CN102242092A - Isolation and identification for bombyx mori intestinal tract probiotics, and cloning and expression of enzyme gene produced by bombyx mori probiotics - Google Patents
Isolation and identification for bombyx mori intestinal tract probiotics, and cloning and expression of enzyme gene produced by bombyx mori probiotics Download PDFInfo
- Publication number
- CN102242092A CN102242092A CN2011101044056A CN201110104405A CN102242092A CN 102242092 A CN102242092 A CN 102242092A CN 2011101044056 A CN2011101044056 A CN 2011101044056A CN 201110104405 A CN201110104405 A CN 201110104405A CN 102242092 A CN102242092 A CN 102242092A
- Authority
- CN
- China
- Prior art keywords
- silkworm
- intestinal tract
- bombyx mori
- enzyme
- probiotics
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a method for isolating and identifying bombyx mori intestinal tract probiotics, and cloning and expression of enzyme gene produced by bombyx mori intestinal tract probiotics. With the present invention, bacillus cereus in the bombyx mori intestinal tract is isolated and identified, the enzyme gene produced by the bacillus cereus is cloned and expressed; the method provides important significance for improving intestinal environment of the bombyx mori, and raising digestibilities of mulberry leaf and feed starch, and leaf-silk conversation rate. The bombyx mori intestinal tract probiotics capable of enzyme producing is screened through the method provided by the present invention, belongs to the range of feed-grade microbial feed additives, and has good application prospect.
Description
Technical field
The present invention relates to a kind of isolation identification of silkworm beneficial bacteria of intestinal tract and the cloning and expression method of enzyme gene thereof, belong to biological technical field.
Background technology
Animal intestinal is the desirable place of multiple microorganism growth breeding.Normal intestinal microbes has effects such as nutrition, immunity, growth-stimulating, biological antagonist to the host, be the physiology integral part of body.Silkworm is the important economic insects that great economic benefit and social benefit are arranged.But exist conversion rate of silk leaves low (about 10%) in the silkworm industry production process, the mulberry leaf cost accounts for more than 50% of silk cocoon production cost always.Simultaneously, flacherie incidence height, China reaches more than 10% because of the cocoon amount that flacherie is lost every year.Therefore, improving the utilization ratio of silkworm to mulberry leaf by multiple channel, improve conversion rate of silk leaves, reduce the generation of flacherie, is that silkworm already produces the important topic that faces for a long time.The application of probiotics with develop into the approach that provides good that addresses these problems.In the control of Animal diseases, microbiotic is used drawback and is manifested day by day, and probiotics has the thing of actuating growth, disease preventing and treating, and therefore characteristics such as have no side effect also become one of microbiotic ideal substitute.
Silkworm has the advantages that as a kind of important economic animal and lepidopterous insects research model growth is fast, the cycle is short.When more than 20 day larval stage, silkworm is except the ability that itself has digest food, and microbial population of a great variety in the enteron aisle, enormous amount also plays an important role to the digestion of its food and the absorption of nutrition.Simultaneously, because the result of long-term domestication, silkworm diseases prevention ability is extremely fragile; The existence of profitable strain in the enteron aisle can help silkworm to resist the invasion and attack of endogenous Micobial Disease effectively.Therefore, the microorganism in the enteron aisle is significant to silkworm, adds to product enzyme probiotic bacterium among the silkworm artificial feed or is applied in mulberry leaf surfaces feeding silkworm, will help silkworm and fully digest and assimilate nutritive substance, improves feed efficiency.
The midgut of silkworm is the main place of digestion mulberry leaf, is assembling a large amount of various microorganisms, and these microorganisms play an important role at aspects such as feed of mulberry silkworm digestion, disease generations, thereby they are the very good material as the silkworm probiotics.Beneficial bacteria of intestinal tract can play prebiotic effect by its secreted enzyme.Research silkworm entero-bacte and produce enzyme and carry out the prokaryotic expression analysis to producing the enzyme gene has the certain significance improving in the exploitation of silkworm intestines micro-ecological environment and artificial diet of silkworm.
