CN114672426A

CN114672426A - Saccharomyces cerevisiae engineering bacterium, construction method and application thereof

Info

Publication number: CN114672426A
Application number: CN202210419586.XA
Authority: CN
Inventors: 杜婕; 李志刚; 颜子豪; 王煜轩; 徐可馨; 沈晓露; 刘云
Original assignee: Jiangsu Polytechnic College of Agriculture and Forestry
Current assignee: Jiangsu Polytechnic College of Agriculture and Forestry
Priority date: 2022-04-21
Filing date: 2022-04-21
Publication date: 2022-06-28
Anticipated expiration: 2042-04-21
Also published as: CN114672426B

Abstract

The invention discloses a saccharomyces cerevisiae engineering bacterium, a construction method and application thereof. The saccharomyces cerevisiae engineering bacteria are specifically obtained by cloning a gene segment MrLectin shown in SEQ ID NO.1 into an expression vector to obtain a recombinant expression vector, and integrating the recombinant expression vector with a saccharomyces cerevisiae strain. The saccharomyces cerevisiae is adopted for eukaryotic expression of the target protein, so that the generation of inclusion bodies is greatly reduced, the active expression of the protein is realized, and meanwhile, the saccharomyces cerevisiae which is used as a common probiotic for aquaculture is adopted, so that the active protein expression strain is more easily applied to the field of aquaculture, and has important significance for improving the organism immunity of shrimps and crabs, and further promoting the green, healthy and stable development of aquaculture.

Description

Saccharomyces cerevisiae engineering bacterium, construction method and application thereof

Technical Field

The invention relates to the field of biotechnology and aquaculture, in particular to saccharomyces cerevisiae engineering bacteria, a construction method and application thereof.

Background

The aquaculture industry is prominent in the world economic system as an indispensable food and economic source for human beings. China is a big country for aquaculture, the aquatic product has become the growing point of agricultural economy in China, and crustaceans are the largest group of aquatic animals. In recent years, crustacean diseases become more serious, and huge economic losses are brought to the aquaculture industry in China.

Crustaceans lack the acquired specific immune function, but they have a well-established innate immune system that rapidly recognizes and effectively eliminates invading microorganisms. The innate immunity of crustaceans mainly includes cellular immunity and humoral immunity. The cellular immune response is mediated by blood cells, and mainly comprises phagocytosis, nodule formation, coating and the like. The humoral immune response mainly depends on hemolymph, and agglutination reaction, blackening reaction caused by activation of prophenoloxidase, and antibacterial peptide production are generated. The effective recognition of pathogens by organisms is the first step of starting innate immune response, and for invertebrates, the distinction between self and non-self substances is mainly completed by Pattern Recognition Receptors (PRRs), which can recognize specific and conserved pathogen-associated molecular patterns (PAMPs) on the surfaces of pathogens such as foreign microorganisms, while lectin is a pattern recognition receptor having a pathogen recognition function and a specific glycosyl determinant receptor on the surface, which can distinguish isohexides according to the glycosyl composition on the surface of the foreign objects, promote phagocytosis of foreign objects by phagocytes in organisms, and induce organisms to generate effective immune defense response.

Currently, for the research of crustacean immune protein, a mode of E.coli prokaryotic expression of target protein is mostly adopted, protein inclusion bodies are easy to appear in the mode to cause activity reduction, and Saccharomyces cerevisiae (Saccharomyces cerevisiae) is a relatively excellent eukaryotic gene expression system, and a protein product of the Saccharomyces cerevisiae has relatively good expression activity and solubility and is widely applied to biological production. However, there are few reports on the expression of macrobrachium rosenbergii lectin genes in saccharomyces cerevisiae. And as food-grade safe saccharomyces cerevisiae, the saccharomyces cerevisiae has an obvious effect in aquaculture. The saccharomycetes can provide nutrition for aquaculture animals such as shrimps, crabs and the like, promote the absorption of nutrient substances, inhibit pathogenic bacteria and adjust the intestinal microecological balance, and can also be used for adjusting the aquaculture water quality. Therefore, how to realize the yeast activity expression of the crustacean-derived Lectin, and how to use the engineering strain as a feed immunization microbial inoculum for aquaculture and effectively improve the growth and immunity of shrimp organisms is a problem to be solved at present.

Disclosure of Invention

The purpose of the invention is as follows: aiming at the problems, the invention constructs the saccharomyces cerevisiae engineering bacteria to perform active expression on the important pattern recognition receptor-Lectin of the Macrobrachium rosenbergii (Macrobrachium rosenbergii). The invention also provides a construction method and application of the saccharomyces cerevisiae engineering bacteria, the recombinant protein strain is used as a feed immune microbial inoculum to be fed to the macrobrachium rosenbergii, and growth indexes and immune index determination and pathogenic bacterium infection experiments prove that the recombinant protein strain effectively promotes the growth of shrimp organisms and improves immunity.

The technical scheme is as follows: the saccharomyces cerevisiae engineering bacteria provided by the invention clone the gene segment MrLectin shown in SEQ ID NO.1 into an expression vector to obtain a recombinant expression vector, and integrate the recombinant expression vector with a saccharomyces cerevisiae strain to obtain the saccharomyces cerevisiae engineering bacteria.

