CN105255749A - Engineered strain of saccharomyces cerevisiae capable of efficiently expressing macrobrachium rosenbergii pattern recognition protein LGBP - Google Patents
Engineered strain of saccharomyces cerevisiae capable of efficiently expressing macrobrachium rosenbergii pattern recognition protein LGBP Download PDFInfo
- Publication number
- CN105255749A CN105255749A CN201510790967.9A CN201510790967A CN105255749A CN 105255749 A CN105255749 A CN 105255749A CN 201510790967 A CN201510790967 A CN 201510790967A CN 105255749 A CN105255749 A CN 105255749A
- Authority
- CN
- China
- Prior art keywords
- lgbp
- saccharomyces cerevisiae
- pattern recognition
- phac181
- macrobrachium rosenbergii
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an engineered strain of saccharomyces cerevisiae capable of efficiently expressing macrobrachium rosenbergii pattern recognition protein LGBP, and belongs to the technical field of biology. cDNA of the macrobrachium rosenbergii pattern recognition protein LGBP is cloned to a vector plasmid pHAC181, sequencing verification is conducted on positive transformants which are successfully cloned, target genes are integrated onto a GAL1 promoter in the saccharomyces cerevisiae strain by means of a homologous recombination method, and target protein MrLGBP is efficiently expressed under induction of galactose.
Description
Technical field
The present invention relates to the saccharomyces cerevisiae engineered yeast of a kind of high expression Macrobrachium rosenbergii pattern recognition protein LGBP, belong to biological technical field.
Background technology
Culture fishery is one of important industry of China's economy foreign exchange earning, and fishery has become the growth point of rural economy in China.Crustacean disease is on the rise in recent years, brings huge financial loss to China's culture fishery.
Crustacean lacks acquired specific immune function, but they have fairly perfect congenital non-specific immune systems, can identify rapidly and effectively remove the microorganism of invasion.The nonspecific immunity mechanism of Crustacean comprises the barrier action of crust and mucus, the phagolysis of reticuloendothelial system and non-specific body fluid molecule.(1) pattern recognition protein (Patternrecognitionproteins, PRPs), comprise LGBP (lipopolysaccharideand β-1, 3-glucan-bindingprotein, LGBP) with coagulogen (Anti-Lipopolysaccharidefactor, ALF) etc., they can with the lipopolysaccharides β-1 of exotic disease original surface, 3-dextran combines with peptidoglycan etc. and waits the molecular pattern (pathogen-associatedmolecularpatterns identifying that pathogenic agent is relevant, PAMPs), then activating pro-phenoloxidase (pro-phenoloxidase, proPO) system, (2) phenol oxidase activation system.Be discharged in blood plasma after crustacean phenol oxidase proenzyme synthesizes in hemocyte.Phenol oxidase proenzyme becomes activated phenol oxidase by the hydrolysis of phenol oxidase activation of zymogen enzyme, catalysis list phenolic compound is oxidized to adjacent diphenol product (o-diphenols), be reoxidised into adjacent diquinone (o-quinones), adjacent diquinone suppresses the activity of pathogenic agent extracellular protease and chitinase, thus suppresses even to kill pathogenic agent.
At present, yet there are no the albumen eukaryotic expression of Macrobrachium rosenbergii LGBP gene and the report of protein function research.As everyone knows, the heterogenous expression of gene is subject to the impact of the many factors such as host, carrier, starting element.Therefore, how the heterogenous expression of implementation pattern identification albumen LGBP, activity expression, high expression are the problems needing solution at present badly.
Summary of the invention
In order to solve the problem, the present invention utilizes yeast saccharomyces cerevisiae to achieve Macrobrachium rosenbergii (Macrobrachiumrosenbergii) pattern recognition protein LGBP (lipopolysaccharideand β-1, heterogenous expression 3-glucan-bindingprotein), activity expression, high expression, waved vital role to strengthening Crustacean to various principal disease and the resistibility of environmental change, effectively its healthy hair tonic of promotion.