Domestic research about the silkworm beneficial bacteria of intestinal tract at present mainly concentrates on its disease-resistant and aid digestion aspect, still is in initial period.Easily send out equality to different silkworm rearing seasons, enteron aisle aerobic microbiological population constitutes and changes and carried out systematic research (Agricultural University Of Southwest's journal, 2001,23 (2): 117-119), but beneficial flora is not studied between the different length of time.Gao Huiju etc. to silkworm enteron aisle bacteria produced proteinase strain carried out separating and screened (separating and screening of silkworm enteron aisle zymogenic bacteria, silkworm industry science, 2007,33 (2): 228～233.), separate obtaining 30 strain bacterial strains from the silkworm enteron aisle, studied the enzymatic productivity of their born of the same parents' exoamylases, proteolytic enzyme, cellulase and lipase, the various zymogenic bacterias in the silkworm enteron aisle are up to 60%, having shown that entero-bacte is in nibbles importance in the thing digestive process, but microbes producing cellulase is not made evaluation.Sun Xue is strange wait filter out in the silkworm enteron aisle the aerobic and amphimicrobe of many strains (aerobic and part amphimicrobe of silkworm enteron aisle and silkworm are with the research [J] of probiotics. Sichuan silkworm industry, 1996,24 (1): 13-15.), select wherein 5 strain bacterium of 5 genus for use, add that another kind of bacterium is made into 4 kinds of mixed bacteria liquids, add the food test 4 the last daies in age silkworm, consequently sickness rate obviously reduces, and cocoon weight and cocoon shell weight also improve a lot.Other is more with the research that the mankind make the effect aspect mutually about domestic silkworm gene.Have not yet to see about the silkworm enteron aisle and produce the directive breeding of enzyme probiotic bacterium and the report of Study on mechanism.
About the research of α-Dian Fenmei, mainly concentrate on molecular improvement and industrial production application facet at present.Comprise the clone of promoter function to this enzyme gene, coding region sequence and in different expression systems, carry out protokaryon and eukaryotic expression etc., and to its transgenation, gene expression regulation, with the mechanism research of expression study in the gene transferred plant and gene function, as stable on heating mechanism of action, its zymologic property etc. has also caused more concern to the problems such as conservation rate of recombinant plasmid in the process of going down to posterity that contains this gene under the extreme environment.The industrial production application facet also has more research report.At present, do not see temporarily the application aspect silkworm industry probiotics of intestines source property bacillus cereus and institute's enzyme that produces thereof, and report few yet about the research of intestines source property α-Dian Fenmei generation bacterium.
Summary of the invention
The object of the present invention is to provide a kind of isolation identification of silkworm beneficial bacteria of intestinal tract and the cloning and expression method of enzyme gene thereof, bacillus cereus in the silkworm enteron aisle is carried out the cloning and expression of isolation identification and enzyme gene, to improving the silkworm intestinal environment, improve mulberry leaf, feed starch digestion rate and conversion rate of silk leaves and have great significance.
The object of the present invention is to provide a kind of silkworm beneficial bacteria of intestinal tract enzyme, it is an enteric microorganism source α-Dian Fenmei, has SEQID NO 3 described aminoacid sequences.
The present invention also aims to:
A kind of gene of silkworm beneficial bacteria of intestinal tract enzyme is provided, has SEQ NO ID 1 or SEQ NO ID 2 described base sequences.
Provide a kind of expression vector that contains said gene to reach by the expression vector transformed host cells.
Another object of the present invention is to: a kind of separation method of silkworm beneficial bacteria of intestinal tract enzyme bacterial strain is provided, may further comprise the steps:
1) get silkworm at random and make the kind five-age larva greatly, stand-by behind the hungry 24h;
2) with after the body surface sterilization in the immersion of the silkworm body in step 1) volumetric concentration 75% ethanol, rinsing is 2 times in the immigration sterilized water, and enteron aisle is taken out in aseptic technique, moves into respectively after smashing to pieces in the NA liquid nutrient medium, carries out enrichment culture; Culture condition: 150r/min, 28 ℃, 48h cultivates 2 times.The 2nd pregnant solution got respectively after by 10 times of dilution methods dilutions on 0.2mL coats on the NA solid medium, in 28 ℃ of incubators, cultivated;
3) will be through step 2) bacterium colony of turning out is separated into single bacterium colony with method of scoring, and the bacterial classification of gained is carried out plating, cultivates 48h in 28 ℃ of incubators;
4) the bacterial classification point of getting behind the purifying with inoculating needle is connected on the preprepared NA starch screening culture medium flat board, cultivate 48h in 28 ℃ of incubators, add iodine staining and observe, the hydrolysis phenomenon is arranged, and unhydrolysed bacterial strain on contrast NA substratum is the screening gained and produces amylase strain.