The invention adopts food-grade safe organisms, namely saccharomyces cerevisiae to perform eukaryotic expression of target protein, greatly reduces the generation of inclusion bodies, realizes the active expression of the protein, simultaneously, the saccharomyces cerevisiae which is a common probiotic for aquaculture is used, and the active protein expression strain is more easily applied to the field of aquaculture, and has important significance for improving the organism immunity of shrimps and crabs, thereby promoting the green, healthy and stable development of aquaculture.

In a preferred embodiment of the present invention, the expression vector is pHAC 181.

As a preferred embodiment of the present invention, the recombinant expression vector is integrated into the Saccharomyces cerevisiae strain downstream of the GAL1 promoter.

The invention constructs a saccharomyces cerevisiae engineering bacterium for expressing macrobrachium rosenbergii agglutinin by expressing a macrobrachium rosenbergii agglutinin (Lectin) gene through a saccharomyces cerevisiae eukaryotic expression system. The cDNA CDS region of the macrobrachium rosenbergii super agglutinin MrLectin is cloned to an expression plasmid pHAC181 to obtain a recombinant plasmid pHAC181-MrLectin with correct sequencing, then a homologous recombination primer is designed, and a target gene MrLectin is integrated to the downstream of a GAL1 promoter of a saccharomyces cerevisiae host strain by utilizing a homologous recombination technology. The engineering strain can actively express a large amount of target protein MrLectin under the induction of galactose.

The construction method of the saccharomyces cerevisiae engineering bacteria comprises the following steps:

(1) cloning the MrLectin gene segment shown as SEQ ID NO.1 to an expression plasmid pHAC181 to obtain a recombinant expression plasmid pHAC 181-MrLectin;

(2) and amplifying the plasmid pHAC181-MrLectin to obtain a nucleotide fragment containing the MrLectin gene, and integrating the nucleotide fragment into the downstream of the GAL1 promoter in the saccharomyces cerevisiae strain through homologous recombination.

As a preferred embodiment of the present invention, in step (2), the amplification primers are shown as SEQ ID NO.2 and SEQ ID NO. 3.

The invention also provides a recombinant plasmid containing the gene segment shown in SEQ ID NO. 1.

The invention further provides a method for expressing the protein by the saccharomyces cerevisiae engineering bacteria, which comprises the following steps: inoculating the single bacterial colony of the saccharomyces cerevisiae engineering bacteria into an SD-LEU culture medium for overnight culture, transferring the culture into an YPG culture medium the next day, and extracting bacterial strain proteins after galactose induction culture.

The invention further provides a feed containing the saccharomyces cerevisiae engineering bacteria.

In a preferred embodiment of the invention, the addition amount of the saccharomyces cerevisiae engineering bacteria in the feed is 0.2-0.5%. In a preferred embodiment of the invention, the addition amount of the saccharomyces cerevisiae engineering bacteria in the feed is 0.3%.

The invention further provides application of the saccharomyces cerevisiae engineering bacteria in a feed immune microbial agent.

The feed immune microbial inoculum can be used for improving the immunity of shrimps.

In the present invention, "%" is a mass percentage unless otherwise specified.

Has the advantages that: (1) the saccharomyces cerevisiae engineering bacteria constructed by the invention can realize the mass expression of macrobrachium rosenbergii agglutinin MrLectin and the activity expression without inclusion bodies; the MrLectin obtained by fermenting the engineering bacteria has activity, and 0.064mg of protein can be obtained in each mL of fermentation liquor after 6 hours of induced culture. (2) The constructed saccharomyces cerevisiae engineering strain MrLectin realizes the mass expression of the Macrobrachium rosenbergii agglutinin MrLectin, the engineering strain is cultured in mass, concentrated and compounded into a pellet feed, and is infected by pathogenic bacteria after being fed, so that the engineering strain is found to be capable of effectively reducing the death rate of the infection of the aeromonas hydrophila, and the death rate is reduced by 25.16 percent compared with other groups, and the organism immunity index enzyme activity (SOD, CAT, ACP, AKP) and the expression quantity of immunity genes (SOD, CAT, ACP, AKP, Lectin) of the Macrobrachium rosenbergii in the feed pellet group compounded with the saccharomyces cerevisiae engineering strain are obviously higher than those of other groups. (3) The constructed saccharomyces cerevisiae engineering strain MrLectin effectively promotes the immunity of shrimp organisms, the research and development of a novel feed protein source and an immune feed probiotic at present become key technologies for promoting the healthy development of modern aquaculture industry, and the saccharomyces cerevisiae engineering strain not only can further research the protein function of important immune genes of crustaceans, but also can provide scientific basis and a novel method for developing a healthy and safe novel immune feed probiotic.

Drawings

FIG. 1 is a schematic diagram of construction of engineered strains of Saccharomyces cerevisiae.

FIG. 2 shows the amplified band (990bp) of Macrobrachium rosenbergii agglutinin MrLectin cDNA.

