CN108771028A - A kind of animal feed additive and the preparation method and application thereof - Google Patents
A kind of animal feed additive and the preparation method and application thereof Download PDFInfo
- Publication number
- CN108771028A CN108771028A CN201810520754.8A CN201810520754A CN108771028A CN 108771028 A CN108771028 A CN 108771028A CN 201810520754 A CN201810520754 A CN 201810520754A CN 108771028 A CN108771028 A CN 108771028A
- Authority
- CN
- China
- Prior art keywords
- pht01
- bmap
- animal feed
- feed additive
- culture
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K50/00—Feeding-stuffs specially adapted for particular animals
- A23K50/60—Feeding-stuffs specially adapted for particular animals for weanlings
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K10/00—Animal feeding-stuffs
- A23K10/10—Animal feeding-stuffs obtained by microbiological or biochemical processes
- A23K10/16—Addition of microorganisms or extracts thereof, e.g. single-cell proteins, to feeding-stuff compositions
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K50/00—Feeding-stuffs specially adapted for particular animals
- A23K50/30—Feeding-stuffs specially adapted for particular animals for swines
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
- A61K38/10—Peptides having 12 to 20 amino acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/12—Antidiarrhoeals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4723—Cationic antimicrobial peptides, e.g. defensins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Polymers & Plastics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Medicinal Chemistry (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Veterinary Medicine (AREA)
- Animal Husbandry (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Food Science & Technology (AREA)
- Birds (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Gastroenterology & Hepatology (AREA)
- General Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Engineering & Computer Science (AREA)
- Toxicology (AREA)
- Physics & Mathematics (AREA)
- Physiology (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Plant Pathology (AREA)
- Immunology (AREA)
- Epidemiology (AREA)
- Fodder In General (AREA)
Abstract
The animal feed additive of the present invention, to express the bacillus subtilis lysate of cecropin B gene MAP-18, the present invention uses CRISPR/Cas9 technologies, it will be in the gene multi-copy integration to the genome of bacillus subtilis that BMAP-18 be expressed, it is built into the engineering bacteria that high yield stablizes expression, large-scale culture fermentation is carried out to the engineering bacteria later, will be added in animal feed after the thalline Direct Pyrolysis of the expression BMAP-18 of preparation, high temperature drying.The animal feed additive of the present invention, production cost is low, yield is high, engineering bacteria construction is good, and animal resistance can be effectively increased by making an addition in animal feed.
Description
Technical field
The invention belongs to life sciences, and in particular to a kind of animal feed additive and its method and application.
Background technology
For a long time, antibiotic achieves good effect as feed addictive applied to aquaculture.However, a large amount of
Basic research shows that antibiotic long-term a large amount of use in aquaculture causes serious drug resistance phenomenon and livestock products drug residual
It stays, greatly the threat mankind's is healthy and safe.Therefore, the developed countries such as European Union, which have completely forbidden, uses antibiosis in animal and fowl fodder
Element finds Substitutes For Antibiotic and becomes one of the important directions for current research.In all kinds of animals that aquaculture is related to, due to
Piglet immunological systematic growth is simultaneously not perfect, it is easy to and it infects harmful bacteria and influences its production performance, severe patient is even dead, because
Nutritional requirement is higher in the feed of this piglet.
Antibacterial peptide generally there is broad-spectrum antiseptic to live as a kind of micromolecule active polypeptide being widely present in nature biotechnology
Property, it is the potential substance of substitute antibiotics so being not likely to produce drug resistance because it uses the mechanism of physical antibacterial.But antibacterial
The synthesis and purifying of peptide face high cost, and traditional coli expression system is used to express, although cost is very low,
It is the problem for facing endotoxin and being difficult to remove, limits application of the antibacterial peptide in feed addictive.
Expressions of the antibacterial peptide CC34 in bacillus subtilis disclosed in Chinese patent literature CN105255935A,
The defect for solving coli expression system expression selects expression vector pHT43 structure weights by Protocols in Molecular Biology
Group expression vector, constructs recombinant expression carrier pHT43/CC34, recombinant expression carrier is transformed into bacillus subtilis
In WB800N, expression engineering bacteria pHT43/CC34/WB800N is obtained.The expression product of the engineering bacteria to gram-positive bacterium and
Gramnegative bacterium has antibacterial activity, can be applied to medicine, food, feed addictive and cultivation field.
Its bacillus subtilis used belongs to bacillus, is that a kind of aerobic, the leather of the degeneration-resistant spermatium of interior life are blue
Family name's positive bacteria.Its cell is in direct rod shape, and size is (0.8-1.2) um × (1.5-4.0) um, is distributed widely in soil and corruption
Organic matter in.Because its culture is simple and quick, ability, non-pathogenic and good fermentation base with stronger secretory protein
Plinth and production technology, therefore bacillus subtilis is to produce various industrial enzymes at present, such as amylase, protease and lipase
Ideal expressive host is a kind of important model bacterial strain in microbe research field.But egg is expressed using bacillus subtilis
In vain, the promoter that the unstability of generally existing plasmid, transformation efficiency are low, engineered strain stability is poor, not more is selective
The defects of.
However, the antibacterial peptide of above-mentioned Chinese patent literature, similar with current a lot of other antibacterial peptides, there are still molecular weight
Greatly, with immunogenicity, antibacterial activity is not high, thermal stability is bad, with toxic side effect or can lead to haemolysis to zooblast
The defects of, these defects limit popularization and application of the antibacterial peptide in feed addictive to a certain extent.
In consideration of it, urgently proposing a kind of antibacterial peptide at present, low production cost, high yield can be realized as animal feed additive
Amount, high stability, and animal resistance can be effectively increased.
Invention content
First technical problem to be solved by this invention is to provide a kind of achievable low production cost, high yield, Gao Wen
It is qualitative, and the animal feed additive of animal resistance can be effectively increased.
The invention solves second technical problem be to provide a kind of application of antibacterial peptide as animal feed additive.
The animal feed additive of the present invention, the animal feed additive are the withered grass bud for expressing cecropin B gene MAP-18
Spore bacillus lysate, the amino acid sequence of the cecropin B gene MAP-18 is as shown in SEQ ID NO.1.