Compared with the prior art, beneficial effect of the present invention is embodied in:
The present invention, improves mulberry leaf, feed starch digestion rate and conversion rate of silk leaves and has great significance improving the silkworm intestinal environment by bacillus cereus in the silkworm enteron aisle being carried out isolation identification and the cloning and expression gene obtains amylase enzyme gene.
The silkworm enteron aisle zymogenic bacteria that filters out in the process of the present invention belongs to the feed level microbe additive scope, has application promise in clinical practice.
Description of drawings
Fig. 1 is the The selection result that the present invention produces amylase strain.
Fig. 2 a is DZ-a bacterium microscopic examination result of the present invention.
Fig. 2 b is DZ-h bacterium microscopic examination result of the present invention.
Fig. 3 is gene amplification of the present invention, the result that 1% agarose gel electrophoresis detects.
M is MarkerD among Fig. 3,1,2,3,4,5,6 represent primer Primer3004-4081 amplification DZ-a fragment, Primer3004-4081 amplification DZ-h fragment, Primer512-1751 amplification DZ-a fragment, Primer512-1751 amplification DZ-h fragment, Primer666-2041 amplification DZ-a fragment, Primer666-2041 amplification DZ-h fragment respectively.
Fig. 4 is that gene glue of the present invention reclaims, the result that 1% agarose gel electrophoresis detects.
M is MarkerD among Fig. 4,1,2,3,4,5,6 represent primer Primer3004-4081 amplification DZ-a fragment, Primer3004-4081 amplification DZ-h fragment, Primer512-1751 amplification DZ-a fragment, Primer512-1751 amplification DZ-h fragment, Primer666-2041 amplification DZ-a fragment, Primer666-2041 amplification DZ-h fragment respectively.
Fig. 5 is that pET28a-DZamy expression product SDS-PAGE analyzes.
Among Fig. 5: 1:Transetta (DE3) tropina; 2: without IPTG inductive protein sample; The 3-8:IPTG induced concentration is respectively 0.2mM, 0.4mM, 0.6mM, 0.8mM, the Recombinant Protein Expression when 1.0mM and 1.2mM; M: molecular weight of albumen standard.
The present invention will be further described by embodiment below in conjunction with accompanying drawing
Embodiment
1. the preparation of the selection of material and substratum
11. silkworm enteron aisle sample silkworm Bombyx mori makes kind greatly provide by bombycology teaching and research room of Agricultural University Of Anhui, by artificial diet feed to five age silkworm as for the examination material.
1.2 test substratum NA substratum: peptone 10.0g, extractum carnis 5.0g, NaCl5.0g, agar 18.0g, water 1L, pH are 7.2～7.4.NA starch screening culture medium: the NA substratum adds 1.0% Zulkovsky starch.The LB substratum: tryptone 10g, yeast extract 5g, NaCl 10g, water 1L, pH 7.0, and solid medium adds 1.5% agar powder, and is standby behind the autoclaving.Liquid nutrient medium does not add agar.
1.3 main agents and plasmid K1201 type UNIQ-10 pillar bacterial genomes DNA extraction test kit, dna molecular amount mark, pcr amplification reagent etc. are given birth to worker's biotechnology company limited available from Shanghai; DNTPs, competent cell Trans5 α, pEASYT1, Transetta etc. are available from TransGen company; Plasmid extraction test kit and gel reclaim test kit AP-GX-50, available from Axygen company; PET-28 (a+) Vector is available from Novagen company; BamHI and XhoI restriction enzyme, T4 ligase enzyme, PMD19-T Simple Vector etc. are available from Takara company, and recombinant plasmid pET28a-DZamy is for making up in this research.Other reagent is homemade analytical reagent.
2. the cloning and expression process of isolation identification of bacillus cereus and enzyme gene thereof
2.1 the silkworm entero-bacte is produced the screening of amylase strain:
Make 10 of kind five-age larvas greatly 2.1.1 get silkworm at random, stand-by behind the hungry 24h.