FIG. 3 shows the colony PCR verification of positive transformants when the Macrobrachium rosenbergii lectin MrLectin cDNA was cloned onto the vector pHAC 181; wherein, Line 21 in the a picture is the correct transformant;

lines

2,6, 7 in panel b are the correct transformants.

FIG. 4 shows the restriction enzyme digestion verification of positive transformants when the Macrobrachium rosenbergii lectin MrLectin cDNA is cloned onto the vector pHAC181, wherein the

lines

10, 12, 13, 14, 15 and 16 in the figure are correct transformants;

FIG. 5 shows the amplification of recombinant plasmid pHAC181-MrLectin (5348bp) by the high fidelity enzyme PrimeSTAR GXL enzyme.

FIG. 6 shows that detection primers detect homologous recombination of pHAC181-MrLectin and a strain containing a GAL1 promoter, and a band with successful homologous recombination is 1276 bp; wherein, Line2 in the a picture is the correct transformant;

lines

7, 9 in panel b are the correct transformants.

FIG. 7 shows that the expression of the protein Gal-pHAC181-MrLectin is detected by Western blot, and the target protein is 42 KD.

FIG. 8 shows the experiment of pathogenic bacteria (aeromonas hydrophila) infection and the statistics of mortality rate of macrobrachium rosenbergii fed with different feeds for one month, and the PBS is an injection control group, and the result shows that the mortality rate of macrobrachium rosenbergii fed with the granulated feed compounded with the saccharomyces cerevisiae-MrLectin strain is the lowest in the vibrio parahaemolyticus infection group.

FIG. 9 is a graph of the relative immunoenzyme activity changes in the hepatopancreas of Macrobrachium rosenbergii at 0,2,6,12,24 and 36 hours after Aeromonas hydrophila injection with PBS as control; wherein, A picture is AKP enzyme activity change result picture; b is ACP enzyme activity change result diagram; c is the result chart of SOD enzyme activity variation; d is a result graph of CAT enzyme activity change; bar values in the figure represent the average of six determinations with standard error, asterisks indicate significant differences (. P <0.05,. P < 0.01).

FIG. 10 shows RT-PCR detection of the immune gene expression level in the hepatopancreas of Macrobrachium rosenbergii after 0,2,6,12,24 and 36 hours of Vibrio parahaemolyticus infection, with β -actin as an internal reference gene; wherein, A picture is expression quantity of Lectin gene; b is AKP gene expression level; FIG. C shows ACP gene expression levels; d is SOD gene expression level; e picture is CAT gene expression level; bar values represent the average of six determinations with standard error, asterisks indicate significant differences (. P <0.05,. P < 0.01).

Detailed Description

Composition of LA medium: 10g/L peptone, 5g/L, NaCl 10g/L yeast extract, and 12g/L agar, adjusting pH to 7.0, and 100mg/mL Amp antibiotic (120 ℃, 20 min).

Composition of SD-Leu Medium: it contains 1.7g/L yeast nitrogen source (without AA), 5g/L ammonium sulfate, 20g/L glucose, 100mL 10xAA mix (-ura, -leu, -his), 10mL 100xUra, 10mL 100xHis, and 20g/L agar (120 ℃, 20 min).

Composition of YPG medium: 20g/L of D-galactose, 20g/L of peptone and 10g/L of yeast extract (115 ℃, 20 min).

Example 1: construction of Saccharomyces cerevisiae genetically engineered bacteria (Gene cloning and homologous recombination)

The construction of high expression plasmid pHAC181-MrLectin includes extracting Macrobrachium rosenbergii tissue RNA with Trizol method, and reverse transcription of RNA into cDNA with reverse transcription kit (fig. 2).

PCR amplification is carried out on the target gene segment MrLectin by using high fidelity enzyme, and the amplified CDS region (not containing a stop codon) of the MrLectin gene segment is 990bp in total, as shown in SEQ ID NO. 1. Then, the fragment shown in SEQ ID NO.1 was cloned into the multiple cloning site of the high expression plasmid pHAC181 (FIG. 1), the ligation vector was transferred into E.coli competent cells transT1, and plated on LA plates for overnight culture at 37 ℃. And (3) carrying out colony PCR and enzyme digestion verification on the positive transformant obtained on the LA plate to verify the positive transformant (shown in figure 3 and figure 4), selecting a correct recon to carry out DNA sequencing, and verifying that the sequence is not mutated to obtain the recombinant high expression plasmid pHAC 181-MrLectin.

Designing homologous recombinant primers (shown as SEQ ID NO.2 and SEQ ID NO. 3) according to the constructed recombinant high-expression plasmid pHAC181-MrLectin, amplifying the plasmid pHAC181-MrLectin by using high-fidelity PrimeSTAR GXL enzyme, wherein the successfully amplified long fragment is 5348bp (figure 5), and integrating the successfully amplified long fragment into the downstream of a GAL1 promoter in a saccharomyces cerevisiae strain (figure 1) to obtain the Gal-pHAC181-MrLectin engineering strain.