The amino acid sequence of the SEQ ID NO.1 is as follows：GRFKRFRKKFKKLFKKLS.
Preferably, the bacillus subtilis is the bacillus subtilis of non-pathogenic.
The method of animal feed additive described in the preparation of the present invention, includes the following steps：
It (1) will be with the first primer of base sequence as shown in SEQ ID NO.2 and with as shown in SEQ ID NO.3
The second primer of base sequence hybridized, obtain the antibacterial peptide with the amino acid sequence as shown in SEQ ID NO.1
BMAP-18；The cecropin B gene MAP-18 has BamHI and XbaI enzyme cutting site；
Wherein, base sequence is as follows shown in the SEQ ID NO.2 that the first primer has：5' -
GGATCCATGGGTAGATTTAAGAGATTTAGAAAGAAGTTTAAGAAATTGTTCAAAAAGTTGTC ATAATGATCTAGA-
3'；
Base sequence is as follows shown in the SEQ ID NO.3 that second primer has：5' -TCTAGATCATTATGACA
ACTTTTTGAACAATTTCTTAAACTTCTTTCTAAATCTCTTAAATC TACCGAAAGTTTTTTGAAAAGTTTTTTAAAT
TTTTTACGGAACCTCTTAAAACGGCCCATGGA TCC-3'；
(2) using BamHI and XbaI as restriction enzyme site, the cecropin B gene MAP-18 obtained in step (1) is connected to
In pHT01 carriers, it is built into expression vector pHT01/BMAP-18；(3) expression vector that will be obtained in step (2)
PHT01/BMAP-18 is expanded in TOP10, and extracts pHT01/BMAP-18 plasmids；
(4) by the pHT01/BMAP-18 plasmids obtained in step (3) and pCas9 carriers cotransformation to withered grass gemma
In bacillus, cultivated 3-7 days on LB solid mediums；Wherein, with the gRNA for the sites ThrC in pCas9 plasmids；
(5) picking positive single bacterium colony on the LB solid mediums from step (4) after culture, is inoculated into liquid
In culture medium, after culture 1-7 days, then obtained engineering bacterium fermentation will be cultivated 1-7 days；
(6) engineering bacteria obtained after fermentation in step (5) is centrifuged, collection thalline, the bacterial cell disruption that will be collected into,
Using sterile water dissolution thalline, the mixed liquor being mixed to get is centrifuged, supernatant is stayed, and be dried to get.
Preferably, the step (2) specifically comprises the following steps：
(a) pHT01 carriers are converted to DH5 α competent cells, and is coated on the LB- containing Ampicillin
On Amp solid mediums, 8-24h is cultivated, then picking single bacterium colony is inoculated on LB-Amp fluid nutrient mediums, is 37 ± 2 in temperature
DEG C, rotating speed be 150-250rpm under conditions of, cultivate 6-12h, extract pHT01 plasmids；
(b) it is carried out at a temperature of the pHT01 plasmids, BamHI and the XbaI that are obtained in step (a) being placed in 37 ± 2 DEG C
Double digestion reacts, and centrifuges reaction solution after reacting 3-4h, then carries out electroresis appraisal；Identify it is errorless after, digestion products are recycled；
(c) by the pHT01 carriers large fragment recycled in the obtained digestion products in step (b) and the antibacterial peptide
BMAP-18 is attached, and structure obtains the pHT01/BMAP-18 expression vectors.
It is further preferred that the step (3) specifically comprises the following steps：
(d) the pHT01/BMAP-18 expression vectors will be obtained in the step (c) be transformed into DH5 α competent cells,
Obtain recombinant plasmid pHT01/BMAP-18；
(e) by recombinant plasmid pHT01/BMAP-18 in step (d), 10 single bacterium colonies of picking are inoculated in LB-Amp respectively
On fluid nutrient medium, 6-12h is cultivated in the case where temperature is 37 ± 5 DEG C, rotating speed is 150-250rpm, extraction obtains the pHT01/
BMAP-18 plasmids.
It is further preferred that the step (4) specifically comprises the following steps：
(f) it is the plasmid for including the gRNA for the sites ThrC by pCas9 plasmid constructions, then obtains structure
PCas9 plasmids are transformed into DH5 α competent cells, and are coated on the LB-CmR solid mediums containing chloramphenicol, culture
Picking single bacterium colony is inoculated on LB-CmR fluid nutrient mediums after 8-24h, in the item that temperature is 37 ± 2 DEG C, rotating speed is 200rpm
6-12h is cultivated under part, finally extraction obtains for use pCas9 plasmids；
(g) bacillus subtilis glycerol stock is taken, is inoculated on LB solid mediums, is trained at a temperature of 37 ± 5 DEG C
Case culture is supported to single bacterium colony is grown, then single bacterium colony switching is in I solution of GM described in picking, in 30 ± 8 DEG C of temperature, rotating speed 80-
6-12h is cultivated under conditions of 200rpm；
(h) bacterium solution that culture obtains in step (g) is taken, is transferred in I solution of GM, temperature is 37 ± 2 DEG C, rotating speed is
It is cultivated to logarithmic growth latter stage under conditions of 150-350rpm；
(i) bacterium solution in the logarithmic growth latter stage obtained in step (h) is transferred in II solution of GM, is 37 ± 2 in temperature
DEG C, rotating speed be 100-300rpm under conditions of cultivate 20-200min, after culture by it at 2-8 DEG C of temperature, rotating speed 3000-
2-30min is centrifuged under conditions of 6000rpm, thalline is collected after centrifugation, discards culture solution supernatant, with remaining culture medium suspended bacteria
Body, the thalline after suspension are competent cell to be transformed；
(j) it is obtained in the competent cell addition step (e) to be transformed obtained into step (i) described
The for use pCas9 obtained in pHT01/BMAP-18 plasmids and step (f), in 37 ± 2 DEG C of temperature, rotating speed 150-350rpm
Under conditions of cultivate 10-200min, then take culture after bacterium solution be coated in screening flat board, through culture, the pHT01/
In BMAP-18 plasmids and pCas9 carriers, that is, cotransformation to bacillus subtilis.