2.1.2 the cultivation of silkworm entero-bacte
After body surface sterilization in silkworm body immersion volumetric concentration 75% ethanol, rinsing is 2 times in the immigration sterilized water, and enteron aisle is taken out in aseptic technique, moves into respectively after smashing to pieces in the NA liquid nutrient medium, carries out enrichment culture.Culture condition: 150r/min, 28 ℃, 48h cultivates 2 times.The 2nd pregnant solution got 0.2mL respectively after by 10 times of dilution methods dilutions coat on the NA solid medium, in 28 ℃ of incubators, cultivate.
2.1.3 the separation and purification of silkworm entero-bacte
The bacterium colony of turning out is separated into single bacterium colony with method of scoring,, preserves standby until being single thalline through microscopic examination.
2.1.4 the morphologic observation of silkworm entero-bacte
The bacterial classification of separation and purification is carried out plating, in 28 ℃ of incubators, cultivate 48h.
2.1.5 produce the screening of amylase strain
The bacterial classification point of getting behind the purifying with inoculating needle is connected on the preprepared NA starch screening culture medium flat board, in 28 ℃ of incubators, cultivate 48h and add the iodine staining observation, for the hydrolysis phenomenon is arranged and on its contrast NA flat board the bacterial strain separated of water breakthrough not, be the product enzyme isolate of screening gained.The selection result is as follows:
Produce the amylase bacterium and the enzyme transparent circle on the NA starch culture-medium, occurs producing, as shown in Figure 1.Therefrom select the more typical two strain bacterium of form, be numbered DZ-a number, DZ-h number, after the NA liquid nutrient medium enrichment culture, the DNS method is measured enzyme and is lived, and sees Table 1.Enzyme is lived and defined: at pH7.0, under 40 ℃ of conditions, it is 1 enzyme activity unit that per minute degraded Zulkovsky starch discharges the needed enzyme amount of 1 micromole's reducing sugar, represents with UmL-1.
Table 1 enzyme activity determination result
2.1.6 microscopy and observation
Observe colonial morphology, colony colour, bacterium colony size and colony growth velocity characteristic.
Zymogenic bacteria DZ-a, DZ-h bacterium microscopy are gram-positive microorganism, and single thalline is shaft-like, and the thalline two ends are more smooth, and most catenations all are in logarithmic phase, and gemma is not obvious, and shown in Fig. 2 a and Fig. 2 b, colony morphology characteristic sees Table 2.Table 2 silkworm enteron aisle isolate colony characteristics
2.2 the mensuration of amylase activity DNS method, reaction substrate are 1% Zulkovsky starch solution.
2.3 the growth curve of isolate is made in the extraction of producing amylase bacterial genomes DNA respectively, finds out logarithmic phase, with pillar bacterial genomes DNA extraction test kit, extracts total DNA of logarithmic phase bacterium.
2.4 the pcr amplification of 16SrDNA sequence and cloning and sequencing are with the 16SrDNA sequence of primer 2 7f-1492r amplification isolate DZ-a number, DZ-h number.The PCR reaction conditions is: 94 ℃, and 10min; 94 ℃, 35s, 54 ℃, 40s, 72 ℃, 90s, 35 circulations; 72 ℃, 10min, 1% agarose gel electrophoresis detects the PCR product.The PCR product utilizes glue to reclaim recovery and purifying that test kit carries out product after gel electrophoresis separates.Then target gene fragment is connected with the PMD-19T carrier, changes in the DH5a competent cell and cultivate.Filter out positive colony, serve the order-checking of extra large Initrogen company.
2.5 16SrDNA sequential analysis and data processing are utilized Primer5.0, DNAStar software package design primer and analytical sequence; BLAST in the ncbi database, instruments such as ClustalW and Interproscan are used for sequence alignment and homology analysis; Adopt the Neighbor-joining method constructing system evolutionary tree in the MEGA4.0 software.
