CN105296374A - Saccharomyces cerevisiae engineered strain for efficiently expressing macrobrachium rosenbergii Crustin (MrCrustin) - Google Patents
Saccharomyces cerevisiae engineered strain for efficiently expressing macrobrachium rosenbergii Crustin (MrCrustin) Download PDFInfo
- Publication number
- CN105296374A CN105296374A CN201510908140.3A CN201510908140A CN105296374A CN 105296374 A CN105296374 A CN 105296374A CN 201510908140 A CN201510908140 A CN 201510908140A CN 105296374 A CN105296374 A CN 105296374A
- Authority
- CN
- China
- Prior art keywords
- mrcrustin
- saccharomyces cerevisiae
- phac181
- cerevisiae engineered
- engineered yeast
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a saccharomyces cerevisiae engineered strain for efficiently expressing macrobrachium rosenbergii Crustin (MrCrustin), belonging to the technical field of biology. The cDNA of MrCrustin is cloned onto a vector plasmid pHAC181; a target gene is integrated at the downstream of a GAL1 promoter in a saccharomyces cerevisiae strain by using a homologous recombination method after a successfully-cloned positive transformant is subjected to sequencing verification; and a target protein, namely MrCrustin, is efficiently expressed under the induction of galactose.
Description
Technical field
The present invention relates to a kind of saccharomyces cerevisiae engineered yeast of high expression Macrobrachium rosenbergii chitin, belong to biological technical field.
Background technology
Culture fishery is one of important industry of China's economy foreign exchange earning, and fishery has become the growth point of rural economy in China.Crustacean disease is on the rise in recent years, brings huge financial loss to China's culture fishery.
Crustacean lacks acquired specific immune function, but they have fairly perfect congenital non-specific immune systems, can identify rapidly and effectively remove the microorganism of invasion.The antibacterial peptide of crustacean has comparatively high antibacterial activity, good water solubility, and the heat-staple immunological effect factor can directly be killed or remove pathogenic micro-organism, is the important component part in crustacean innate immune system.Most antibacterial peptide has broad-spectrum antibacterial action, has sterilization in various degree or bacteriostatic action to Gram-negative bacteria and gram-positive microorganism.
Chitin (Crustin) studies more antibacterial peptide in shrimp crab.At present, utilize yeast saccharomyces cerevisiae to Macrobrachium rosenbergii Crustin albumen carry out eukaryotic expression and protein function research have not been reported.But the heterogenous expression of gene is subject to the impact of the many factors such as host, carrier, starting element.Therefore, how to realize the heterogenous expression of chitin Crustin in Crustacean source, activity expression, high expression be the problem needing solution at present badly.
Summary of the invention
In order to solve the problem, the present invention utilizes yeast saccharomyces cerevisiae to achieve the important immune factor of Macrobrachium rosenbergii (the Macrobrachiumrosenbergii)-heterogenous expression of chitin Crustin, activity expression, high expression, has played vital role to strengthening Crustacean to various principal disease and the resistibility of environmental change, effectively its healthy growth of promotion.
First object of the present invention is to provide a kind of saccharomyces cerevisiae engineered yeast of high expression Macrobrachium rosenbergii chitin, the construction process of described engineering bacteria is cloned into by the cDNA of Macrobrachium rosenbergii chitin Crustin on expression plasmid pHAC181 to obtain the correct recombinant plasmid pHAC181-MrCrustin of sequence verification (namely MrCrustin represents the Crustin deriving from Macrobrachium rosenbergii), then design homologous recombination primer, utilize homologous recombination technique goal gene MrCrustin to be integrated into the GAL1 promotor downstream of Saccharomyces cerevisiae host bacterial strain.This project bacterium, can high efficiency expressing destination protein under the induction of semi-lactosi.
In one embodiment of the invention, the nucleotide sequence in the CDS region of the cDNA of described MrCrustin is as shown in SEQIDNO.1.
In one embodiment of the invention, the cDNA of described MrCrustin CDS region (codingsequence) translation after aminoacid sequence as shown in SEQIDNO.2.