It is further preferred that the step (5) specifically comprises the following steps：
(k) by the recombinant bacillus of the pHT01/BMAP-18 plasmids and pCas9 carrier cotransformations in picking step (j)
The single bacterium colony of bacillus is inoculated in the LB-Amp fluid nutrient mediums of addition Ampicillin, is 37 ± 2 in temperature
DEG C, rotating speed cultivates 14-16h under conditions of being 100-300rpm, obtains seed liquor；
(l) seed liquor obtained in step (k) is transferred with the inoculum concentration of 0.5-5% in the LB liquid of addition antibiotic
It it is 37 ± 2 DEG C in temperature, rotating speed continues fermented and cultured 24-48h under conditions of being 100-300rpm in body culture medium.
It is further preferred that the step (6) specifically comprises the following steps：
The engineering bacterium fermentation liquid that will be obtained after fermentation in step (l) temperature be 2-10 DEG C, rotating speed 1000-
1-30min is centrifuged under conditions of 20000rpm, recycles the medium supernatant containing somatic cells, is resuspended and is washed with PBS, then
It is crushed thalline under conditions of 0-5 DEG C, using sterile water dissolution thalline, intracellular organic matter is released in 1000- by broken
5-60min is centrifuged under the rotating speed of 20000rpm, supernatant is recycled after centrifugation, is dried up to the animal feed additive.
The present invention also provides the animal feed additives being prepared by above-mentioned method.
Application of the animal feed additive in the diarrhea rate field for reducing wean animal；Especially reducing wean
The application in the diarrhea rate field of piglet.
Alternatively, the animal feed additive is in the application for inhibiting pathogenic bacteria field；The pathogenic bacteria include large intestine bar
Bacterium, salmonella, Pseudomonas aeruginosa, staphylococcus aureus.
The above-mentioned technical proposal of the present invention, has the following advantages compared with prior art：
(1) animal feed additive of the invention is the bacillus subtilis lysate for expressing cecropin B gene MAP-18,
In, the BMAP-18 is the variant of ox bone marrow antibacterial peptide 27 (BMAP-27), and early stage research finds that it has several parasites
Very strong resistance, including trypanosoma and Leishmania.Cecropin B gene MAP-18, which has the antibacterial activity of wide spectrum and resists, to be posted
Infested activity, to common pathogenic bacteria, such as：Escherichia coli, salmonella, Pseudomonas aeruginosa and staphylococcus aureus, all
There is good bacteriostasis；
(2) present invention uses CRISPR/Cas9 technologies, will express the gene multi-copy integration of BMAP-18 to withered grass gemma
In the genome of bacillus, it is built into the engineering bacteria that high yield stablizes expression, large-scale culture fermentation is carried out to the engineering bacteria later,
It will be added in animal feed after the thalline Direct Pyrolysis of the expression BMAP-18 of preparation, high temperature drying.The present invention utilizes withered grass gemma
Bacillus directly expresses antibacterial peptide, then is directly prepared into feed addictive, eliminates protein separation process, reduces production
Cost thus avoids the direct chemical synthesis of polypeptide problem with high costs.Also, CRISPR/Cas9 technologies are used, it will
BMAP-18 genes stablize be integrated into the genome of bacillus subtilis, improve the stability of engineered strain, it can be achieved that
BMAP-18 antibacterial peptide high yields, further decrease production cost；
(3) bacillus subtilis that the present invention uses is a kind of gram-positive bacteria of non-pathogenic, therefore is also avoided
The problems such as facing endotoxin is prepared using traditional Escherichia coli；What is more important, bacillus subtilis as feed addictive,
Have the function of supplementing albumen, improve immunity of livestock, the present invention has recombinated antibacterial peptide gene and protected in bacillus subtilis
Card antibacterial peptide activity is constant, and this bacillus subtilis can increase the resistance of livestock and poultry, reduce the use of antibiotic.
Description of the drawings
It, below will be to specific in order to illustrate more clearly of the specific embodiment of the invention or technical solution in the prior art
Attached drawing needed in embodiment is briefly described, wherein：
Fig. 1 is the carrier that BMAP-18 genes are cloned in the embodiment of the present invention；
Fig. 2 is expression Cas9 albumen and the carrier for the sites ThrC gRNA in the embodiment of the present invention；
The test result statistical chart that Fig. 3 verifies for PCR in the bacillus subtilis positive transformant identification experiment of the present invention；
Fig. 4 is the analysis result statistical chart in the cytotoxicity experiment of the additive of the present invention；
Fig. 5 is the result statistical chart that acts on confirmatory experiment of the additive to improvement diarrhea of weaned piglets rate of the present invention；
Fig. 6 is the comparing result statistical chart of the animal feed additive and BMAP-18 of the present invention；
Specific implementation mode
The present invention is described in detail with specific embodiment below in conjunction with the accompanying drawings.
The animal feed additive of the present embodiment, it is described to express the bacillus subtilis lysate of cecropin B gene MAP-18
The amino acid sequence of cecropin B gene MAP-18 is as shown in SEQ ID NO.1.The bacillus subtilis is the withered grass bud of non-pathogenic
Spore bacillus.
The amino acid sequence of the SEQ ID No.1 is specific as follows:GRFKRFRKKFKKLFKKLS.
The preparation method of the animal feed additive is as shown in Figure 1 the Vector map of expressed BMP -18, such as Fig. 2 institutes
It is shown as the Vector map of expression Cas9 albumen and gRNA, is specifically comprised the following steps：
It (1) will be with the first primer of base sequence as shown in SEQ ID NO.2 and with as shown in SEQ ID NO.3
The second primer of base sequence hybridized, obtain the antibacterial peptide with the amino acid sequence as shown in SEQ ID NO.1
BMAP-18；The cecropin B gene MAP-18 has BamHI and XbaI enzyme cutting site；
Wherein, the base sequence of the SEQ ID No.2 is specific as follows:5' -GGATCCATGGGTAGATTTAAGAGATT
TAGAAAGAAGTTTAAGAAATTGTTCAAAAAGTTGTC ATAATGATCTAGA-3'；
The base sequence of the SEQ ID No.3 is specific as follows:5' -TCTAGATCATTATGACAACTTTTTGAACAAT
TTCTTAAACTTCTTTCTAAATCTCTTAAATC TACCGAAAGTTTTTTGAAAAGTTTTTTAAATTTTTTACGGAACCT
CTTAAAACGGCCCATGGA TCC-3'；
(2) using BamHI and XbaI as restriction enzyme site, the cecropin B gene MAP-18 obtained in step (1) is connected to
In pHT01 carriers, it is built into expression vector pHT01/BMAP-18.