First object of the present invention is to provide the saccharomyces cerevisiae engineered yeast of a kind of high expression Macrobrachium rosenbergii pattern recognition protein LGBP, the construction process of described engineering bacteria is cloned into by the cDNA of Macrobrachium rosenbergii pattern recognition protein LGBP on expression plasmid pHAC181 to obtain the correct recombinant plasmid pHAC181-LGBP of sequence verification, then design homologous recombination primer, utilize homologous recombination technique goal gene LGBP to be integrated into the GAL1 promotor downstream of Saccharomyces cerevisiae host bacterial strain.This project bacterium, can high efficiency expressing destination protein under the induction of semi-lactosi.
In one embodiment of the invention, the cDNA of described Macrobrachium rosenbergii pattern recognition protein LGBP CDS (codingsequence) region translation after aminoacid sequence as shown in SEQIDNO.2.
In one embodiment of the invention, the nucleotide sequence in the CDS region of the cDNA of described LGBP is as shown in SEQIDNO.1.
In one embodiment of the invention, described expression plasmid pHAC181 inserts 3 histidine-taggedly to obtain in SphI and the EcoRV site of commercialization plasmid YCplac181, refer to document: AnalysesoftheeffectsofRck2pmutantsonPbs2p
dD-inducedtoxicityinSaccharomycescervisiaeidentifyaMAPkinas edockingmotif, andunexpectedfunctionalinactivationduetoacidicsubstituti onofT379, MolGenGenomics, 2004,271:208 – 219.
In one embodiment of the invention, described host strain is yeast saccharomyces cerevisiae GAL1-ScRCH1, is the promotor of the ScRCH1 gene in yeast saccharomyces cerevisiae BY4741 (Sc04153268_s1) bacterial strain is replaced to GAL1 promotor.
In one embodiment of the invention, described saccharomyces cerevisiae engineered yeast builds as follows and obtains: (1) for template PCR amplifications or directly chemosynthesis, obtains the LGBP gene fragment of nucleotide sequence as shown in SEQIDNO.1 with the cDNA of Macrobrachium rosenbergii; (2) by LGBP gene fragment clone on expression plasmid pHAC181, obtain recombinant expression plasmid pHAC181-LGBP; (3) design homologous recombination primer, plasmid pHAC181-LGBP is increased, obtains the nucleotide fragments containing LGBP gene, use the method for homologous recombination, this nucleotide fragments is integrated into GAL1 promotor downstream in Wine brewing yeast strain.
In one embodiment of the invention, described step (3), also comprises and bacterial strain after inducing culture 6h, is extracted strain protein in YPG substratum, detect for being WESTERNBLOT, the Yeast engineering bacteria of bacterial strain then for successfully constructing that target protein is expressed.
Second object of the present invention is to provide a kind of method of high expression Macrobrachium rosenbergii pattern recognition protein LGBP, and described method uses described saccharomyces cerevisiae engineered yeast for producing bacterial strain.
Described method, after being activated by saccharomyces cerevisiae engineered yeast, is inoculated in YPG substratum, under the induction of semi-lactosi, cultivates 6h; Described YPG substratum contains D-semi-lactosi 20g/L, peptone 20g/L, yeast extract 10g/L.
The present invention also claimed described saccharomyces cerevisiae engineered yeast produces the pattern recognition protein LGBP obtained, and its application in aquaculture or aquatic animal immunological feed additive.
Beneficial effect of the present invention:
(1) saccharomyces cerevisiae engineered yeast of the present invention's structure, can realize the high expression of Macrobrachium rosenbergii pattern recognition protein LGBP, activity expression; The LGBP that engineering bacterium fermentation of the present invention obtains has vigor, and after inducing culture 6h, every mL fermented liquid can obtain 0.064mg albumen.
(2) engineering bacteria of the present invention is saccharomyces cerevisiae engineered yeast, expresses the LGBP of eukaryotic source, can secrete the protein through correctly folding and processing; And yeast saccharomyces cerevisiae has and grows fast in simple culture media; Safety, can be used for the advantages such as foodstuff production;
(3) the present invention take pHAC181 as carrier, GAL1-ScRCH1 builds saccharomyces cerevisiae engineered yeast for host, achieve the high expression of Macrobrachium rosenbergii pattern recognition protein LGBP, to strengthening the resistibility of Crustacean to various principal disease and environmental change, effectively promote its healthy growth.The manufacture and exploit of current new feed protein source and fodder additives oneself become the gordian technique promoting that modern aquaculture industry develops in a healthy way, Yeast engineering bacteria of the present invention not only can further be studied the protein function of the important immunogene of Crustacean, also will provide scientific basis and novel method for development of new immunity enhancement type fodder additives.
