find that the foregoing description recombinant protein PtALF-2 has the obvious suppression effect to Gram-negative bacteria vibrio alginolyticus, Pseudomonas aeruginosa and Edwardsiella tarda, gram-positive microorganism streptococcus aureus and micrococcus luteus, minimal inhibitory concentration is respectively 1.02 μ M, 2.04 μ M, 4.07 μ M, 16.30 μ M, 65.19 μ M; And the fungi pichia spp is not had the obvious suppression effect.
The foregoing description is a preferred implementation of the present invention; But embodiment of the present invention is not restricted to the described embodiments; Other any do not deviate from change, the modification done under spirit of the present invention and the principle, substitutes, combination, simplify; All should be the substitute mode of equivalence, be included within protection scope of the present invention.
Sequence table
Claims (5)
1. Portunus trituberculatus Miers coagulogen PtALF-2 gene, it is characterized in that: Portunus trituberculatus Miers coagulogen PtALF-2 gene is shown in the base sequence among the sequence table SEQ ID No.1.
2. the described Portunus trituberculatus Miers coagulogen of claim 1 PtALF-2 gene coded protein is characterized in that: said PtALF-2 gene coded protein is among the sequence table SEQ IDNo.2 shown in the aminoacid sequence.
3. application by the described Portunus trituberculatus Miers coagulogen of claim 2 PtALF-2 gene coded protein, it is characterized in that: the recombination expression product of said Portunus trituberculatus Miers coagulogen PtALF-2 gene can be prepared as antibacterials, immunostimulant, fodder additives, sanitas or preservation agent.
4. by the application of the described Portunus trituberculatus Miers coagulogen of claim 3 PtALF-2 gene coded protein, it is characterized in that: the recombination expression product of said Portunus trituberculatus Miers coagulogen PtALF-2 gene can be used as the antibacterial medicines of Gram-negative bacteria, gram-positive microorganism.
5. press the application of the described Portunus trituberculatus Miers coagulogen of claim 4 PtALF-2 gene coded protein; It is characterized in that: said Gram-negative bacteria is vibrio alginolyticus, Pseudomonas aeruginosa, Edwardsiella tarda, and gram-positive microorganism is streptococcus aureus, micrococcus luteus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011102904577A CN102337271A (en) | 2011-09-23 | 2011-09-23 | Portunus trituberculatus anti-lipopolysaccharide factor PtALF-2 gene and encoding proteins and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011102904577A CN102337271A (en) | 2011-09-23 | 2011-09-23 | Portunus trituberculatus anti-lipopolysaccharide factor PtALF-2 gene and encoding proteins and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102337271A true CN102337271A (en) | 2012-02-01 |
Family
ID=45513223
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2011102904577A Pending CN102337271A (en) | 2011-09-23 | 2011-09-23 | Portunus trituberculatus anti-lipopolysaccharide factor PtALF-2 gene and encoding proteins and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102337271A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103724412A (en) * | 2013-09-29 | 2014-04-16 | 中国科学院海洋研究所 | Fenneropenaeus chinensiss anti-lipopolysaccharide factor as well as preparation and application thereof |
| CN110747136A (en) * | 2019-11-25 | 2020-02-04 | 天津师范大学 | Pichia pastoris strain KM71 and application |
| CN112877334A (en) * | 2021-02-04 | 2021-06-01 | 中国科学院海洋研究所 | Portunus trituberculatus fibrinogen related protein PtFREP gene and encoding protein and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101245344A (en) * | 2007-02-17 | 2008-08-20 | 中国科学院海洋研究所 | Eriocheir sinensis lipotropism polyoses factor gene and encoding protein and application |
| CN101914149A (en) * | 2010-01-16 | 2010-12-15 | 中国科学院海洋研究所 | Preparation and application of anti-lipid polysaccharide factor with bacteriostatic activity |
-
2011
- 2011-09-23 CN CN2011102904577A patent/CN102337271A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101245344A (en) * | 2007-02-17 | 2008-08-20 | 中国科学院海洋研究所 | Eriocheir sinensis lipotropism polyoses factor gene and encoding protein and application |