(3) the expression vector pHT01/BMAP-18 obtained in step (2) is expanded in TOP10, and extracted
PHT01/BMAP-18 plasmids；
(4) by the pHT01/BMAP-18 plasmids obtained in step (3) and pCas9 carriers cotransformation to withered grass gemma
In bacillus, cultivated 5 days on LB solid mediums；
(5) picking positive single bacterium colony on the LB solid mediums from step (4) after culture, is inoculated into liquid
In culture medium, after culture 3 days, then by culture obtained engineering bacterium fermentation 1-7 days；
(6) engineering bacteria obtained after fermentation in step (5) is centrifuged, collection thalline, the bacterial cell disruption that will be collected into,
Using sterile water dissolution thalline, the mixed liquor being mixed to get is centrifuged, supernatant is stayed, and be dried to get.
As the preferred embodiment of the present embodiment, the preparation method of the animal feed additive specifically includes following step
Suddenly：
(1) be structure can in bacillus subtilis successful expression BMAP-18 genes expression vector, existed using codon
Line optimization tool DNAWorks (https://hpcwebapps.cit.nih.gov/dnaworks/), BMAP-18 is carried out close
Numeral optimizes, it is contemplated that BMAP-18 is to the toxicity of host strain, the strategy expressed using non-secreting expression combined induction, after optimization
Gene directly synthesize the long primer of upstream and downstream, in addition restriction enzyme site, hybridization is used for follow-up vector construction after forming double-strand；
The amino acid sequence of optimized cecropin B gene MAP-18 is as shown in SEQ ID NO.1.There to be such as SEQ ID
The first primer of base sequence shown in NO.2 carries out ladder with the second primer with the base sequence as shown in SEQ ID NO.3
Degree cooling hybridization, obtains the cecropin B gene MAP-18 with the amino acid sequence as shown in SEQ ID NO.1；The cecropin B gene MAP-
18 have BamHI and XbaI enzyme cutting site；
(a) pHT01 carriers are converted to DH5 α competent cells, and is coated on containing 100 μ g/mL's
On the LB-Amp solid mediums of Ampicillin, 12h is cultivated, then picking single bacterium colony is inoculated in the LB-Amp Liquid Cultures of 10mL
On base, under conditions of temperature is 37 ± 2 DEG C, rotating speed is 200rpm, 12h is cultivated, extracts pHT01 plasmids；
(b) endonuclease reaction system is added in the pHT01 plasmids obtained in step (a), BamHI and XbaI, mixing is equal
Centrifugation after even, carries out double digestion reaction at a temperature of being subsequently placed in 37 ± 2 DEG C, centrifuge reaction solution after reacting 3h, then carry out
Electroresis appraisal；Identify it is errorless after, according to Agarose gel DNA QIAquick Gel Extraction Kits (common centrifugal column type) (it is commercially available, be purchased from
Axygen companies, the product that different manufacturers are sold have no effect on the realization of the technology of the present invention effect) operating instruction digestion is produced
Object recycles, and is placed at -20 DEG C and preserves, and is used for pHT01/BMAP-18 expression vector establishments；
Wherein, digestion system is as follows：
| Component | Volume |
| Carrier pHT01 | 20.0μL |
| BamHI | 1.5μL |
| XbaI | 1.5μL |
| 10×Buffer | 3.0μL |
| ddH2O | 4.0μL |
(c) by the pHT01 carriers large fragment recycled in the obtained digestion products in step (b) and the antibacterial peptide
BMAP-18 is placed in mixing in linked system and centrifuges, using sealed membrane closing EP pipes, in the case where temperature is 20-25 DEG C, the company of incubation
2h is met, structure obtains the pHT01/BMAP-18 expression vectors；
Wherein, linked system is as follows：
| Component | Volume |
| BMAP-18 genetic fragments | 7.0μL |
| PHT01 carrier large fragments | 1.0μL |
| 10×T4DNA Ligase Buffer | 1.0μL |
| T4DNA Ligase | 1.0μL |
(d) the pHT01/BMAP-18 expression vectors will be obtained in the step (c) be transformed into DH5 α competent cells,
Obtain recombinant plasmid pHT01/BMAP-18；
(e) by recombinant plasmid pHT01/BMAP-18 in step (d), 10 single bacterium colonies of picking are inoculated in LB-Amp respectively
On fluid nutrient medium, 6-12h is cultivated in the case where temperature is 37 ± 5 DEG C, rotating speed is 150-250rpm, extraction obtains the pHT01/
BMAP-18 plasmids.