F1：caaatgtaataaaagtatcaacaaaaaattgttaatatacctctatactttaacgtcaaggagaaaaaacccggatctcaaaatgtggcattcaaggggc(SEQ ID NO.2)；

R1：tatggacgaggtaataaggaaactcagaaccagaatagtggcatgagctctccaatttaacatatttgccattagtgacccgatgataagctgtcaaacatg(SEQ ID NO.3)；

The specific steps of gene homologous recombination (integration) are as follows:

1. activated GAL1-ScRCH1 strain was picked as a single colony, inoculated into 3mL YPD medium, and cultured overnight at 30 ℃ and 220 rpm.

2. Inoculating 300uL of the overnight culture into 4.7mL of 2 XPYDD, and culturing at 30 ℃ for 4-5 h (to OD600 of 0.6-1.0);

3. 5mL of the bacterial solution is divided into 3 tubes, centrifuged at 4000rpm for 1min at room temperature, the supernatant is discarded, then resuspended in 1mL of water and merged into 1 EP tube, centrifuged at 3000rpm for 1min, and the supernatant is discarded.

4. 100uL of 0.1M LiAc solution was added, mixed by pipetting, centrifuged at 12000rpm for 10s, and the supernatant was discarded.

5. And (4) repeating the step.

6. The following were added in sequence, gently mixed after addition:

7. mixing, and incubating in 30 deg.C water bath for 30 min;

incubation in a water bath at 9.42 ℃ for 30min (heat shock);

and (3) centrifuging at 10.3000 rpm to remove supernatant, re-suspending the thalli with 1mL of sterile water, centrifuging at 3000rpm for 1min, discarding supernatant, reserving 100ul of bacterial liquid, paving the bacterial liquid on a selective plate (SD-LEU), and culturing at 30 ℃ for 3-5 days.

11. The grown transformants were streaked out on SD-LEU plates. Inoculating the single colony in a YPD culture medium for overnight culture, extracting a transformant genome, carrying out PCR detection by using detection primers DF and DR, and obtaining a transformant amplified by a target fragment, namely the strain Gal1-pHAC181-MrLectin with successful homologous recombination.

The detection primers for homologous recombination are DF and DR, and the sequences are shown as follows:

DF:cctggccccacaaaccttc(SEQ ID NO.4)；

DR:taggttgtatctgctgacc(SEQ ID NO.5)；

colony PCR detection is carried out on the positive transformant after homologous recombination by using detection primers (shown as SEQ ID NO.4 and SEQ ID NO. 5), and the successfully amplified target band (1276bp) is the successfully homologous recombination plasmid (figure 6).

A colony PCR preparation system and steps:

the system is mixed evenly and centrifuged for a short time to lead the solution to gather at the bottom of the tube, and the PCR reaction procedure adopts: pre-denaturation at 95 deg.C for 30s, denaturation at 95 deg.C for 5s, annealing at 60 deg.C, extension at 72 deg.C for 30s, and storing at 72 deg.C for 10min and 4 deg.C for 40 cycles.

Example 2: protein expression of engineering strain and Western blot detection

The GaL1-pHAC181-MrLectin strain single colony successfully recombined in the homologous way is inoculated in 5mL of SD-LEU culture medium for overnight culture, the culture is transferred into 45mLYPG culture medium the next day, and after galactose induction culture is carried out for 6h (OD detection is 1.2-1.5), the strain protein is extracted. The extracted protein is used for Western blot detection.

The method comprises the following specific steps:

(I) extraction of Total protein from cells

1. Picking single colony to be cultured in required liquid culture medium (SD-LEU culture medium) overnight at 30 ℃ until saturation;

2. 5mL of overnight-cultured broth was added to 45mL of fresh liquid medium (YPG medium) and cultured with shaking at 30 ℃ for about 6 hours (OD ═ 1.2 to 1.5) (rotation speed 220rmp) in a shaker;

3. collecting thallus at 8000rpm/1min, and removing the upper liquid;

4. resuspending the cells with pre-cooled double distilled water, and centrifuging to remove the supernatant;

5. adding PEB (protein Extraction buffer) which is equal to the thallus and is precooled, and adding 100 XPMSF into the PEB;

6. adding acid-washed glass beads with the same volume as the thalli;

7. oscillating the EP tube for 10 × 30s on an oscillating mixer, and putting on ice for 1min after each oscillation;

8. centrifuging at 12000rpm for 10min, sucking supernatant, storing on ice, and discarding precipitate;

9. concentration (OD) detection by Coomassie Brilliant blue₅₉₅) Adjusting the concentration of the sample to be consistent;

10. adding 5 XSB, decocting at 95 deg.C for 5 min.

Detection of protein concentration by Coomassie brilliant blue method

1. Preparation of standard protein solution: 10mg of BSA solid was weighed and dissolved in 1mL of water to obtain a 10mg/mL solution as a standard stock solution. Serial dilutions of the standard protein solutions were prepared using standard stock solutions at concentrations of 1.2mg/mL, 1.0mg/mL, 0.8mg/mL, 0.6mg/mL, 0.4mg/mL, 0.2mg/mL, and 0.1mg/mL, respectively.

2. Preparing a protein solution to be detected: the sample to be tested is diluted to a concentration of between 0.1mg/mL and 1.2 mg/mL.

3. 4 mul of dye solution +200 mul of protein solution, mixing evenly and standing for 3 min. Protein concentrations were determined according to the "protein" program of the nucleic acid protein analyzer.

In the experiment, the concentration of the MrLectin protein expressed by the saccharomyces cerevisiae is measured to be 16 ug/uL. The protein concentration is 0.064mg/mL by conversion, namely 0.064mg of protein is obtained per mL of fermentation liquor.

(III) SDS-PAGE

1. Assembling the device; 2. preparing glue; 3. preparing a protein sample; 4. and (4) loading, pre-staining a Marker in a spot manner, and carrying out electrophoresis. 80V of concentrated gel and 100V of separation gel.

(IV) transfer printing (dipping method).

And (V) sealing, namely adding sealing liquid for sealing, and slightly shaking for 1-4 h by using a shaking table.

Sixthly, adding primary antibody 1, and slightly transferring the confining liquid; 2. adding primary antibody hybridization solution, and standing at room temperature for 2h or 4 ℃ overnight.

Adding a secondary antibody 1, gently transferring a primary antibody hybridization solution (which can be repeatedly used), and washing with TBST for 3 times, wherein each time lasts for 10 min; 2. adding a second antibody hybridization solution, and gently shaking at room temperature for 2 h; 3. the membrane was washed 3 times 10min each with TBST.

(eight) reacting.

(nine) Exposure development-operation in dark light

After the development, according to the comparison of a protein Marker, Gal1-pHAC181-MrLectin target protein expression is detected, the molecular weight is 42KD (shown as SEQ ID NO. 6), and the strains are the saccharomyces cerevisiae MrLectin immune protein engineering strains which are successfully constructed (figure 7).

Example 3: saccharomyces cerevisiae MrLectin engineering strain for effectively improving shrimp organism immunity

(1) Enlarging culture and concentration of yeast engineering strain

And carrying out laboratory amplification culture on the constructed saccharomyces cerevisiae MrLectin engineering strain. The engineering strain is cultured in 500mL triangular flask (YPG culture medium), then expanded to 1L, 3L and 5L, the cultured engineering strain is centrifuged and filtered, and the thallus is naturally dried at room temperature. And mixing the thalli after being dried in the shade with shrimp pellet feed, feeding the feed mixed with the yeast engineering strain to the macrobrachium rosenbergii after the thalli is dried in the air, setting a control group, and observing the influence of the feed containing the recombinant engineering strain and the common feed on the macrobrachium rosenbergii when the feeds are fed. The feeding period is one month.

(2) Macrobrachium rosenbergii organism pathogenic bacteria infection and mortality determination

300 macrobrachium rosenbergii with uniform size (about 20 g) are purchased from the local aquatic product market. Feeding different feeds to the feed in groups: experimental groups: the common shrimp pellet feed (Bada feed, Nantong) is compounded with a yeast MrLectin engineering strain (0.3 percent); control group one: the common shrimp pellet feed is compounded with an unloaded saccharomyces cerevisiae strain; control group two: common shrimp pellet feed. The feeding amount is 4% of the weight of the feed, and the feed is fed for 2 times every morning and evening for 4 weeks. 1 month later, 3.0 × 10 of Aeromonas hydrophila is used⁵cfu 50ul of shrimp bodies were infected by injection, while 50. mu.LPBS injection was set as a control group. The cumulative mortality is counted at 0,2,6,12,24 and 36h after the infection of the vibrio parahaemolyticus, and the results show that the death rate of the macrobrachium rosenbergii fed with saccharomyces cerevisiae MrLectin particles is lowest (the cumulative mortality value is 66.9%), the death rate of a common feed feeding group is highest, the death rate of the macrobrachium rosenbergii fed with saccharomyces cerevisiae MrLectin particles reaches 92.06% after 4 weeks, the death rate of a no-load feed group mixed with yeast in the feed is higher than that of a recombinant protein group smaller than that of a common feed group (figure 8), and the result shows that the recombinant yeast MrLectin engineering strain can effectively reduce the death rate after the infection of pathogenic bacteria.

(3) Macrobrachium rosenbergii hepatopancreas tissue immunoenzyme activity and immunogene expression amount determination

Taking hepatopancreas tissues for measuring immune indexes at 0,2,6,12,24 and 36h after the aeromonas hydrophila is infected, wherein the measurement of the activity of the immunoenzyme and the expression quantity change of the immunogene is included. Wherein the measured immunoenzyme activities comprise: alkaline phosphatase (AKP); acid phosphatase (ACP); superoxide dismutase (SOD) and Catalase (CAT).

The method comprises the following specific steps: and (3) placing about 0.1g of hepatopancreas into 1mL of 0.6% physiological saline for homogenization (ice operation), centrifuging 3500g of liver tissue samples for 10min at 4 ℃, and using supernate for determination of the activity of the immunoenzyme.

Determination of alkaline phosphatase (AKP):

the alkaline phosphatase decomposes disodium phenylphosphate to generate free phenol and phosphoric acid, the phenol reacts with 4-aminoantipyrine in alkaline solution to generate red quinone derivative through potassium ferricyanide oxidation, and the absorbance of the red quinone derivative is measured by a visible light spectrophotometer according to the red shade, so that the enzyme activity can be measured. The results show that: the AKP activity of macrobrachium rosenbergii fed to the s.cerevisiae MrLectin group increased from 2 hours after infection and reached a maximum of 75.33U/g at 12 hours, and the enzyme activity level was lower in the s.cerevisiae no-load feeding group than in the target protein group, similar to the normal pellet feeding group (shown in Panel A in FIG. 9).

Determination of acid phosphatase (ACP):

the acid phosphatase decomposes disodium phenyl phosphate to generate free phenol and phosphoric acid, the phenol reacts with 4-aminoantipyrine in alkaline solution to generate red quinone derivative through potassium ferricyanide oxidation, and the absorbance of the red quinone derivative is measured by a visible light spectrophotometer according to the red shade, so that the enzyme activity can be measured. The results show that: the ACP activity in 6h of the macrobrachium rosenbergii fed with the saccharomyces cerevisiae MrLectin group is obviously higher than that in the other two groups, and the highest ACP activity in 12h reaches 52.6U/g. The empty s.cerevisiae pellet feed and the normal pellet feed group showed similar results with ACP enzyme activity levels below the target protein group and no significant change during this period (shown in panel B of fig. 9).

Determination of superoxide dismutase (SOD):

production of superoxide anion radical (O) by xanthine and xanthine oxidase reaction systems^2-.) The latter oxidizes hydroxylamine to form nitrite, which appears purple red under the action of a color developing agent, and the absorbance of the nitrite is measured by a visible light spectrophotometer. When the tested sample contains SOD, it has specific inhibition action on superoxide anion free radical, so that the formed nitrite is reduced, and the light absorption value of the measuring tube is lower than that of the control tube in the colorimetric process, and the SOD activity in the tested sample can be obtained by means of calculation formula. The results show that: the SOD activity of the Saccharomyces cerevisiae MrLectin particle feeding group is obviously higher than that of two control groups at the beginning of 2h after the aeromonas hydrophila is attacked, and then reaches the highest value (30.3U/g, P) at 12 hours<0.05) (shown in C of fig. 9).

Determination of Catalase (CAT)

The experiment adopts a molybdate-ammonium colorimetric method to determine catalase, and the principle is that catalase catalyzes H₂O₂Decomposition to H₂O and O₂The enzymatic reaction being the remainderH₂O₂And forming a stable yellow compound with the ammonium molybdate, wherein the color intensity of the compound is inversely proportional to the enzyme activity, and performing colorimetric determination at 405nm to calculate the enzyme activity. The results show that: CAT activity was significantly increased at 2h and 12h post-infection in the group fed s.cerevisiae MrLectin, with 12h reaching a maximum of 11.56U/g, while enzyme activity levels observed in the groups fed s.cerevisiae empty pellets and general feed pellets were lower than those of the target protein group (FIG. 9, panel D).

The enzyme activity data show that after being impregnated by pathogenic bacteria aeromonas hydrophila, the macrobrachium rosenbergii fed in the group compounded with the yeast engineering bacteria MrLectin shows stronger immunological enzyme activity, which indicates that the body immunity of the macrobrachium rosenbergii in the group is higher than that of other two groups.

(4) RT-PCR detection of macrobrachium rosenbergii hepatopancreatic tissue immune gene expression quantity change

The influence of the saccharomyces cerevisiae MrLectin engineering strain on the expression quantity of the immune gene is detected by measuring the immune gene (Lectin, AKP, ACP, SOD, CAT) in the hepatopancreas tissue infected with the aeromonas hydrophila through real-time quantitative PCR (RT-PCR). The method comprises the following specific steps:

tissue lysis and total RNA extraction were performed according to Trizol reagent instructions.

(1) Adding 1mL of LTrizol into the collected shrimp body liver and pancreas tissue sample, fully and quickly grinding in a 2mL homogenizer, and standing for 5min at room temperature to fully crack the shrimp body liver and pancreas tissue sample. At this time, the sample can be stored at-70 ℃ for a long time. Centrifuge at 12,000g for 5min, collect the supernatant in a new centrifuge tube and discard the precipitate.

(2) Chloroform was added to 200. mu.L of chloroform/ml of trizol, and the mixture was shaken and mixed for 15 seconds, left at room temperature for 12min, and centrifuged at 4 ℃ at 12,000g for 15 min.

(3) The upper aqueous phase (about 500. mu.L and 600. mu.L) was pipetted into another centrifuge tube.

(4) 0.5ml of isopropanol/ml of Trizol is added into the isopropanol and mixed evenly, and the mixture is placed for 8min at room temperature.

(5) Centrifugation at 12,000g for 10min at 4 ℃ removed the supernatant, whereupon RNA settled to the bottom of the tube.

(6) Add 75% ethanol (DEPC treated) to 1mL of 75% ethanol/mL Trizol, gently shake the centrifuge tube and gently suspend the pellet.

(7) Centrifuge at 8,000g for 5min at 4 ℃ and discard the supernatant.

(8) Air drying at room temperature or vacuum drying for 5-10 min.