| CN101914149A (en) * | 2010-01-16 | 2010-12-15 | 中国科学院海洋研究所 | Preparation and application of anti-lipid polysaccharide factor with bacteriostatic activity |
Non-Patent Citations (2)
| Title |
|---|
| YUAN LIU等: "Multiple isoforms of immune-related genes from hemocytes and eyestalk cDNA libraries of swimming crab Portunus trituberculatus", 《FISH & SHELLFISH IMMUNOLOGY》, vol. 31, 27 February 2011 (2011-02-27), pages 29 - 42 * |
| 刘媛: "三疣梭子蟹(Portunus trituberculatus)cDNA文库构建、EST分析及抗脂多糖因子研究", 《中国博士学位论文全文数据库 农业科技》, no. 20118, 15 August 2011 (2011-08-15), pages 052 - 6 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103724412A (en) * | 2013-09-29 | 2014-04-16 | 中国科学院海洋研究所 | Fenneropenaeus chinensiss anti-lipopolysaccharide factor as well as preparation and application thereof |
| CN110747136A (en) * | 2019-11-25 | 2020-02-04 | 天津师范大学 | Pichia pastoris strain KM71 and application |
| CN112877334A (en) * | 2021-02-04 | 2021-06-01 | 中国科学院海洋研究所 | Portunus trituberculatus fibrinogen related protein PtFREP gene and encoding protein and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Gao et al. | The stress hormone norepinephrine increases the growth and virulence of Aeromonas hydrophila | |
| CN110643612B (en) | Trachinotus ovatus antimicrobial peptide NK-lysin gene and application thereof | |
| He et al. | A goose-type lysozyme gene in Japanese scallop (Mizuhopecten yessoensis): cDNA cloning, mRNA expression and promoter sequence analysis | |
| CN110551732A (en) | Trachinotus ovatus antimicrobial peptide LEAP-2 gene and application thereof | |
| CN107937406B (en) | Novel Crustin gene of portunus trituberculatus and application of recombinant protein thereof | |
| Vaseeharan et al. | Molecular cloning, sequence analysis and expression of Fein-Penaeidin from the haemocytes of Indian white shrimp Fenneropenaeus indicus | |
| CN103160525A (en) | Mytilus edulis G-type lysozyme gene and recombinant protein and application thereof | |
| Tang et al. | Identification and expression analysis on bactericidal permeability-increasing protein/lipopolysaccharide-binding protein of blunt snout bream, Megalobrama amblycephala | |
| CN102337271A (en) | Portunus trituberculatus anti-lipopolysaccharide factor PtALF-2 gene and encoding proteins and application thereof | |
| Wei et al. | Molecular cloning, expression analyses and functional characterization of a goose-type lysozyme gene from Bostrychus sinensis (family: Eleotridae) | |
| CN102337273A (en) | Portunus trituberculatus anti-lipopolysaccharide factor PtALF-5 gene and encoding proteins and application thereof | |
| CN102417539A (en) | Antibacterial protein and its coding gene, expression system, refolding system and application | |
| CN101525617B (en) | Eriocheir sinensis Crustin-1 gene and in-vitro recombination expression | |
| CN102586261A (en) | Portunus trituberculatus PtCrustin-2 gene, and coded protein and application thereof | |
| Li et al. | Two isoforms of piscidin from Malabar grouper, Epinephelus malabaricus: Expression and functional characterization | |
| CN102337272A (en) | Portunus trituberculatus anti-lipopolysaccharide factor PtALF-3 gene and encoding proteins and application thereof | |
| CN101942473B (en) | Procambrus clarkii type i lysozyme gene, lysozyme coded by lysozyme gene and application of lysozyme | |
| CN102586260A (en) | PtCrustin-1 gene of Portunus trituberculatus, encoding protein of PtCrustin-1 gene and application of PtCrustin-1 gene | |
| CN102329802A (en) | Portunus trituberculatus antilipopolysaccharide factor PtALF-4 gene and coding protein and applications thereof | |
| CN102329801A (en) | Portunus trituberculatus anti-lipopolysaccharide factor PtALF-1 gene, protein encoded by gene and application of protein | |
| CN104117059B (en) | The application of Portunus trituberculatus Miers serine protease gene | |
| CN101245344B (en) | Eriocheir sinensis lipotropism polyoses factor gene and encoding protein and application | |
| CN101565703B (en) | Eriocheir sinensis Crustin-2 gene and application of recombinant protein thereof | |
| CN102020709A (en) | Mytilus coruscus antibacterial peptide and preparation method and application thereof | |
| CN102051363A (en) | Clam ferroprotein gene as well as coding protein and application of in vitro recombinant expression product of same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20120201 |