In one embodiment of the invention, described expression plasmid pHAC181 inserts 3 histidine-taggedly to obtain in SphI and the EcoRV site of commercialization plasmid YCplac181, refer to document: AnalysesoftheeffectsofRck2pmutantsonPbs2p
dD-inducedtoxicityinSaccharomycescervisiaeidentifyaMAPkinas edockingmotif, andunexpectedfunctionalinactivationduetoacidicsubstituti onofT379, MolGenGenomics, 2004,271:208 – 219.
In one embodiment of the invention, described host strain is yeast saccharomyces cerevisiae GAL1-ScRCH1, is the promotor of the ScRCH1 gene in yeast saccharomyces cerevisiae BY4741 (Sc04153268_s1) bacterial strain is replaced to GAL1 promotor.
In one embodiment of the invention, described saccharomyces cerevisiae engineered yeast builds as follows and obtains: (1) for template PCR amplifications or directly chemosynthesis, obtains the MrCrustin gene fragment of nucleotide sequence as shown in SEQIDNO.1 with the cDNA of Macrobrachium rosenbergii; (2) by MrCrustin gene fragment clone on expression plasmid pHAC181, obtain recombinant expression plasmid pHAC181-MrCrustin; (3) homologous recombination primer is designed, plasmid pHAC181-MrCrustin is increased, obtain the nucleotide fragments containing MrCrustin gene, use the method for homologous recombination, this nucleotide fragments is integrated into GAL1 promotor downstream in Wine brewing yeast strain.
In one embodiment of the invention, described step (3), also comprises and bacterial strain after inducing culture 6h, is extracted strain protein in YPG substratum, detect for being WESTERNBLOT, the Yeast engineering bacteria of bacterial strain then for successfully constructing that target protein is expressed.
Second object of the present invention is to provide a kind of method of high expression Macrobrachium rosenbergii chitin MrCrustin, and described method uses described saccharomyces cerevisiae engineered yeast for producing bacterial strain.
In one embodiment of the invention, described method, after being activated by saccharomyces cerevisiae engineered yeast, is inoculated in YPG substratum, under the induction of semi-lactosi, cultivates 6h; Described YPG substratum contains D-semi-lactosi 20g/L, peptone 20g/L, yeast extract 10g/L.
The present invention also claimed described saccharomyces cerevisiae engineered yeast produces the Macrobrachium rosenbergii chitin MrCrustin obtained, and the application of described saccharomyces cerevisiae engineered yeast in aquaculture or aquatic animal immunity and fodder additives etc.
Beneficial effect of the present invention:
(1) saccharomyces cerevisiae engineered yeast of the present invention's structure, can realize the high expression of Macrobrachium rosenbergii chitin MrCrustin, activity expression; The MrCrustin that engineering bacterium fermentation of the present invention obtains has vigor, and after inducing culture 6h, every mL fermented liquid can obtain 0.0584mg albumen.
(2) engineering bacteria of the present invention is saccharomyces cerevisiae engineered yeast, expresses the MrCrustin of eukaryotic source, can secrete the protein through correctly folding and processing; And yeast saccharomyces cerevisiae has and grows fast in simple culture media; The Host Strains yeast saccharomyces cerevisiae that the present invention adopts, is food safety bacterial strain, can directly adds in feed.
(3) the present invention take pHAC181 as carrier, GAL1-ScRCH1 builds saccharomyces cerevisiae engineered yeast for host, achieve the high expression of chitin MrCrustin, to strengthening the resistibility of Crustacean to various principal disease and environmental change, effectively promote its healthy growth.The manufacture and exploit of current new feed protein source and fodder additives oneself become the gordian technique promoting that modern aquaculture industry develops in a healthy way, Yeast engineering bacteria of the present invention not only can further be studied the protein function of the important immunogene of Crustacean, also will provide scientific basis and novel method for development of new immunity enhancement type fodder additives.