Accompanying drawing explanation
Fig. 1: Macrobrachium rosenbergii MrLGBPcDNA amplified band (1098bp);
Fig. 2: when Macrobrachium rosenbergii MrLGBPcDNA is cloned on carrier pHAC181, and the digestion verification of positive transformant (Line1,2,3,4,5,6,7,9,10,11,12,13,14,15,17,18,20,21,22,23,24 is correct transformant);
Fig. 3: high-fidelity enzyme PrimeSTARGXL enzyme increases (5481bp) to recombinant plasmid pHAC181-MrLGBP;
Fig. 4: detect primer and detect pHAC181-MrLGBP and the bacterial strain homologous recombination (the successful band of homologous recombination is 1381bp, Line2, and 3,4,6 is correct transformant) containing GAL1 promotor;
Fig. 5: WESTERNBLOT detects Gal-pHAC181-MrLGBP protein expression, and target protein is 45KD.
Embodiment
In the present invention, first adopt gene clone technology, be specially: after Macrobrachium rosenbergii RNA is extracted, be cDNA with Reverse Transcription box by RNA reverse transcription.High fidelity PCR enzyme is utilized to be increased by goal gene fragment MrLGBP (namely MrLGBP represents the LGBP deriving from Macrobrachium rosenbergii).The gene fragment obtained that increases is connected with carrier pHAC181, proceeds in competent escherichia coli cell transT1, coats the dull and stereotyped upper 37 DEG C of incubated overnight of LA.The positive transformant that LA flat board obtains carries out digestion verification and sequence verification.Secondly, utilize homologous recombination technique that the plasmid pHAC181 with goal gene MrLGBP is integrated into GAL1 promotor downstream in Wine brewing yeast strain, the bacterial strain of successful integration after inducing culture 6h, extracts albumen, detects for WESTERNBLOT in YPG substratum.Target protein expresses the Yeast engineering bacteria of successful bacterial strain then for successfully constructing.
The composition of LA substratum: peptone 10g/L, yeast extract 5g/L, NaCl10g/L, agar 12g/L, adjusts pH to be 7.0, Amp microbiotic 100mg/ml (120 DEG C, 20min).
The composition of SD-Leu substratum: containing yeast nitrogen (without AA) 1.7g/L, ammonium sulfate 5g/L, glucose 20g/L, 10xAAmix (-ura ,-leu ,-his) 100ml, 100xUra10ml, 100xHis10ml, agar 20g/L (120 DEG C, 20min).
The composition of YPG substratum: D-semi-lactosi 20g/L, peptone 20g/L, yeast extract 10g/L (115 DEG C, 20min).
Embodiment 1: the structure (gene clone) of Saccharomyces cerevisiae gene engineering bacteria
Build high-expression plasmid pHAC181-MrLGBP, concrete grammar organizes RNA for extracting Macrobrachium rosenbergii, and RNA reverse transcription is cDNA by Reverse Transcription box.Utilize high-fidelity enzyme that goal gene fragment MrLGBP is carried out pcr amplification, MrLGBP gene fragment (CDS region, do not comprise terminator codon, 1098bp altogether), then this fragment is cloned in the multiple clone site of high-expression vector pHAC181, finally carry out DNA sequencing to correct recon, authentication sequence is not undergone mutation, and obtains restructuring high-expression plasmid pHAC181-MrLGBP.
Embodiment 2: the structure (homologous recombination) of Saccharomyces cerevisiae gene engineering bacteria
Homologous recombination primer is designed according to the restructuring high-expression plasmid pHAC181-MrLGBP built, utilize high-fidelity PrimeSTARGXL enzyme to increase to plasmid pHAC181-MrLGBP, the successful long segment that increases is integrated into GAL1 promotor downstream in Wine brewing yeast strain.
Homologous recombination primer is F1, R1, and sequence is as shown in SEQIDNO.3, SEQIDNO.4:
F1：caaatgtaataaaagtatcaacaaaaaattgttaatatacctctatactttaacgtcaaggagaaaaaacccggatctcaaa
ATGAGGACCTTATACCTATTGCTAC
R1：tatggacgaggtaataaggaaactcagaaccagaatagtggcatgagctctccaatttaacatatttgccattagtgacc
CGATGATAAGCTGTCAAACATG
The concrete steps of homologous recombination (integration) are:
1. choose the GAL1-ScRCH1 bacterial strain list bacterium colony of activation, be inoculated into 3mlYPD substratum, 30 DEG C of 220rpm overnight incubation.