As the preferred embodiment of step (e), step (e) further include 10 plasmids that will be extracted be sent to sequencing company into
Whether row sequencing, verifying purpose genetic fragment are correctly cloned into expression vector, and the LB- being inoculated into correctly is cloned in verification
The re-spread big culture of Amp fluid nutrient mediums, cultivates 12h under conditions of temperature is 37 DEG C, rotating speed is 200rpm, then plasmid carry
Take kit (commercially available, to be purchased from Promega companies, the product that different manufacturers are sold has no effect on the realization of the technology of the present invention effect)
It is spare to extract a large amount of plasmids；
(f) it is the plasmid for including the gRNA for the sites ThrC by pCas9 plasmid constructions, then obtains structure
PCas9 plasmids are transformed into DH5 α competent cells, and are coated on the LB-CmR solid cultures containing 1200 μ g/mL chloramphenicol
On base, picking single bacterium colony is inoculated on the LB-CmR fluid nutrient mediums of 10mL after culture for 24 hours, is 37 ± 2 DEG C, rotating speed in temperature
To cultivate 12h under conditions of 200rpm, finally using plasmid extraction kit, (commercially available, purchased from Promega companies, different manufacturers go out
The product sold has no effect on the realization of the technology of the present invention effect) extraction obtain for use pCas9 plasmids；
(g) the bacillus subtilis glycerol stock being stored at -80 DEG C is taken out, bacillus subtilis glycerine is dipped with oese
Bacterium streak inoculation on LB solid mediums, incubator culture is to single bacterium colony is grown at a temperature of 37 ± 5 DEG C, then with sterilizing
Oese picking single bacterium colony transfer in I solution of GM of 5mL, cultivated under conditions of 30 ± 8 DEG C of temperature, rotating speed 120rpm
12h；
(h) bacterium solution that culture obtains in step (g) is taken, is transferred in I solution of GM, temperature is 37 ± 2 DEG C, rotating speed is
It is cultivated to logarithmic growth latter stage, about 3-5h under conditions of 250rpm；
(i) bacterium solution in the logarithmic growth latter stage obtained in (h) the step of 10mL is transferred in II solution of GM, is in temperature
37 ± 2 DEG C, rotating speed be 200rpm under conditions of cultivate 90min, after culture by it at 4 DEG C of temperature, the condition of rotating speed 5000rpm
Lower centrifugation 10min, is collected after centrifugation thalline, discards the culture solution supernatant of 90mL, with remaining culture medium suspension thalline, after suspension
Thalline is competent cell to be transformed；
(j) the competent cell bacterium solution to be transformed obtained into step (i) is distributed into 0.5 mL/ and often manages, and is added
It the pHT01/BMAP-18 plasmids obtained in 1.5 μ L steps (e) and is obtained in 1.5 μ L steps (f) described for use
PCas9 cultivates 90min under conditions of 37 ± 2 DEG C of temperature, rotating speed 250rpm, and the bacterium solution after culture is then taken to be coated on screening
On tablet, 12h is cultivated, in the pHT01/BMAP-18 plasmids and pCas9 carriers, that is, cotransformation to bacillus subtilis；
It should be noted that the component of I solution of the GM, II solution of the GM is not unique, one is provided in the present embodiment
The preferred realization method of kind, I solution of the GM includes following ingredient：1 × minimum salting liquid 95mL, 50% glucose 1mL, 5%
Caseinhydrolysate 0.4mL, 10% yeast juice, 1 mL, 2mg/mL amino acid (tryptophan L-trp) solution 2.5mL (50ug/mL)；
II solution of the GM includes following ingredient：1 × minimum salting liquid 97.5mL, 50% glucose 1mL, 5% hydrolysis junket
Albumen 0.08mL, 10% yeast juice 0.04mL, 0.5mol/L MgCl2 0.5 mL (2.5mmol/L), 0.1mol/L CaCl2
0.5mL (0.5mmol/L), 2mg/mL amino acid (tryptophan L-trp) solution 0.5mL (5ug/mL)；
(k) pass through pHT01/BMAP-18 matter with the oese picking step (j) of sterilizing is middle in superclean bench
The single bacterium colony of the recombined bacillus subtilis of grain and pCas9 carrier cotransformations, is inoculated in the 10mL of addition Ampicillin
LB-Amp fluid nutrient mediums in, temperature be 37 ± 2 DEG C, rotating speed be 200rpm under conditions of cultivate 14-16h, obtain seed
Liquid；
(l) seed liquor obtained in step (k) is transferred with 1% inoculum concentration in the 100mL's for adding antibiotic
It it is 37 ± 2 DEG C in temperature, rotating speed continues fermented and cultured 24-48h under conditions of being 200rpm in LB liquid medium.
(6) by the engineering bacterium fermentation liquid obtained after fermentation in step (l) in the item that temperature is 4 DEG C, rotating speed is 10000rpm
10min is centrifuged under part, recycles the medium supernatant containing somatic cells, washing 2 times is resuspended with PBS, then in ice-water bath
It is crushed thalline with sonicator, using sterile water dissolution thalline, the broken intracellular organic matter that releases is turned in 10000rpm
Speed is lower to centrifuge 30min, and supernatant is recycled after centrifugation, is dried up to the animal feed additive.
The application method of animal feed additive of the present invention is not unique, is provided in the present embodiment a kind of preferred
Occupation mode：The animal feed additive obtained in the present embodiment is added to feed by birds according to the weight ratio of 2-4%
In；The animal feed additive obtained in the present embodiment is added in feed by livestock according to the weight ratio of 0.5-1%；Or
Person calculates the additive amount of the corresponding animal feed additive according to the daily feed dosage of birds or livestock, by phase
The animal feed additive of additive amount is answered to be added directly into the drinking water of birds or livestock.The birds include but not
It is limited to chicken, duck, goose；The livestock includes but not limited to ox, sheep, pig.
Test example
For the technique effect of the verification present invention, following tests is carried out：
One, bacillus subtilis positive transformant identification experiment
The pHT01/BMAP-18 plasmids and pCas9 carrier cotransformations will be passed through in step (j) in specific implementation mode
Recombined bacillus subtilis be coated on screening flat board culture medium (LB-Amp/CmR), cultivated under conditions of 37 DEG C to growing list
Bacterium colony.The picking single bacterium colony is inoculated on the LB-Amp fluid nutrient mediums of 10mL, temperature is 37 DEG C, rotating speed is 200rpm's
Under the conditions of cultivate 12h.Finally, it has been integrated into the sites ThrC of bacillus subtilis using PCR verification BMAP-18 genes
(CTCGCTCAAGCTGTCATGTA).Wherein, the sense primer that PCR verifications use for the upstream sequence in the sites ThrC, draw by downstream
Object is the sequence in BMAP-18.
The sense primer has the base sequence as shown in SEQ ID NO.4, the base sequence of the SEQ ID NO.4
It is classified as：5'-GCCCGTGCTAACATGAAATG-3'；The downstream primer has the base sequence as shown in SEQ ID NO.5,
The base sequence of the SEQ ID NO.5 is：5' -TACGGAACCTCTTAAAACGG-3'.
The results are shown in Figure 3 for it, is verified through PCR, and pHT01/BMAP-18 plasmid integrations are into the positions ThrC of bacillus subtilis
Point on.