Accompanying drawing explanation
Fig. 1: Macrobrachium rosenbergii chitin MrCrustincDNA amplified band (339bp);
Fig. 2: when Macrobrachium rosenbergii chitin MrCrustincDNA is cloned on carrier pHAC181, bacterium colony PCR checking positive transformant (Line2,3,4,5,6,7,9,10,11,12,14,15,16,18,19,20,21,23 is correct transformant);
Fig. 3: when Macrobrachium rosenbergii chitin MrCrustin is cloned on carrier pHAC181, and the digestion verification of positive transformant (Line1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18 is correct transformant);
Fig. 4: high-fidelity enzyme PrimeSTARGXL enzyme increases (4694bp) to recombinant plasmid pHAC181-MrCrustin;
Fig. 5: (the successful band of homologous recombination is the Line1 in 622bp, a figure, and 2,3 is correct transformant with the bacterial strain homologous recombination containing GAL1 promotor to detect primer detection pHAC181-MrCrustin; Line9 in b figure, 11 is correct transformant);
Fig. 6: WESTERNBLOT detects Gal-pHAC181-MrCrustin protein expression, and target protein is 22KD.
Embodiment
In the present invention, first adopt gene clone technology, be specially: after Macrobrachium rosenbergii RNA is extracted, be cDNA with Reverse Transcription box by RNA reverse transcription.High fidelity PCR enzyme is utilized to be increased by goal gene fragment MrCrustin.The gene fragment obtained that increases is connected with carrier pHAC181, proceeds in competent escherichia coli cell transT1, coats the dull and stereotyped upper 37 DEG C of incubated overnight of LA.The positive transformant that LA flat board obtains carries out digestion verification and sequence verification.Secondly, utilize homologous recombination technique that the plasmid pHAC181 with goal gene MrCrustin is integrated into GAL1 promotor downstream in Wine brewing yeast strain GAL1-ScRCH1 bacterial strain, the bacterial strain of successful integration after inducing culture 6h, extracts albumen, detects for WESTERNBLOT in YPG substratum.Target protein expresses the Yeast engineering bacteria of successful bacterial strain then for successfully constructing.
The composition of LA substratum: peptone 10g/L, yeast extract 5g/L, NaCl10g/L, agar 12g/L, adjusts PH to be 7.0, Amp microbiotic 100mg/ml (120 DEG C, 20min).
The composition of SD-Leu substratum: containing yeast nitrogen (without AA) 1.7g/L, ammonium sulfate 5g/L, glucose 20g/L, 10xAAmix (-ura ,-leu ,-his) 100ml, 100xUra10ml, 100xHis10ml, agar 20g/L (120 DEG C, 20min).
The composition of YPG substratum: D-semi-lactosi 20g/L, peptone 20g/L, yeast extract 10g/L (115 DEG C, 20min).Embodiment 1: the structure (gene clone) of Saccharomyces cerevisiae gene engineering bacteria
By building high-expression plasmid pHAC181-MrSOD, concrete grammar organizes RNA for extracting Macrobrachium rosenbergii, and RNA reverse transcription is cDNA by Reverse Transcription box.Utilize high-fidelity enzyme that goal gene fragment MrCrustin is carried out pcr amplification, MrCrustin gene fragment (CDS region, do not comprise terminator codon, 339bp altogether), then this fragment is cloned in high-expression plasmid pHAC181 multiple clone site, finally carry out DNA sequencing to correct recon, authentication sequence is not undergone mutation, and obtains restructuring high-expression plasmid pHAC181-MrCrustin.
Embodiment 2: the structure (homologous recombination) of Saccharomyces cerevisiae gene engineering bacteria
Homologous recombination primer is designed according to the restructuring high-expression plasmid pHAC181-MrCrustin built, utilize high-fidelity PrimeSTARGXL enzyme to increase to plasmid pHAC181-MrCrustin, the successful long segment that increases is integrated into GAL1 promotor downstream in Wine brewing yeast strain.
Homologous recombination primer is F1, R1, and sequence is as shown in SEQIDNO.3, SEQIDNO.4:
F1:caaatgtaataaaagtatcaacaaaaaattgttaatatacctctatactttaacgtcaaggagaaaaaacccggatctcaaaATGAAGGGTCTCCTGGTTTGC
R1：tatggacgaggtaataaggaaactcagaaccagaatagtggcatgagctctccaatttaacatatttgccattagtgaccCGATGATAAGCTGTCAAACATG
The concrete steps of homologous recombination (integration) are:
1. choose the GAL1-ScRCH1 bacterial strain list bacterium colony of activation, be inoculated into 3mlYPD substratum, 30 DEG C of 220rpm overnight incubation.
2. getting 300ul overnight culture is inoculated in 4.7ml2*YPD, cultivates 4 ~ 5h (reaching OD600=0.6-1.0) for 30 DEG C;
3. divide 3 pipes by 5ml bacterium liquid, room temperature centrifugal 4000rpm, 1min, abandon supernatant, then be merged in 1 EP pipe with 1ml water is resuspended, and the centrifugal 1min of 3000rpm, abandons supernatant.
4. add the 0.1MLiAc solution of 100ul, pressure-vaccum mixes, and the centrifugal 10s of 12000rpm, abandons supernatant.
5. repeating step 4.
6. add following material successively, add rear gentleness mixing:
240μlPEG(50％w/v)
36μl1.0MLiAc
10 μ lssDNA (10mg/ml, with front boiling 5min, is put in 5-10min on ice)
5-10ugpcr sheet segment DNA
7. mix, incubation 30min in 30 DEG C of water-baths;
Incubation 30min (heat shock) in 9.42 DEG C of water-baths;
The centrifugal removing supernatant of 10.3000rpm, with the resuspended thalline of the sterilized water of 1ml, 3000rpm is centrifugal, and 1min abandons supernatant, and reserved 100ul bacterium liquid is layered on to be selected on dull and stereotyped (SD-LEU), cultivates 3 ~ 5 days for 30 DEG C.
The transformant grown is carried out line purifying by 11. on SD-LEU flat board.Single colony inoculation incubated overnight in YPD substratum, extract transformant genome, carry out PCR detection with detection primer, the transformant having object fragment amplification to go out is the successful bacterial strain Gal-pHAC181-MrCrustin of homologous recombination.
Detecting primer is DF, DR, and sequence is as shown in SEQIDNO.5, SEQIDNO.6:
DF:CCTGGCCCCACAAACCTTC
DR:GCCGAAAAAGCTTAGTGGTTTG
Embodiment 3: engineering strain protein expression and WESTERNBLOT detect
Above-mentioned homologous recombination successful Gal-pHAC181-MrCrustin bacterial strain list colony inoculation incubated overnight in SD-LEU substratum 5ml, culture is transferred in 45mlYPG substratum for second day, after semi-lactosi inducing culture 6h (OD is detected as 1.2-1.5), extract strain protein.The albumen extracted is used for WESTERNBLOT and detects.
Concrete steps are:
(1) extraction of total protein in cell
1, picking list bacterium colony 30 DEG C of incubated overnight in required liquid nutrient medium are extremely saturated;
2, the bacterium liquid getting 5mL incubated overnight adds the fresh liquid nutrient medium of 45mL and shaking culture is about 6h (OD=1.2 ~ 1.5) (rotating speed is 220rmp) in 30 DEG C of shaking tables;
3, collect thalline with 8000rpm1min, remove the liquid on upper strata;
4, with the resuspended thalline of precooling distilled water, and supernatant liquor is removed after centrifugal;
5, add with thalline equivalent and the PEB of precooling (ProteinExtractionBuffer), in PEB, add 100 × PMSF;
6, isopyknic pickling glass pearl with thalline is added;
7, vibrate EP pipe 10 × 30s in shaker mixer, puts 1min on ice after each vibration;
8, the centrifugal 10min of 12000rpm, Aspirate supernatant, in preserving, discards precipitation on ice;
9, with Coomassie Brilliant Blue detectable level (OD595), by consistent for sample concentration adjustment;
10, add 5 × SB95 DEG C and boil 5min
(2) Coomassie Brilliant Blue detects protein concentration
1, the preparation of standard protein solution: weigh BSA solid 10mg and be dissolved in the water of 1mL, the solution obtaining 10mg/mL stores liquid as standard.With the standard protein solution of standard storage liquid preparation serial dilution, its concentration is respectively 1.2mg/ml, 1.0mg/ml, 0.8mg/ml, 0.6mg/ml, 0.4mg/ml, 0.2mg/ml, 0.1mg/ml.
2, the preparation of testing protein solution: testing sample is diluted to concentration between 0.1mg/ml-1.2mg/ml.(rule of thumb diluting 15 times)
3,4 μ l dye liquor+200 μ l protein solutions, mixing, leaves standstill 3min.According to " protein " program determination protein concentration of nucleic acid-protein analyser.
In this experiment, the protein concentration recorded is 14.6ug/ul.It is 0.0584mg/ml that conversion can obtain protein concentration, and namely every mL fermented liquid obtains 0.0584mg albumen.
Albumen is diluted for 8ug/ul, for subsequent experimental.
(3) SDS-PAGE
1. device assembling
Attention: (1) sheet glass, string rubber, comb, clean and dry
(2) good seal is wanted, preventing from cementing leakage
2. glue
Attention: (1) encapsulating is wanted rapidly
(2) perfusion of separation gel is about 2cm apart from short sheet glass top
(3) note whether having bubble
(4) add pellicular water at glue interface, concordant separation gel face, 15-30min polymerization is intact
3. protein sample preparation
Protein sample+SampleBuffer, boiling water bath boils 5min, cooled on ice 5min.
4, loading, must put pre-dyed Marker, electrophoresis.
Concentrated glue 80V, separation gel 100V.
(4) transfer printing (pickling process)
1, filled with water in ice chest, freezes reality
2, transfering buffering liquid is cooled to 4 DEG C
3, in shallow pallet, transfering buffering liquid is poured into
4, by the pvdf membrane equal with glue size, good with Pencil marks, in methyl alcohol, soak about 3min, transfer to transfering buffering liquid and soak balance, until there is no bubble
5, the Whatmman filter paper that 4 conform to glue size is placed in transfering buffering liquid fully soak
6, absorbent wool is fully soaked in transfering buffering liquid
7, after electrophoresis, bring gloves, it washs by glue rapidly that cut useful part in transfering buffering liquid
8, open turn trough offset plate, put into successively: soak absorbent wool-2 layer Whatmman filter paper-glue-pvdf membrane--2 layers of Whatmman filter paper-soak absorbent wool, note not having bubble.
9, carefully close the offset plate of transfer groove, puts into transfer groove immediately, notes cathode and anode directions
10, in transfer groove, add bar magnet, pour transfering buffering liquid into, make its submergence transfer blanket, transfer groove is placed on magnetic stirring apparatus, put into cooling ice chest
11, electrode insertion, notes reexamining cathode and anode directions, opens switch, electrophoretic blotting 100V1h
12, after transfer terminates, deenergization also pulls up plug on groove, and each layer of dismounting transfer, takes out pvdf membrane from top to bottom.
(5) close
Add confining liquid to close, shake 1h-4h gently with shaking table
(6) primary antibodie is added
1, confining liquid is fallen in transfer gently
2, add primary antibodie hybridization solution, room temperature 2h or 4 DEG C spends the night
(7) add two to resist
1, primary antibodie hybridization solution (reusable) is fallen in transfer gently, washes 3 times, each 10min with TBST
2, two anti-hybridization solutions are added, room temperature jog 2h
3, film is washed 3 times, each 10min with TBST
(8) react
1, get 100ul substrate solution 1 respectively with different tip heads and 100ul substrate solution 2 mixes in 1.5ml pipe, then this 200ul mixed solution is turned and drip on preservative film.By washed film, allow the washing lotion that its drip-dry is unnecessary, be covered on chromogenic substrate, reaction 5min.
2, the substrate free flow on film is sopped up with filter paper.
(9) operate under exposure imaging---half-light
1, the preservative film of film by suitable size is wrapped, press X-ray, exposure, timing;
2, by developing solution, stop bath is poured in shallow pallet respectively
3, take out X-ray, put into developing solution 5min
4, tap water rinses rapidly
5, stop bath 5min is put into immediately
6, a large amount of tap water
7, hang airing
After development, compare according to albumen MARKER, what Gal-pHAC181-MrCrustin target protein expression (22KD) detected is then the yeast saccharomyces cerevisiae MrCrustin immune protein engineering strain successfully built.
Although the present invention with preferred embodiment openly as above; but it is also not used to limit the present invention, any person skilled in the art, without departing from the spirit and scope of the present invention; all can do various changes and modification, what therefore protection scope of the present invention should define with claims is as the criterion.
Claims (9)
1. the saccharomyces cerevisiae engineered yeast of a high expression Macrobrachium rosenbergii chitin, it is characterized in that, the construction process of described engineering bacteria is cloned into by the cDNA of Macrobrachium rosenbergii chitin MrCrustin on expression plasmid pHAC181 to obtain the correct recombinant plasmid pHAC181-MrCrustin of sequence verification, then design homologous recombination primer, utilize homologous recombination technique goal gene MrCrustin to be integrated into the GAL1 promotor downstream of Saccharomyces cerevisiae host bacterial strain.
2. saccharomyces cerevisiae engineered yeast according to claim 1, is characterized in that, the aminoacid sequence after the CDS region translation of the cDNA of described MrCrustin is as shown in SEQIDNO.2.
3. saccharomyces cerevisiae engineered yeast according to claim 1, is characterized in that, the nucleotide sequence in the CDS region of the cDNA of described MrCrustin is as shown in SEQIDNO.1.
4. saccharomyces cerevisiae engineered yeast according to claim 1, is characterized in that, described pHAC181 inserts 3 histidine-taggedly to obtain in SphI and the EcoRV site of YCplac181.
5. saccharomyces cerevisiae engineered yeast according to claim 1, it is characterized in that, described saccharomyces cerevisiae engineered yeast builds as follows and obtains: (1) for template PCR amplifications or directly chemosynthesis, obtains the MrCrustin gene fragment of nucleotide sequence as shown in SEQIDNO.1 with the cDNA of Macrobrachium rosenbergii; (2) by MrCrustin gene fragment clone on expression plasmid pHAC181, obtain recombinant expression plasmid pHAC181-MrCrustin; (3) homologous recombination primer is designed, plasmid pHAC181-MrCrustin is increased, obtain the nucleotide fragments containing MrCrustin gene, use the method for homologous recombination, this nucleotide fragments is integrated into GAL1 promotor downstream in Wine brewing yeast strain.
6. a method of high expression Macrobrachium rosenbergii chitin MrCrustin, is characterized in that, described method uses right to want the arbitrary described saccharomyces cerevisiae engineered yeast of 1-5 for producing bacterial strain.
7. method according to claim 6, is characterized in that, described method, after being activated by saccharomyces cerevisiae engineered yeast, is inoculated in YPG substratum, under the induction of semi-lactosi, cultivates 6h; Described YPG substratum contains D-semi-lactosi 20g/L, peptone 20g/L, yeast extract 10g/L.
8. the arbitrary described saccharomyces cerevisiae engineered yeast of claim 1-5 produces the Macrobrachium rosenbergii chitin MrCrustin obtained.
9. the application of the arbitrary described saccharomyces cerevisiae engineered yeast of claim 1-5 in aquaculture, aquatic animal immunity or additive.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510908140.3A CN105296374A (en) | 2015-12-10 | 2015-12-10 | Saccharomyces cerevisiae engineered strain for efficiently expressing macrobrachium rosenbergii Crustin (MrCrustin) |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510908140.3A CN105296374A (en) | 2015-12-10 | 2015-12-10 | Saccharomyces cerevisiae engineered strain for efficiently expressing macrobrachium rosenbergii Crustin (MrCrustin) |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105296374A true CN105296374A (en) | 2016-02-03 |
Family
ID=55194210
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510908140.3A Pending CN105296374A (en) | 2015-12-10 | 2015-12-10 | Saccharomyces cerevisiae engineered strain for efficiently expressing macrobrachium rosenbergii Crustin (MrCrustin) |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105296374A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101886081A (en) * | 2010-06-04 | 2010-11-17 | 山东大学 | Procambarus clarkia chitin peptide gene and encoded chitin peptide and application thereof |
| CN102816815A (en) * | 2012-03-30 | 2012-12-12 | 浙江海洋学院 | Yeast fermentation production method of recombinant antibacterial peptide rCrustinI |
-
2015
- 2015-12-10 CN CN201510908140.3A patent/CN105296374A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101886081A (en) * | 2010-06-04 | 2010-11-17 | 山东大学 | Procambarus clarkia chitin peptide gene and encoded chitin peptide and application thereof |
| CN102816815A (en) * | 2012-03-30 | 2012-12-12 | 浙江海洋学院 | Yeast fermentation production method of recombinant antibacterial peptide rCrustinI |
Non-Patent Citations (5)
| Title |
|---|
| AROCKIARAJ,J. ET AL.: "GenBank: JQ413342.1", 《NCBI》 * |
| JESU AROCKIARAJ ET AL.: "Crustin, a WAP domain containing antimicrobial peptide from freshwater prawn Macrobrachium rosenbergii: Immune characterization", 《FISH & SHELLFISH IMMUNOLOGY》 * |
| JIQUAN ZHANG ET AL.: "Expression, purification, and characterization of recombinant Chinese shrimp crustin-like protein (CruFc) in Pichia pastoris", 《BIOTECHNOL LETT》 * |
| L. JIANG ET AL.: "Analyses of the effects of Rck2p mutants on Pbs2pDD-induced toxicity in Saccharomyces cervisiae identify a MAP kinase docking motif, and unexpected functional inactivation due to acidic substitution of T379", 《MOL GEN GENOMICS》 * |
| 周欢敏主编: "《动物细胞工程学》", 31 May 2009, 中国农业出版社 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101736062B (en) | Method for preparing recombinant porcine alpha interferon standard substance | |
| CN106957805B (en) | Bacillus GBacilus-9 strain with bacteriostatic effect and separation method and application thereof | |
| CN104988077B (en) | A kind of production high temperature fiber element enzyme and the fine penicillium of zytase and application | |
| CN103555754B (en) | A kind of lactobacterium casei bacterium shadow and its preparation method and application | |
| CN107828806A (en) | A kind of β alpha-glucosidase genes of new resistance to glucose and its application | |
| CN103013960A (en) | Alkaline protease and recombinant expression engineering bacterium thereof | |
| CN102260656A (en) | Recombinant aspergillus niger tannase and expression and purification method thereof | |
| CN105296372A (en) | Engineered strain of saccharomyces cerevisiae capable of efficiently expressing macrobrachium rosenbergii lectin (Mr Lectin) | |
| CN103966297A (en) | Fermentation process for producing antibacterial peptides from bacillus subtilis | |
| CN105296373A (en) | Engineered saccharomyces cerevisiae capable of efficiently expressing Chinese mitten crab chitin | |
| CN107418909A (en) | One plant of marine source bacillus licheniformis is used for the biological reinforced method of vinegar | |
| CN105200078A (en) | Aspergillus niger gene knockout method | |
| CN102242092A (en) | Isolation and identification for bombyx mori intestinal tract probiotics, and cloning and expression of enzyme gene produced by bombyx mori probiotics | |
| CN102382808A (en) | Preparation method of renninum | |
| CN108192903A (en) | A kind of alkalescent xylanase and its encoding gene and application | |
| CN104560833B (en) | A kind of basophilic micrococcus luteus and its alkalescent xylanase and the application of generation | |
| CN105274014A (en) | Engineering bacterium of saccharomyces cerevisiae for efficiently expressing superoxide dismutase of macrobrachium rosenbergii | |
| CN105255749A (en) | Engineered strain of saccharomyces cerevisiae capable of efficiently expressing macrobrachium rosenbergii pattern recognition protein LGBP | |
| CN105255750A (en) | Engineered strain of saccharomyces cerevisiae capable of efficiently expressing eriocheir sinensis anti-lipopolysaccharide factor | |
| CN105296374A (en) | Saccharomyces cerevisiae engineered strain for efficiently expressing macrobrachium rosenbergii Crustin (MrCrustin) | |
| CN103031289A (en) | Lactase and recombinant expression engineering bacterium thereof | |
| CN103184197B (en) | Sorbose dehydrogenase and sorbosone dehydrogenase, and applications thereof | |
| CN103352045B (en) | Arylsulfatase and preparation method and applications thereof | |
| CN103966110A (en) | Penicillium oxalicum host strain for enhancing expression of filamentous fungi protein | |
| CN107488221A (en) | The expansion fibroin and its gene of originated from fungus and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160203 |