2. getting 300ul overnight culture is inoculated in 4.7ml2*YPD, cultivates 4 ~ 5h (reaching OD600=0.6-1.0) for 30 DEG C;
3. divide 3 pipes by 5ml bacterium liquid, room temperature centrifugal 4000rpm, 1min, abandon supernatant, then be merged in 1 EP pipe with 1ml water is resuspended, and the centrifugal 1min of 3000rpm, abandons supernatant.
4. add the 0.1MLiAc solution of 100ul, pressure-vaccum mixes, and the centrifugal 10s of 12000rpm, abandons supernatant.
5. repeating step 4.
6. add following material successively, add rear gentleness mixing:
7. mix, incubation 30min in 30 DEG C of water-baths;
Incubation 30min (heat shock) in 9.42 DEG C of water-baths;
The centrifugal removing supernatant of 10.3000rpm, with the resuspended thalline of the sterilized water of 1ml, 3000rpm is centrifugal, and 1min abandons supernatant, and reserved 100ul bacterium liquid is layered on to be selected on dull and stereotyped (SD-LEU), cultivates 3 ~ 5 days for 30 DEG C.
The transformant grown is carried out line purifying by 11. on SD-LEU flat board.Single colony inoculation incubated overnight in YPD substratum, extract transformant genome, carry out PCR detection with detection primer, the transformant having object fragment amplification to go out is the successful bacterial strain Gal-pHAC181-MrLGBP of homologous recombination.
Detecting primer is DF, DR, and sequence is as shown in SEQIDNO.5, SEQIDNO.6:
DF:CCTGGCCCCACAAACCTTC
DR:CTGTTTCGCGCTCTCCATTT
Embodiment 3: engineering strain protein expression and WESTERNBLOT detect
Above-mentioned homologous recombination successful Gal-pHAC181-MrLGBP bacterial strain list colony inoculation incubated overnight in SD-LEU substratum 5ml, culture is transferred in 45mlYPG substratum for second day, after semi-lactosi inducing culture 6h (OD is detected as 1.2-1.5), extract strain protein.The albumen extracted is used for WESTERNBLOT and detects.
Concrete steps are:
(1) extraction of total protein in cell
1, picking list bacterium colony 30 DEG C of incubated overnight in required liquid nutrient medium are extremely saturated;
2, the bacterium liquid getting 5mL incubated overnight adds the fresh liquid nutrient medium of 45mL and shaking culture is about 6h (OD=1.2 ~ 1.5) (rotating speed is 220rmp) in 30 DEG C of shaking tables;
3, collect thalline with 8000rpm1min, remove the liquid on upper strata;
4, with the resuspended thalline of precooling distilled water, and supernatant liquor is removed after centrifugal;
5, add with thalline equivalent and the PEB of precooling (ProteinExtractionBuffer), in PEB, add 100 × PMSF;
6, isopyknic pickling glass pearl with thalline is added;
7, vibrate EP pipe 10 × 30s in shaker mixer, puts 1min on ice after each vibration;
8, the centrifugal 10min of 12000rpm, Aspirate supernatant, in preserving, discards precipitation on ice;
9, with Coomassie Brilliant Blue detectable level (OD595), by consistent for sample concentration adjustment;
10, add 5 × SB95 DEG C and boil 5min
(2) Coomassie Brilliant Blue detects protein concentration
1, the preparation of standard protein solution: weigh BSA solid 10mg and be dissolved in the water of 1mL, the solution obtaining 10mg/mL stores liquid as standard.With the standard protein solution of standard storage liquid preparation serial dilution, its concentration is respectively 1.2mg/ml, 1.0mg/ml, 0.8mg/ml, 0.6mg/ml, 0.4mg/ml, 0.2mg/ml, 0.1mg/ml.
2, the preparation of testing protein solution: testing sample is diluted to concentration between 0.1mg/ml-1.2mg/ml.(rule of thumb diluting 15 times)
3,4 μ l dye liquor+200 μ l protein solutions, mixing, leaves standstill 3min.According to " protein " program determination protein concentration of nucleic acid-protein analyser.
In this experiment, the protein concentration recorded is 16ug/ul.It is 0.064mg/ml that conversion can obtain protein concentration, and namely every mL fermented liquid obtains 0.064mg albumen.
Target protein is diluted for 8ug/ul, for subsequent experimental.
(3) SDS-PAGE
1. device assembling
Attention: (1) sheet glass, string rubber, comb, clean and dry
(2) good seal is wanted, preventing from cementing leakage
2. glue
Attention: (1) encapsulating is wanted rapidly
(2) perfusion of separation gel is about 2cm apart from short sheet glass top
(3) note whether having bubble
(4) add pellicular water at glue interface, concordant separation gel face, 15-30min polymerization is intact
3. protein sample preparation
Protein sample+SampleBuffer, boiling water bath boils 5min, cooled on ice 5min.
4, loading, must put pre-dyed Marker, electrophoresis.
Concentrated glue 80V, separation gel 100V.
(4) transfer printing (pickling process)
1, filled with water in ice chest, freezes reality
2, transfering buffering liquid is cooled to 4 DEG C
3, in shallow pallet, transfering buffering liquid is poured into
4, by the pvdf membrane equal with glue size, good with Pencil marks, in methyl alcohol, soak about 3min, transfer to transfering buffering liquid and soak balance, until there is no bubble
5, the Whatmman filter paper that 4 conform to glue size is placed in transfering buffering liquid fully soak
6, absorbent wool is fully soaked in transfering buffering liquid
7, after electrophoresis, bring gloves, it washs by glue rapidly that cut useful part in transfering buffering liquid
8, open turn trough offset plate, put into successively: soak absorbent wool-2 layer Whatmman filter paper-glue-pvdf membrane--2 layers of Whatmman filter paper-soak absorbent wool, note not having bubble.
9, carefully close the offset plate of transfer groove, puts into transfer groove immediately, notes cathode and anode directions
10, in transfer groove, add bar magnet, pour transfering buffering liquid into, make its submergence transfer blanket, transfer groove is placed on magnetic stirring apparatus, put into cooling ice chest
11, electrode insertion, notes reexamining cathode and anode directions, opens switch, electrophoretic blotting 100V1h
12, after transfer terminates, deenergization also pulls up plug on groove, and each layer of dismounting transfer, takes out pvdf membrane from top to bottom.
(5) close
Add confining liquid to close, shake 1h-4h gently with shaking table
(6) primary antibodie is added
1, confining liquid is fallen in transfer gently
2, add primary antibodie hybridization solution, room temperature 2h or 4 DEG C spends the night
(7) add two to resist
1, primary antibodie hybridization solution (reusable) is fallen in transfer gently, washes 3 times, each 10min with TBST
2, two anti-hybridization solutions are added, room temperature jog 2h
3, film is washed 3 times, each 10min with TBST
(8) react
1, get 100ul substrate solution 1 respectively with different tip heads and 100ul substrate solution 2 mixes in 1.5ml pipe, then this 200ul mixed solution is turned and drip on preservative film.By washed film, allow the washing lotion that its drip-dry is unnecessary, be covered on chromogenic substrate, reaction 5min.
2, the substrate free flow on film is sopped up with filter paper.
(9) operate under exposure imaging---half-light
1, the preservative film of film by suitable size is wrapped, press X-ray, exposure, timing;
2, by developing solution, stop bath is poured in shallow pallet respectively
3, take out X-ray, put into developing solution 5min
4, tap water rinses rapidly
5, stop bath 5min is put into immediately
6, a large amount of tap water
7, hang airing
After development, compare according to albumen MARKER, what Gal-pHAC181-MrLGBP target protein expression (45KD) detected is then the yeast saccharomyces cerevisiae MrLGBP immune protein engineering strain successfully built.
Although the present invention with preferred embodiment openly as above; but it is also not used to limit the present invention, any person skilled in the art, without departing from the spirit and scope of the present invention; all can do various changes and modification, what therefore protection scope of the present invention should define with claims is as the criterion.