Two, additive bacteriostatic experiment
The engineering bacteria obtained after fermenting in (l) step in the embodiment of the present invention, thalline were collected by centrifugation, and high pressure cell is broken
Broken instrument is crushed thalline, and with sterile water dissolution thalline, centrifugation stays supernatant, freeze-drying to obtain crude extract, tested according to cylinder-plate method
Step carries out bacteriostatic experiment.
Its testing result is as shown in the table：
| Tested strain | MIC(mg/ml) |
| Escherichia coli | 1.0 |
| Salmonella | 1.2 |
| Pseudomonas aeruginosa | 1.5 |
| Staphylococcus aureus | 1.2 |
Above-mentioned bacteriostatic experiment the result shows that：The animal feed additive of the present invention is to Escherichia coli, salmonella, green
Purulence bacillus and staphylococcus aureus have In Vitro Bacteriostatic.
Three, the cytotoxicity experiment of additive
Chitterlings epithelial cell IPEC-1 is being contained into 10% fetal calf serum, 5ug/L epidermal growth factor (EGF)
It in DMEM high glucose mediums, cultivates to logarithmic phase, after then cleaning three times with PBS, 0.25% trypsin digestion is added extremely
It is unicellular；Then, complete medium is added and terminates digestion, discard, after adding DMEM culture mediums, under the rotating speed of 1000RPM
Centrifugation 5 minutes, abandons supernatant；Then, complete medium suspension cell is added, it is 1 × 10 to adjust to cell density6It is spread after a/mL
96 orifice plates various concentration additive are added after cell is adherent, is placed in carbon dioxide incubator per hole 200uL, 37 DEG C,
5%CO2Under conditions of cultivate 24 hours；After culture, the CCK-8 solution of 20uL is added in every hole, continues culture 2 hours,
Finally, the light absorption value of 450nm wavelength is detected using microplate reader.
Testing result is as shown in figure 4, the cytotoxicity experiment result of additive is the average value of independent experiment result three times.
It being obtained from Fig. 4, additive has dose dependent to the toxicity of cell, but at maximum concentration 3mg/ml, cell toxicant
Property it is still very low, be less than 10%.
Four, effect confirmatory experiment of the additive to improvement diarrhea of weaned piglets rate
Weanling pig 30 after 21 ages in days transport is chosen, assigns to 3 processing groups at random by weight and gender, control group does not add
Add animal feed additive of the present invention, in addition adds 250mg/kg's and 500mg/kg respectively in two groups of every daily sustenance
Animal feed additive described in specific embodiment, 10 days experimental periods, record the diarrhea situation of weanling pig.
Its test result is as shown in figure 5, result is the result tested in triplicate.By test result it can be seen that the present invention
The animal feed additive can significantly reduce diarrhea of weaned piglets rate.
Further to verify animal feed additive and BMAP-18 of the present invention to improving diarrhea of weaned piglets rate
Effect is compared, and is tested as follows：
Weanling pig 30 after 21 ages in days transport is chosen, assigns to 3 processing groups at random by weight and gender, control group does not add
Add animal feed additive of the present invention, the present invention in addition adding 250mg/kg in two groups of every daily sustenance respectively is specific
The net of the BMAP-18 of the animal feed additive and 500mg/kg that are prepared in embodiment, the BMAP-18 contains
Amount is 500mg/kg, and 10 days experimental periods recorded the diarrhea situation of weanling pig.
Its test result is as shown in fig. 6, result is the result tested in triplicate.By test result it can be seen that reducing
In terms of diarrhea of weaned piglets rate, the effect of animal feed additive ratio BMAP-18 of the present invention is more preferable, this illustrates withered grass bud
Spore bacillus and BMAP-18 are used in combination, and effect is more preferable.
Obviously, the above embodiments are merely examples for clarifying the description, and does not limit the embodiments.It is right
For those of ordinary skill in the art, can also make on the basis of the above description it is other it is various forms of variation or
It changes.There is no necessity and possibility to exhaust all the enbodiments.And it is extended from this it is obvious variation or
It changes still within the protection scope of the invention.
Sequence table
<110>Thousand bio tech ltd Ji Nuo of Nanjing
<120>A kind of animal feed additive and the preparation method and application thereof
<130> 2018
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 18
<212> PRT
<213>Artificial sequence ()
<400> 1
Gly Arg Phe Lys Arg Phe Arg Lys Lys Phe Lys Lys Leu Phe Lys Lys
1 5 10 15
Leu Ser
<210> 2
<211> 75
<212> DNA
<213>Artificial sequence ()
<400> 2
ggatccatgg gtagatttaa gagatttaga aagaagttta agaaattgtt caaaaagttg 60
tcataatgat ctaga 75
<210> 3
<211> 128
<212> DNA
<213>Artificial sequence ()
<400> 3
tctagatcat tatgacaact ttttgaacaa tttcttaaac ttctttctaa atctcttaaa 60
tctaccgaaa gttttttgaa aagtttttta aattttttac ggaacctctt aaaacggccc 120
atggatcc 128
<210> 4
<211> 20
<212> DNA
<213>Artificial sequence ()
<400> 4
gcccgtgcta acatgaaatg 20
<210> 5
<211> 20
<212> DNA
<213>Artificial sequence ()
<400> 5
tacggaacct cttaaaacgg 20
Claims (10)
1. a kind of animal feed additive, which is characterized in that the animal feed additive is the withered of expression cecropin B gene MAP-18
Careless bacillus lysate, the amino acid sequence of the cecropin B gene MAP-18 is as shown in SEQ ID NO.1.
2. animal feed additive according to claim 1, which is characterized in that the bacillus subtilis is non-pathogenic
Bacillus subtilis.