2.6 bacillus cereus produces the segmental clone of alpha-amylase gene according to the position of alpha-amylase gene in bacillus cereus genome sequence CP001283.1, design 3 pairs of primer segmentation amplification bacillus cereuss and produce alpha-amylase gene: Primer666:5 '-CATAGCCACCCATACCT-3 ', Primer2041:5 '-ATCTCCATTAGCGAACC-3 '; Primer512:5 '-CCATCAGCAGCAGGTCC-3 ', Primer1751:5 '-TCCACTTCCCGTCTTTC-3 '; Primer3004:5 '-TTGTCGCAAATGTATGG-3 ', Primer4081:5 '-CTCGCGTTGTATCTCGT-3 ', 3 pairs of primers are synthetic by Ying Jun biotech firm.Be that template increases with DZ-a, DZ-h bacterium genomic dna respectively, the PCR reaction conditions: 94 ℃, 10min; 94 ℃, 35s, 57 ℃, 40s, 72 ℃, 90s, 35 circulations; 72 ℃, 10min, 1% agarose gel electrophoresis detects the PCR product.Glue reclaims, goal gene clone process is with 2.4, and positive colony bacterium liquid is served the order-checking of extra large Initrogen company, the amplified production electrophoresis detection, as shown in Figure 3, Figure 4.
Draw the complete amylase gene coding region sequence that obtains after the three sections alpha-amylase gene cloning and sequencing result splicings separately of 2 strain bacillus cereuss 2.7 produce enzyme gene clone sequencing result analysis and phylogenetic tree, the phylogenetic tree method for drafting is with 2.5.
2.8 construction of prokaryotic expression vector is a template with aforesaid bacterial genomes DNA, the ORF fragment of design primer PrimerB, PrimerX amplification bacillus cereus amylase gene.PrimerB:5 ' CA wherein
ATGCTTAAAGAAGCCATTTA 3 ', PrimerX:5 ' GAC
TTACCATTTTAATATGGAGAA 3 ' (the italic underscore partly is difference BamHI and XhoI restriction enzyme site), the PCR reaction conditions: 94 ℃, 10min; 94 ℃, 35s, 57 ℃, 40s, 72 ℃, 120s, 35 circulations; 72 ℃, 10min.Be connected into pEASY T1 carrier after the PCR product is purified, transformed into escherichia coli TransT1.Choose positive colony and carry out enlarged culturing and extract plasmid, the back is all carried out endonuclease reaction respectively with BamHI and XhoI restriction enzyme with pET-28 (a+) carrier.The contained rare codon of this enzyme genes encoding region sequence of on-line analysis
Http:// nihserver.mbi.ucla.edu/RACC/Enzyme is cut product and is connected back transformed into escherichia coli Transetta (DE3), obtains recombinant expression plasmid after enzyme is cut evaluation.
2.9 Recombinant Protein Expression transforms host bacterium Transetta (DE3) with evaluation with recombinant plasmid pET28a-DZamy, coating selectivity plate screening positive colony.Prepare 6 centrifuge tubes, every pipe is got the positive colony bacterium liquid of same amount 200 μ L, adding concentration respectively then in the positive colony bacterium liquid of cultivating is 0mmol/L, 0.2mmol/L, 0.4mmol/L, 0.6mmol/L, 0.8mmol/L, 1.0mmol/L, 1.2mmol/L IPTG add volume and be respectively: 0mmol/L does not add, 0.2mmol/L add 24 μ L, 0.4mmol/L adds 48 μ L, 0.6mmol/L72 μ L, 0.8mmol/L96 μ L, 1.0mmol/L120 μ L, the IPTG144 μ L of 1.2mmol/L induces centrifugal collection thalline behind the 4h.Thalline carries out cytoclasis (300W, 20min, ultrasonic 3s, 2s at interval) with ultrasonic wave after PBS suspends, extract e. coli total protein and carry out the SDS-PAGE electrophoretic analysis, as shown in Figure 5.
3. the cloning and expression result of isolation identification of bacillus cereus and enzyme gene thereof
The present invention filters out from the silkworm enteron aisle 2 strain producing alphas-diastatic bacterial isolates DZ-a number and DZ-h number, is accredited as the bacillus bacillus cereus, and the DNS method is surveyed its product enzyme work and is respectively 20.5UmL
-1And 24.2UmL
-1Clone 2 sequences that the back order-checking obtains 3414,3378 bases respectively to producing the enzyme gene, all comprise complete ORF frame, and wherein DZ-a bacterium alpha-amylase gene carries out prokaryotic expression in escherichia expression system, SDS-PAGE analyzes the target protein DZamy obtain the about 66kD of size, for further functional study and this zymogenic bacteria of this enzyme lays the foundation in the application aspect the probiotics.The silkworm enteron aisle zymogenic bacteria that filters out in this invention process belongs to the feed level microbe additive scope, has application promise in clinical practice.