Claims (9)
1. the saccharomyces cerevisiae engineered yeast of a high expression Macrobrachium rosenbergii pattern recognition protein LGBP, it is characterized in that, the construction process of described engineering bacteria is cloned into by the cDNA of Macrobrachium rosenbergii pattern recognition protein LGBP on expression plasmid pHAC181 to obtain the correct recombinant plasmid pHAC181-LGBP of sequence verification, then design homologous recombination primer, utilize homologous recombination technique goal gene LGBP to be integrated into the GAL1 promotor downstream of Saccharomyces cerevisiae host bacterial strain.
2. saccharomyces cerevisiae engineered yeast according to claim 1, is characterized in that, the aminoacid sequence after the CDS region translation of the cDNA of described Macrobrachium rosenbergii pattern recognition protein LGBP is as shown in SEQIDNO.2.
3. saccharomyces cerevisiae engineered yeast according to claim 1, is characterized in that, the nucleotide sequence in the CDS region of the cDNA of described LGBP is as shown in SEQIDNO.1.
4. saccharomyces cerevisiae engineered yeast according to claim 1, is characterized in that, described pHAC181 inserts 3 histidine-taggedly to obtain in SphI and the EcoRV site of YCplac181.
5. saccharomyces cerevisiae engineered yeast according to claim 1, it is characterized in that, described saccharomyces cerevisiae engineered yeast builds as follows and obtains: (1) for template PCR amplifications or directly chemosynthesis, obtains the LGBP gene fragment of nucleotide sequence as shown in SEQIDNO.1 with the cDNA of Macrobrachium rosenbergii; (2) by LGBP gene fragment clone on expression plasmid pHAC181, obtain recombinant expression plasmid pHAC181-LGBP; (3) design homologous recombination primer, plasmid pHAC181-LGBP is increased, obtains the nucleotide fragments containing LGBP gene, use the method for homologous recombination, this nucleotide fragments is integrated into GAL1 promotor downstream in Wine brewing yeast strain.
6. a method of high expression Macrobrachium rosenbergii pattern recognition protein LGBP, is characterized in that, described method uses right to want the arbitrary described saccharomyces cerevisiae engineered yeast of 1-5 for producing bacterial strain.
7. method according to claim 6, is characterized in that, described method, after being activated by saccharomyces cerevisiae engineered yeast, is inoculated in YPG substratum, under the induction of semi-lactosi, cultivates 6h; Described YPG substratum contains D-semi-lactosi 20g/L, peptone 20g/L, yeast extract 10g/L.
8. the arbitrary described saccharomyces cerevisiae engineered yeast of claim 1-5 produces the pattern recognition protein LGBP obtained.
9. the arbitrary described saccharomyces cerevisiae engineered yeast of claim 1-5 is in the application of aquaculture or aquatic animal immunology.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510790967.9A CN105255749A (en) | 2015-11-17 | 2015-11-17 | Engineered strain of saccharomyces cerevisiae capable of efficiently expressing macrobrachium rosenbergii pattern recognition protein LGBP |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510790967.9A CN105255749A (en) | 2015-11-17 | 2015-11-17 | Engineered strain of saccharomyces cerevisiae capable of efficiently expressing macrobrachium rosenbergii pattern recognition protein LGBP |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105255749A true CN105255749A (en) | 2016-01-20 |
Family
ID=55095681
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510790967.9A Pending CN105255749A (en) | 2015-11-17 | 2015-11-17 | Engineered strain of saccharomyces cerevisiae capable of efficiently expressing macrobrachium rosenbergii pattern recognition protein LGBP |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105255749A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114672426A (en) * | 2022-04-21 | 2022-06-28 | 江苏农林职业技术学院 | Saccharomyces cerevisiae engineering bacterium, construction method and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004025263A2 (en) * | 2002-09-16 | 2004-03-25 | Advanced Bionutrition Corporation | Protein and peptide expression for passive immunity |
| CN101914546A (en) * | 2010-07-23 | 2010-12-15 | 中山大学 | Amphioxus saccharide pattern-recognition molecule Bjfcn1 gene and application thereof |
-
2015
- 2015-11-17 CN CN201510790967.9A patent/CN105255749A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004025263A2 (en) * | 2002-09-16 | 2004-03-25 | Advanced Bionutrition Corporation | Protein and peptide expression for passive immunity |