3. a kind of method preparing the animal feed additive described in claims 1 or 2, which is characterized in that including walking as follows
Suddenly：
It (1) will be with the first primer of base sequence as shown in SEQ ID NO.2 and with the alkali as shown in SEQ ID NO.3
Second primer of basic sequence is hybridized, and the cecropin B gene MAP-18 with the amino acid sequence as shown in SEQ ID NO.1 is obtained；
The cecropin B gene MAP-18 has BamHI and XbaI enzyme cutting site；
(2) using BamHI and XbaI as restriction enzyme site, the cecropin B gene MAP-18 obtained in step (1) is connected to pHT01
In carrier, it is built into expression vector pHT01/BMAP-18；
(3) the expression vector pHT01/BMAP-18 obtained in step (2) is expanded in TOP10, and extracts pHT01/
BMAP-18 plasmids；
(4) by the pHT01/BMAP-18 plasmids obtained in step (3) and pCas9 carriers cotransformation to bacillus subtilis
In, it is cultivated 3-7 days on LB solid mediums；
(5) picking positive single bacterium colony on the LB solid mediums from step (4) after culture, is inoculated into Liquid Culture
In base, after culture 1-7 days, then obtained engineering bacterium fermentation will be cultivated 1-7 days；
(6) engineering bacteria obtained after fermentation in step (5) is centrifuged, collects thalline, the bacterial cell disruption that will be collected into uses
Sterile water dissolution thalline, by the mixed liquor being mixed to get centrifuge, stay supernatant, and be dried to get.
4. according to the method for preparing animal feed additive described in claim 3, which is characterized in that step (2) tool
Body includes the following steps：
(a) pHT01 carriers are converted to DH5 α competent cells, and is coated on the LB-Amp solids containing Ampicillin
On culture medium, 8-24h is cultivated, then picking single bacterium colony is inoculated on LB-Amp fluid nutrient mediums, is 37 ± 2 DEG C, rotating speed in temperature
Under conditions of 150-250rpm, 6-12h is cultivated, extracts pHT01 plasmids；
(b) double enzymes are carried out at a temperature of the pHT01 plasmids, BamHI and the XbaI that are obtained in step (a) being placed in 37 ± 2 DEG C
Reaction is cut, reaction solution is centrifuged after reacting 3-4h, then carries out electroresis appraisal；Identify it is errorless after, digestion products are recycled；
(c) by the pHT01 carriers large fragment recycled in the obtained digestion products in step (b) and the cecropin B gene MAP-18
It is attached, structure obtains the pHT01/BMAP-18 expression vectors.
5. according to the method for preparing animal feed additive described in claim 4, which is characterized in that step (3) tool
Body includes the following steps：
(d) the pHT01/BMAP-18 expression vectors will be obtained in the step (c) and be transformed into DH5 α competent cells, obtain
Recombinant plasmid pHT01/BMAP-18；
(e) by recombinant plasmid pHT01/BMAP-18 in step (d), 10 single bacterium colonies of picking are inoculated in LB-Amp liquid respectively
On culture medium, 6-12h is cultivated in the case where temperature is 37 ± 5 DEG C, rotating speed is 150-250rpm, extraction obtains the pHT01/BMAP-
18 plasmids.
6. according to the method for preparing animal feed additive described in claim 5, which is characterized in that step (4) tool
Body includes the following steps：
(f) it is the plasmid for including the gRNA for the sites ThrC by pCas9 plasmid constructions, the pCas9 matter for then obtaining structure
Grain is transformed into DH5 α competent cells, and is coated on the LB-CmR solid mediums containing chloramphenicol, after cultivating 8-24h
Picking single bacterium colony is inoculated on LB-CmR fluid nutrient mediums, is cultivated under conditions of temperature is 37 ± 2 DEG C, rotating speed is 200rpm
6-12h, finally extraction obtain for use pCas9 plasmids；
(g) bacillus subtilis glycerol stock is taken, is inoculated on LB solid mediums, the incubator at a temperature of 37 ± 5 DEG C
Culture is to single bacterium colony is grown, and then single bacterium colony switching is in I solution of GM described in picking, in 30 ± 8 DEG C of temperature, rotating speed 80-
6-12h is cultivated under conditions of 200rpm；
(h) bacterium solution that culture obtains in step (g) is taken, is transferred in I solution of GM, is 37 ± 2 DEG C, rotating speed 150- in temperature
It is cultivated to logarithmic growth latter stage under conditions of 350rpm；
(i) bacterium solution in the logarithmic growth latter stage obtained in step (h) is transferred in II solution of GM, is 37 ± 2 DEG C, turns in temperature
Speed cultivates 20-200min under conditions of being 100-300rpm, after culture by it at 2-8 DEG C of temperature, rotating speed 3000-6000rpm
Under conditions of centrifuge 2-30min, thalline is collected after centrifugation, discards culture solution supernatant, with remaining culture medium suspension thalline, after suspension
Thalline be competent cell to be transformed；
(j) pHT01/ obtained in step (e) is added in the competent cell to be transformed obtained into step (i)
The for use pCas9 obtained in BMAP-18 plasmids and step (f), in 37 ± 2 DEG C of temperature, the condition of rotating speed 150-350rpm
Then lower culture 10-200min takes the bacterium solution after culture to be coated in screening flat board, through culture, the pHT01/BMAP-18 matter
In grain and pCas9 carriers, that is, cotransformation to bacillus subtilis.
7. according to the method for preparing animal feed additive described in claim 6, which is characterized in that step (5) tool
Body includes the following steps：
(k) by the recombinant bacillus gemma of the pHT01/BMAP-18 plasmids and pCas9 carrier cotransformations in picking step (j)
The single bacterium colony of bacillus is inoculated in the LB-Amp fluid nutrient mediums of addition Ampicillin, is 37 ± 2 DEG C in temperature, is turned
Speed cultivates 14-16h under conditions of being 100-300rpm, obtains seed liquor；
(l) seed liquor obtained in step (k) is trained with the inoculum concentration switching of 0.5-5% in the LB liquid of addition antibiotic
It supports in base, is 37 ± 2 DEG C in temperature, rotating speed continues fermented and cultured 24-48h under conditions of being 100-300rpm.
8. according to the method for preparing animal feed additive described in claim 7, which is characterized in that step (6) tool
Body includes the following steps：
By the engineering bacterium fermentation liquid obtained after fermentation in step (l) in the item that temperature is 2-10 DEG C, rotating speed is 1000-20000rpm
1-30min is centrifuged under part, recycles the medium supernatant containing somatic cells, is resuspended and is washed with PBS, then in 0-5 DEG C of item
Thalline is crushed under part, using sterile water dissolution thalline, broken will release intracellular organic matter under the rotating speed of 1000-20000rpm from
Heart 5-60min recycles supernatant after centrifugation, is dried up to the animal feed additive.