Claims (6)
1. a silkworm beneficial bacteria of intestinal tract enzyme is characterized in that, has SEQ ID NO 3 described aminoacid sequences.
2. the gene of the described silkworm beneficial bacteria of intestinal tract of coding claim 1 enzyme is characterized in that having SEQ NO ID 1 or SEQ NO ID 2 described base sequences.
3. contain right and require 2 described expression carrier.
By the described expression vector of claim 4 transform host cell.
5. the separation method of a silkworm beneficial bacteria of intestinal tract enzyme is characterized in that, may further comprise the steps,
1) get silkworm at random and make the kind five-age larva greatly, stand-by behind the hungry 24h;
2) with after the body surface sterilization in the immersion of the silkworm body in step 1) volumetric concentration 75% ethanol, rinsing is 2 times in the immigration sterilized water, and enteron aisle is taken out in aseptic technique, smashs to pieces in the back immigration NA liquid nutrient medium, carries out enrichment culture; Culture condition: 150r/min, 28 ℃, 48h cultivates 2 times, gets 0.2mL respectively after the 2nd pregnant solution diluted by 10 times of dilution methods and coats on the NA solid medium, cultivates in 28 ℃ of incubators;
3) will be through step 2) bacterium colony of turning out is separated into single bacterium colony with method of scoring, and the bacterial classification of gained is carried out plating, cultivates 48h in 28 ℃ of incubators;
4) the bacterial classification point of getting behind the purifying with inoculating needle is connected on the preprepared NA starch screening culture medium flat board, cultivate 48h in 28 ℃ of incubators, add iodine staining and observe, the hydrolysis phenomenon is arranged, and unhydrolysed bacterial strain on contrast NA substratum is the screening gained and produces amylase strain.
6. the separation method of a kind of silkworm beneficial bacteria of intestinal tract enzyme according to claim 5 is characterized in that, described NA substratum is by following proportioning: contain peptone 10.0g, extractum carnis 5.0g, NaCl5.0g, agar 18.0g in every premium on currency, pH is 7.2～7.4; Described NA starch screening culture medium is to serve as the Zulkovsky starch of basis interpolation massfraction 1.0% with the NA substratum; Described LB substratum is pressed following proportioning: tryptone 10g, yeast extract 5g, NaCl 10g, water 1L, pH 7.0.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011101044056A CN102242092A (en) | 2011-04-25 | 2011-04-25 | Isolation and identification for bombyx mori intestinal tract probiotics, and cloning and expression of enzyme gene produced by bombyx mori probiotics |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011101044056A CN102242092A (en) | 2011-04-25 | 2011-04-25 | Isolation and identification for bombyx mori intestinal tract probiotics, and cloning and expression of enzyme gene produced by bombyx mori probiotics |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102242092A true CN102242092A (en) | 2011-11-16 |
Family
ID=44960340
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2011101044056A Pending CN102242092A (en) | 2011-04-25 | 2011-04-25 | Isolation and identification for bombyx mori intestinal tract probiotics, and cloning and expression of enzyme gene produced by bombyx mori probiotics |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102242092A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102533598A (en) * | 2011-12-19 | 2012-07-04 | 安徽农业大学 | Neutral protease enzyme-producing bacterial strain in bombyx mori intestinal tract, neutral protease gene and prokaryotic expression vector and preparation method thereof |
| CN106867904A (en) * | 2017-02-20 | 2017-06-20 | 华南农业大学 | A kind of cultural method of bombyx mori intestinal probiotics and its application in terms of silkworm cocoon yield is improved |
| CN110016452A (en) * | 2019-04-30 | 2019-07-16 | 汕头大学 | One plant has prebiotic active production butyric DG1 and its cultural method and application |
| CN112301055A (en) * | 2020-11-04 | 2021-02-02 | 西南大学 | Application and method of silkworm amylase gene BmAmy1 |
-
2011
- 2011-04-25 CN CN2011101044056A patent/CN102242092A/en active Pending
Non-Patent Citations (3)
| Title |
|---|
| 孙雪奇: "家蚕肠道好氧和部分兼厌氧微生物及蚕用微生态制剂的研究", 《四川蚕业》 * |
| 李蒙英 等: "家蚕肠道菌群的研究", 《江苏蚕业》 * |
| 高绘菊等: "家蚕肠道产酶菌的分离与筛选", 《蚕业科学》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102533598A (en) * | 2011-12-19 | 2012-07-04 | 安徽农业大学 | Neutral protease enzyme-producing bacterial strain in bombyx mori intestinal tract, neutral protease gene and prokaryotic expression vector and preparation method thereof |
| CN106867904A (en) * | 2017-02-20 | 2017-06-20 | 华南农业大学 | A kind of cultural method of bombyx mori intestinal probiotics and its application in terms of silkworm cocoon yield is improved |
| CN110016452A (en) * | 2019-04-30 | 2019-07-16 | 汕头大学 | One plant has prebiotic active production butyric DG1 and its cultural method and application |
| CN110016452B (en) * | 2019-04-30 | 2022-12-20 | 汕头大学 | Butyric acid producing bacterium DG1 with probiotic activity and culture method and application thereof |
| CN112301055A (en) * | 2020-11-04 | 2021-02-02 | 西南大学 | Application and method of silkworm amylase gene BmAmy1 |
| CN112301055B (en) * | 2020-11-04 | 2022-05-20 | 西南大学 | Application and method of silkworm amylase gene BmAmy1 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105670958B (en) | One plant of low temperature biocontrol bacterial strain and its application | |
| CN103074315B (en) | Lipase LIP, gene and application thereof | |
| CN102757947A (en) | Xylanase xyn-CDBFV-m with modified thermal stability, gene thereof, and application thereof | |
| CN107828806A (en) | A kind of β alpha-glucosidase genes of new resistance to glucose and its application | |
| CN105368866A (en) | Application of improved ATMT (Agrobacterium Tumefaciens-Mediated Transformation) to construction of trichoderma atroviride T23 deltaCrel | |
| CN101402959A (en) | Promotor replacement method for improving volume of production of bacillus subtilis surfactin | |
| CN102242092A (en) | Isolation and identification for bombyx mori intestinal tract probiotics, and cloning and expression of enzyme gene produced by bombyx mori probiotics | |
| CN105802892B (en) | It is a kind of produce keratinase germ oligotrophy unit cell and its application | |
| CN103451163B (en) | The hydrogen peroxide enzyme mutant that a kind of enzyme is lived and thermostability improves | |
| CN105255771A (en) | Staphylococcus succinus for generating collagenase and application thereof | |
| Zin et al. | Purification and characterization of a carboxymethyl cellulase from Artemia salina | |
| CN104560817B (en) | Thermophilic bacillus licheniformis UTM102 for producing phytase and application of thermophilic bacillus licheniformis UTM102 | |
| CN103525782A (en) | Organophosphorus pesticide degrading enzyme gene and application thereof | |
| CN101701214B (en) | Xylanase XYNA4 with wide pH applicability and gene and application thereof | |
| CN104263749B (en) | A kind of expression of scorpion derived antimicrobial peptide IsCT in Pichia pastoris and its clinically application for the treatment of infectious trauma | |
| CN101475944B (en) | Promoter replacement method for improving Bacillus amyloliquefaciens yield | |
| CN104357425A (en) | Novel alpha-galactosidase NGAL, and gene and application thereof | |
| CN101838636A (en) | High-specific-activity xylanase XYN11F63 and genes and application thereof | |
| CN104818220B (en) | One plant is screened the Rhizopus oryzae bacterial strain JHSW01 obtained from rotten stalk | |
| CN103966110A (en) | Penicillium oxalicum host strain for enhancing expression of filamentous fungi protein | |
| CN103589660A (en) | Endophytic bacterium capable of producing triptolide | |
| CN105062906B (en) | A kind of production method optimizing organophosphor hydrolytic enzyme Yeast engineering bacteria and its enzyme | |
| CN101565462B (en) | Large yellow croaker BPI-BN protein, primer and applications thereof in preparing antibiotic drugs | |
| CN103290039B (en) | Alpha-amylase derived from animal feces metagenome and gene of the alpha-amylase | |
| CN102260689A (en) | Gene engineering bacteria for food-grade heterologous secretion expression of IIa-class bacteriocin, construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20111116 |