| CN101914546A (en) * | 2010-07-23 | 2010-12-15 | 中山大学 | Amphioxus saccharide pattern-recognition molecule Bjfcn1 gene and application thereof |
Non-Patent Citations (4)
| Title |
|---|
| CHENG,W. ET AL.: "GenBank：GQ228481.1", 《NCBI》 * |
| L. JIANG ET AL.: "Analyses of the effects of Rck2p mutants on Pbs2pDD-induced toxicity in Saccharomyces cervisiae identify a MAP kinase docking motif, and unexpected functional inactivation due to acidic substitution of T379", 《MOL GEN GENOMICS》 * |
| MAW-SHENG YEH ET AL.: "Molecular cloning and characterization of lipopolysaccharide- and β-1,3-glucan-binding protein from the giant freshwater prawn Macrobrachium rosenbergii and its transcription in relation to foreign material injection and the molt stage", 《FISH & SHELLFISH IMMUNOLOGY 》 * |
| 陈寅儿等: "三疣梭子蟹LGBP基因的重组表达及微生物结合实验", 《水产学报》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114672426A (en) * | 2022-04-21 | 2022-06-28 | 江苏农林职业技术学院 | Saccharomyces cerevisiae engineering bacterium, construction method and application thereof |
| CN114672426B (en) * | 2022-04-21 | 2023-11-10 | 江苏农林职业技术学院 | Saccharomyces cerevisiae engineering bacteria, construction method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104988077B (en) | A kind of production high temperature fiber element enzyme and the fine penicillium of zytase and application | |
| CN108795814B (en) | Bacterial strain capable of degrading waste feather, screening method and application thereof | |
| Yang et al. | Characterization and functional analyses of the chitinase-encoding genes in the nematode-trapping fungus Arthrobotrys oligospora | |
| CN101736062B (en) | Method for preparing recombinant porcine alpha interferon standard substance | |
| CN107828806A (en) | A kind of β alpha-glucosidase genes of new resistance to glucose and its application | |
| CN103013960A (en) | Alkaline protease and recombinant expression engineering bacterium thereof | |
| CN105296372A (en) | Engineered strain of saccharomyces cerevisiae capable of efficiently expressing macrobrachium rosenbergii lectin (Mr Lectin) | |
| CN101619309B (en) | Enzyme composition for high-efficiency decomposition of cellulose | |
| CN104928315A (en) | Construction and expression method of recombinant pichia pastoris strain expressing lysine aminopeptidase | |
| Zhang et al. | Enhancing laccase production by white-rot fungus Trametes hirsuta SSM-3 in co-culture with yeast Sporidiobolus pararoseus SSM-8 | |
| CN107384899A (en) | The acid protease g412 and its gene of a kind of originated from fungus and application | |
| CN105296373A (en) | Engineered saccharomyces cerevisiae capable of efficiently expressing Chinese mitten crab chitin | |
| CN105255749A (en) | Engineered strain of saccharomyces cerevisiae capable of efficiently expressing macrobrachium rosenbergii pattern recognition protein LGBP | |
| CN105255750A (en) | Engineered strain of saccharomyces cerevisiae capable of efficiently expressing eriocheir sinensis anti-lipopolysaccharide factor | |
| CN108192903A (en) | A kind of alkalescent xylanase and its encoding gene and application | |
| CN103352045B (en) | Arylsulfatase and preparation method and applications thereof | |
| CN105274014A (en) | Engineering bacterium of saccharomyces cerevisiae for efficiently expressing superoxide dismutase of macrobrachium rosenbergii | |
| CN101724565A (en) | Acid xylanase XYNB, genes and application thereof | |
| CN103031289A (en) | Lactase and recombinant expression engineering bacterium thereof | |
| CN103184197B (en) | Sorbose dehydrogenase and sorbosone dehydrogenase, and applications thereof | |
| CN105296374A (en) | Saccharomyces cerevisiae engineered strain for efficiently expressing macrobrachium rosenbergii Crustin (MrCrustin) | |
| CN102242092A (en) | Isolation and identification for bombyx mori intestinal tract probiotics, and cloning and expression of enzyme gene produced by bombyx mori probiotics | |
| CN104726388A (en) | Pullulanase enzyme-producing strain and method for improving enzyme-producing capacity thereof | |
| CN104560833A (en) | Basophilic micrococcus and alkaline xylanase produced from basophilic micrococcus and application | |
| CN107201354A (en) | A kind of neutral proteinase and its gene and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160120 |
|
| RJ01 | Rejection of invention patent application after publication |