(9) Using 20-50 μ L DEPC-H₂And dissolving the RNA sample by using O, and fully dissolving the RNA at the temperature of 55-60 ℃ for 5-10 min.

Reverse transcription of cDNA

RT reaction solution was prepared according to the following composition (the reaction solution was prepared on ice).

The reverse transcription reaction conditions are 37 ℃ for 15min and 85 ℃ for 5 s.

Fluorescent quantitative RT-PCR detection of immune related genes

The fluorescent quantitative PCR was performed according to the instructions of the fluorescent quantitative PCR KIT SYBR Premix Ex TagTM KIT. The PCR reaction system is as follows:

the system is mixed evenly and centrifuged for a short time to lead the solution to gather at the bottom of the tube, and the RT-PCR reaction program adopts a two-step method: pre-denaturation at 95 ℃ for 30s, denaturation at 95 ℃ for 5s, annealing at 60 ℃ and extension for 30s, and 40 cycles. The concentration of the cDNA template is searched for from the plotted melting curve. Relative expression of genes employed 2^-ΔΔCtAnd (delta. Ct ═ (Ct target gene-Ct housekeeping gene) experimental group- (Ct target gene-Ct housekeeping gene) control), and before the CT method is used, the amplification efficiency of the target gene and the housekeeping gene is basically consistent. PBS stimulation group is used as blank control, actin beta-actin gene is used as reference gene, t-test is adopted for data analysis, and when P is detected<0.01 was judged as a significant difference.

The results show that: compared with the control group, the expression level of the immune gene of the macrobrachium rosenbergii is obviously increased at 6h, 12h and 24h, but reaches the maximum value (51folds, P <0.01) at 12h (graph A in figure 10). AKP gene expression reached a maximum value (15folds, P <0.01) at 24h (FIG. 10, panel B). ACP gene expression is obviously increased at 2h, expression level is increased to the maximum value at 24h (52folds, P is less than 0.01, but compared with two control groups, the gene expression level of a saccharomyces cerevisiae MrLectin feeding group is higher than that of two control feeding groups (C picture in figure 10), SOD gene expression level is up-regulated within 12h to 24h after the aeromonas hydrophila is infected (D picture in figure 10), CAT gene expression level is up-regulated at 6h to 12h and reaches the maximum peak value (33folds, P is less than 0.01) at 12h (E picture in figure 10), according to the research result, the macrobrachium rosenbergii in a pellet feed group which is fed with the saccharomyces cerevisiae MrLectin engineering strain has higher immune gene expression level in vivo and is obviously higher than that of a compound saccharomyces cerevisiae pellet feed group and a normal pellet feed group after the organism is infected by the aeromonas hydrophila, which indicates that the engineered strain of the saccharomyces cerevisiae effectively enhances the immune capability of the macrobrachium rosenbergii organism, when infected by pathogenic bacteria, the body can express more immune genes to participate in innate immunity. Therefore, the saccharomyces cerevisiae recombinant MrLectin strain is an immune strain with better potential, can improve the immunity level of crustacean organisms and increase the resistance to crustacean pathogen-aeromonas hydrophila.

Sequence listing

<110> Jiangsu academy of agriculture, forestry, and occupational technology

<120> saccharomyces cerevisiae engineering bacteria, construction method and application thereof

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 990

<212> DNA

<213> Macrobrachium rosenbergii Lectin gene sequence (Macrobrachium rosenbergii Lectin gene)

<400> 1

atgtggcatt caaggggctt catcctactt ttatgcgctg tgcagttgct gctgccctgt 60

tcagctgcga cctctgactg ggagctgcag atggattccc ctaaactgac atgcccagcc 120

ttctttcaaa atgttggcga tcagtgcctc ttctttagtt tcatggaacc tacagattac 180

aagtcagcga agcaattctg cggcggtcta caagcttcct tgatagttat caatagcact 240

actcagttcg aaaacatcat ccatttcatc tactcgcaag gatacgaatc ctccttctgg 300

gtcgacggtt ccgaccttaa gaatgaaggt gactggagag actcgcacaa caaagcagtc 360

gtcatgaata cccccttctg gttggcttct gagtcacact acaaacctaa caacgacact 420

gaggcaaact gcattgcact cgaaagcacg tacggtttct tcatgaacga cgtcgattgt 480

gaatccgacc acagcgctct ctgcgaatac cccgcgacag tcgaagagag cgttgacgaa 540

gaaaaggcga ctgttgaatg tcctgttttc tttgtggatg tcggtggcac ctgcctggcc 600

ttcgtcattt gggaagaagt tgtgtgggaa gaagccaata tcccctgtat cggcatcgaa 660

ggcgaactgg ctattttgga caacatacaa cagctcagag atatttatga gtacctgcat 720

gaccatgaaa tctatgaaca ttccttctgg atcggaggat cggacacggt aacagaaggg 780

gaatgggtct ggaatgataa cagtactgtt accatgggta gtccttggtg gggttttagc 840

gaatatgaaa cgggcaactg gacccaagag ccagacggta acgacgaaga gaactgcctt 900

gctctaacct cagaggggca tcattacctt agagacaaag actgttctga actactcagt 960

cctctctgca tggtcagcag atacaaccta 990

<210> 2

<211> 100

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

caaatgtaat aaaagtatca acaaaaaatt gttaatatac ctctatactt taacgtcaag 60

gagaaaaaac ccggatctca aaatgtggca ttcaaggggc 100

<210> 3

<211> 102

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tatggacgag gtaataagga aactcagaac cagaatagtg gcatgagctc tccaatttaa 60

catatttgcc attagtgacc cgatgataag ctgtcaaaca tg 102

<210> 4

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cctggcccca caaaccttc 19

<210> 5

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

taggttgtat ctgctgacc 19

<210> 6

<211> 330

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 6

Met Thr His Ser Ala Gly Pro Ile Leu Leu Leu Cys Ala Val Gly Leu

1 5 10 15

Leu Leu Pro Cys Ser Ala Ala Thr Ser Ala Thr Gly Leu Gly Met Ala

20 25 30

Ser Pro Leu Leu Thr Cys Pro Ala Pro Pro Gly Ala Val Gly Ala Gly

35 40 45

Cys Leu Pro Pro Ser Pro Met Gly Pro Thr Ala Thr Leu Ser Ala Leu

50 55 60

Gly Pro Cys Gly Gly Leu Gly Ala Ser Leu Ile Val Ile Ala Ser Thr

65 70 75 80

Thr Gly Pro Gly Ala Ile Ile His Pro Ile Thr Ser Gly Gly Thr Gly

85 90 95

Ser Ser Pro Thr Val Ala Gly Ser Ala Leu Leu Ala Gly Gly Ala Thr

100 105 110

Ala Ala Ser His Ala Leu Ala Val Val Met Ala Thr Pro Pro Thr Leu

115 120 125

Ala Ser Gly Ser His Thr Leu Pro Ala Ala Ala Thr Gly Ala Ala Cys

130 135 140

Ile Ala Leu Gly Ser Thr Thr Gly Pro Pro Met Ala Ala Val Ala Cys

145 150 155 160

Gly Ser Ala His Ser Ala Leu Cys Gly Thr Pro Ala Thr Val Gly Gly

165 170 175

Ser Val Ala Gly Gly Leu Ala Thr Val Gly Cys Pro Val Pro Pro Val

180 185 190

Ala Val Gly Gly Thr Cys Leu Ala Pro Val Ile Thr Gly Gly Val Val

195 200 205

Thr Gly Gly Ala Ala Ile Pro Cys Ile Gly Ile Gly Gly Gly Leu Ala

210 215 220

Ile Leu Ala Ala Ile Gly Gly Leu Ala Ala Ile Thr Gly Thr Leu His

225 230 235 240

Ala His Gly Ile Thr Gly His Ser Pro Thr Ile Gly Gly Ser Ala Thr

245 250 255

Val Thr Gly Gly Gly Thr Val Thr Ala Ala Ala Ser Thr Val Thr Met

260 265 270

Gly Ser Pro Thr Thr Gly Pro Ser Gly Thr Gly Thr Gly Ala Thr Thr

275 280 285

Gly Gly Pro Ala Gly Ala Ala Gly Gly Ala Cys Leu Ala Leu Thr Ser

290 295 300

Gly Gly His His Thr Leu Ala Ala Leu Ala Cys Ser Gly Leu Leu Ser

305 310 315 320

Pro Leu Cys Met Val Ser Ala Thr Ala Leu

325 330

Claims

1. The engineering strain of the saccharomyces cerevisiae is characterized in that a gene segment MrLectin shown as SEQ ID NO.1 is cloned into an expression vector to obtain a recombinant expression vector, and the recombinant expression vector is integrated with a saccharomyces cerevisiae strain to obtain the engineering strain of the saccharomyces cerevisiae.

2. The engineered saccharomyces cerevisiae strain of claim 1, wherein the expression vector is pHAC 181.

3. The engineered saccharomyces cerevisiae strain of claim 1, wherein the recombinant expression vector is integrated into the saccharomyces cerevisiae strain downstream of the GAL1 promoter.

4. The construction method of the saccharomyces cerevisiae engineering bacteria according to claim 1, characterized by comprising the following steps:

5. The construction method of the saccharomyces cerevisiae engineering bacteria according to claim 4, wherein in the step (2), the amplification primers are shown as SEQ ID NO.2 and SEQ ID NO. 3.

6. A recombinant plasmid is characterized in that the recombinant plasmid contains a gene segment shown as SEQ ID NO. 1.

7. The method for expressing protein by using the saccharomyces cerevisiae engineering bacteria as described in claim 1, which comprises the following steps: inoculating single colony of the engineered Saccharomyces cerevisiae strain of claim 1 into SD-LEU culture medium for overnight culture, transferring the culture to YPG culture medium the next day, inducing with galactose, and extracting strain protein.

8. A feed containing the engineered strain of Saccharomyces cerevisiae as claimed in claim 1.

9. The feed of claim 8, wherein the saccharomyces cerevisiae engineering bacteria are added into the feed in an amount of 0.2-0.5%.

10. The use of the engineered saccharomyces cerevisiae strain of claim 1 in feed immunization bacterial agents.