9. the animal feed additive that a kind of method by described in any one of claim 3-8 is prepared.
10. animal feed additive described in claim 9 is in the application in the diarrhea rate field for reducing wean animal；Or pressing down
The application in pathogenic bacteria field processed；The pathogenic bacteria include Escherichia coli, salmonella, Pseudomonas aeruginosa, staphylococcus aureus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810520754.8A CN108771028B (en) | 2018-05-28 | 2018-05-28 | Animal feed additive and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810520754.8A CN108771028B (en) | 2018-05-28 | 2018-05-28 | Animal feed additive and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108771028A true CN108771028A (en) | 2018-11-09 |
| CN108771028B CN108771028B (en) | 2021-08-06 |
Family
ID=64027770
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810520754.8A Active CN108771028B (en) | 2018-05-28 | 2018-05-28 | Animal feed additive and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108771028B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022048180A1 (en) * | 2020-09-04 | 2022-03-10 | 浙江瀛康生物医药有限公司 | Use of polypeptide in drug for preventing and treating pneumonia |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103468673A (en) * | 2013-06-19 | 2013-12-25 | 江苏吉锐生物技术有限公司 | Preparation method and applications of antibacterial peptide |
| US20140296137A1 (en) * | 2013-04-01 | 2014-10-02 | Los Alamos National Security, Llc | Methods and compositions for controlling rotifers |
| CN105255935A (en) * | 2015-11-04 | 2016-01-20 | 黑龙江八一农垦大学 | Expression method of antimicrobial peptide CC34 in bacillus subtilis |
| US20160271272A1 (en) * | 2011-09-12 | 2016-09-22 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| US20170065675A1 (en) * | 2011-09-12 | 2017-03-09 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| CN106578836A (en) * | 2016-12-29 | 2017-04-26 | 江苏嘉肽生物技术有限公司 | Application of polypeptides in food preservation |
| CN106668832A (en) * | 2017-03-30 | 2017-05-17 | 江苏吉锐生物技术有限公司 | Application of polypeptide in preparing medicine for treating enterovirus infection |
-
2018
- 2018-05-28 CN CN201810520754.8A patent/CN108771028B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20160271272A1 (en) * | 2011-09-12 | 2016-09-22 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| US20170065675A1 (en) * | 2011-09-12 | 2017-03-09 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| US20140296137A1 (en) * | 2013-04-01 | 2014-10-02 | Los Alamos National Security, Llc | Methods and compositions for controlling rotifers |
| CN103468673A (en) * | 2013-06-19 | 2013-12-25 | 江苏吉锐生物技术有限公司 | Preparation method and applications of antibacterial peptide |
| CN105255935A (en) * | 2015-11-04 | 2016-01-20 | 黑龙江八一农垦大学 | Expression method of antimicrobial peptide CC34 in bacillus subtilis |
| CN106578836A (en) * | 2016-12-29 | 2017-04-26 | 江苏嘉肽生物技术有限公司 | Application of polypeptides in food preservation |
| CN106668832A (en) * | 2017-03-30 | 2017-05-17 | 江苏吉锐生物技术有限公司 | Application of polypeptide in preparing medicine for treating enterovirus infection |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022048180A1 (en) * | 2020-09-04 | 2022-03-10 | 浙江瀛康生物医药有限公司 | Use of polypeptide in drug for preventing and treating pneumonia |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108771028B (en) | 2021-08-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108587957B (en) | Screening and application of probiotic bacillus licheniformis capable of highly producing complex enzyme | |
| US20180072633A1 (en) | Agricultural methods | |
| CN105175518B (en) | The bacteriocin and preparation method thereof that bacillus coagulans FM603 is generated | |
| CN110982753B (en) | Bacillus coagulans MES847, microbial inoculum, chicken feed, preparation method and application | |
| CN111534459B (en) | Lactobacillus fermentum for high yield of amylase and application of lactobacillus fermentum in preparation of fermented feed | |
| CN110317278A (en) | The fusion protein and its encoding gene of SVV and FMDV, expression vector, cell line, engineering bacteria and vaccine and application | |
| CN105324481A (en) | Novel bacteriophage and antibacterial composition comprising the same | |
| CN105524855B (en) | A kind of bacillus coagulans and its application with aquatic pathogenic bacterium antagonistic properties | |
| CN101457231A (en) | Construction of bacteria ghost vector PMAL-E-SN and its application in bacillus coli | |
| CN102433269B (en) | Bacillus and application thereof | |
| CN113502243B (en) | Lactobacillus plantarum GBW-LP001 capable of highly producing lactic acid and antibacterial agent alternative thereof and application | |
| CN101638661B (en) | Construction of recombinant lactic acid bacteria with HN gene and F gene of Newcastle disease virus | |
| CN108771028A (en) | A kind of animal feed additive and the preparation method and application thereof | |
| CN108611300A (en) | A kind of saliva Bacillus acidi lactici SNK-6 and its application | |
| CN116003537B (en) | Rhabdovirus recombinant G protein, recombinant cell comprising rhabdovirus recombinant G protein and application of rhabdovirus recombinant G protein | |
| CN104988170B (en) | One kind fusion antibacterial peptide and its preparation method and application | |
| CN110755605A (en) | Flavobacterium columnare transgenic engineering oral vaccine, use method and application | |
| CN104418945A (en) | Preparation method of peptide and application of peptide in preparation of medicine and feed additive | |
| CN106818885A (en) | A kind of acid protease is preparing the application in suppressing cause of disease bacteria preparation | |
| CN105713908A (en) | Recombinant bombyx mori gloverin and preparation method and application thereof | |
| CN102533719A (en) | Method for improving antibacterial performance of Bacillus natto | |
| JP6117336B2 (en) | Newly isolated Bacillus licheniformis and probiotics using it | |
| KR100621657B1 (en) | New Bacillus subtilis UBT-M02 strain which has an acid and bile acid resistances, feed additive composition using it, and feed of animal having thereof | |
| CN105524158A (en) | Fly maggot antibacterial peptide, encoding gene, carrier, engineering bacteria and application thereof | |
| CN105732792A (en) | Yeast expressed chicken Cathelicidin antibacterial peptide as well as preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |