CN101457231A - Construction of bacteria ghost vector PMAL-E-SN and its application in bacillus coli - Google Patents
Construction of bacteria ghost vector PMAL-E-SN and its application in bacillus coli Download PDFInfo
- Publication number
- CN101457231A CN101457231A CNA200810051489XA CN200810051489A CN101457231A CN 101457231 A CN101457231 A CN 101457231A CN A200810051489X A CNA200810051489X A CN A200810051489XA CN 200810051489 A CN200810051489 A CN 200810051489A CN 101457231 A CN101457231 A CN 101457231A
- Authority
- CN
- China
- Prior art keywords
- gene
- vector pmal
- bacteria
- plasmid
- pmal
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a bacterial ghost vector PMAL-E-SN construction and application thereof in an escherichia coli comprising an E gene obtained by PCR amplification using a PhiX174 phage RFI plasmid as a template; an SN gene obtained by PCR amplification using a staphylococcus aureus standard strain ATCC25923 genome DNA as a template; an E-SN gene obtained by serial connecting the E gene and the SN gene by the Linker of the fifteen flexible amino acids; a positive plasmid pT-E-SN sequencing screened by coupling an E-SN gene PCR amplification outcome and a pMD18-T vector and the bacterial ghost vector PMAL-E-SN constructed by the recombinant plasmid pT-E-SN with right sequencing and the plasmid vector PMAL-p2X. The bacterial ghost vector PMAL-E-SN of the invention enables the E gene and the SN gene to obtain the high efficiency expression through a ''tac'' strong promoter and a malE start signal, successfully prepares the escherichia coli bacterial ghost and the degradation efficiency can reach 99.99 The invention induces a secondary killing gene SN, obtains good effect by combining the E gene and the SN gene to a high efficiency expression vector PMAL-p2X and is widely used in preparation of the escherichia coli bacterial ghost.
Description
Technical field
The present invention relates to the method for a kind of E of utilization gene and the gene constructed bacteria ghost vector PMAL-E-SN of SN, the invention still further relates to bacteria ghost vector PMAL-E-SN and in preparation intestinal bacteria bacterium shadow, use, belong to the genetically engineered field.
Background technology
Bacterium shadow (bacterial ghost, BG) be a kind of novel vaccine and adjuvant form, its essence is a kind of ghost body that does not contain contents such as endochylema and nucleic acid, the characteristics of its maximum are to have kept the complete interior outer membrane structure the same with viable bacteria, can produce specificity and nonspecific immune response by the effective stimulus body, the invasion and attack of opposing pathogenic micro-organism.With respect to traditional inactivated vaccine, its antigenic surface structure is farthest kept, the immunogenicity height, have the dual function of vaccine and adjuvant again concurrently than new generation vaccine, and load exogenous antigen on portion and the adventitia within it, becoming good antigen delivery vectors, the research for combined vaccine simultaneously provides research platform, in invasive organism more and more unmanageable today, bacterium shadow system begins to be subjected to domestic and international investigator's concern.
One 91 amino acid whose membranins of the E genes encoding of phage PhiX174, it can merge gram-negative bacteria inner membrance and adventitia, forms a kind of size and strides film cracking passage between the E of 40～200nm specificity.Under the effect of osmotic pressure, outer membrane structure in bacterium is only remaining, its internal space has lost nucleic acid, rrna and other guide thing.Electronic Speculum shows that week slurry gap is closed at the cracking channel edge, be likely albumen E effect after, adventitia fusion in the molten phosphatidylethanolamine that occurs on the after birth makes.E gene ts or amber mutation only make cracking phenotype defective, 10 times (only have less than 1% and discharge) that the cell that infects Eam mutant (UAG is at the 4th codon) stops to divide, cell is elongated, forfeiture viability and progeny phage can run up to normal emission levels.E albumen accounts for 1/3 aminoterminal and λ S albumen similarity.Inducing the E genetic expression of being cloned into lacI/cI aporepressor expression vector can cause lysis, form empty shadow cell, also is the bacterium shadow.
Streptococcus aureus nuclease A (Staphylococcus nuclease A, SN), having another name called micrococcal nuclease, is by the outer non-specificity phosphodiesterase of nucleic acid of a kind of born of the same parents of streptococcus aureus excretory, strand or double-stranded DNA or RNA are all had stronger degradation capability, and its activity depends on Ca
2+, Mg
2+Concentration.This nuclease can be degraded to DNA of bacteria small segment below the 100bp in the intracytoplasmic gathering of bacterium in the process of preparation bacterium shadow, helps the release of bacterium content, improves the bacterium cleavage rate.Staphylococcal nuclease A is not only peculiar by streptococcus aureus, and has higher conservative property between different strains.At expression in escherichia coli staphylococcal nuclease A the nucleic acid zymoprotein is piled up, and host DNA is degraded into short-movie section below the 100bp, but can not influence the formation of bacterium shadow.This enzymatic structure is simple, only is made up of 1 single chain polypeptide, is about 149 amino acid, does not contain halfcystine and disulfide linkage, and reversibly unfolding and refolding is research protein structure and function relationship, protein folding and dynamic (dynamical) important models.Simultaneously, SN also is capsid protein target inactivation of virus (cap sidtargeted viral inactivation, the antiviral agent that CTVI) is most widely used in the strategy.
At present at home and abroad the bacterium shadow prepare aspect existing a lot of successful precedents, but general bacterium shadow carrier is only used the E gene, and lysis efficiency is difficult to raising.
Summary of the invention:
The present invention discloses a kind of bacteria ghost vector PMAL-E-SN, makes E gene and SN gene obtain to efficiently express.
The present invention also provides the construction process of bacteria ghost vector PMAL-E-SN, has improved the lysis efficiency of preparation intestinal bacteria bacterium shadow.
The present invention further provides the application of bacteria ghost vector PMAL-E-SN in preparation intestinal bacteria bacterium shadow.
The invention discloses the method for utilizing bacteria ghost vector PMAL-E-SN to prepare intestinal bacteria O138 bacterium shadow.
Bacteria ghost vector PMAL-E-SN of the present invention is characterized in that: be made up of E gene, SN gene and plasmid vector PMAL-p2X.
Bacteria ghost vector PMAL-E-SN construction process of the present invention is as follows:
With PhiX174 phage RFI plasmid is that template is carried out pcr amplification, obtains the E gene; With streptococcus aureus type strain ATCC25923 genomic dna is that template is carried out pcr amplification, obtains the SN gene; With 15 amino acid whose Linker polyphone E genes of flexibility and SN gene, obtain the E-SN gene; E-SN gene PCR amplified production is connected with the pMD18-T carrier, screening positive plasmid pT-E-SN order-checking; Make up bacteria ghost vector PMAL-E-SN with plasmid vector PMAL-p2X and the correct recombinant plasmid pT-E-SN of order-checking.
Bacteria ghost vector PMAL-E-SN of the present invention can be used to prepare intestinal bacteria bacterium shadow.
Utilize the intestinal bacteria O138 bacterium shadow of bacteria ghost vector PMAL-E-SN preparation, may further comprise the steps: bacteria ghost vector PMAL-E-SN is transformed into enterobacteria TB1 and O
138In, make up the recombinant bacterial strain TB1 and the O that comprise bacteria ghost vector PMAL-E-SN
138With 37 ℃ of shaking culture of recombinant bacterial strain during to OD600=0.4, the IPTG that adds final concentration and be 1mmol/L induces, and 37 ℃ are continued shaking culture 4h, are prepared into intestinal bacteria O138 bacterium shadow.
Intestinal bacteria O138 bacterium shadow immunization experiment animal with the present invention's preparation can stimulate body to produce anti-O
138Specific humoral immunity and cellular immunization, comparing with the formalin-inactivated seedling has identical protection ratio.
Positively effect of the present invention is:
The present invention is on the basis of E gene, introduce the less important gene SN that kills and wounds, and associating E gene and SN gene be connected into efficient expression vector PMAL-p2X, successfully constructed bacteria ghost vector PMAL-E-SN, obtain good effect, can be widely used in the preparation of intestinal bacteria bacterium shadow.Improved the lysis efficiency of preparation intestinal bacteria bacterium shadow, lysis efficiency can reach 99.99%.
Description of drawings
Fig. 1 is the structure schema of bacteria ghost vector PMAL-E-SN;
Fig. 2,3 is an intestinal bacteria O138 bacterium shadow TEM photo (13000 *);
Fig. 4 detects the serum IgG antibody level for indirect ELISA.
Embodiment
By following examples the present invention is described for example further, and do not limit the present invention in any way, under the prerequisite that does not deviate from technical solution of the present invention, any change or change that those of ordinary skills that the present invention did are realized easily all will fall within the claim scope of the present invention.
Experiment material: restriction enzyme, PhiX174 phage RFI plasmid, pMD18T cloning vector are available from Takara company, plasmid vector carrier PMAL-p2X available from identifying institute by Chinese pharmaceutical biological product, causes baby pig edema reference culture O available from New England Biolabs company, streptococcus aureus type strain ATCC25923
138Available from China Veterinary Drugs Supervisory Inst..
Embodiment 1
The structure of bacteria ghost vector PMAL-E-SN (according to Fig. 1)
1. design of primers is with synthetic:
According to the PhiX174 phage splitting gene E that delivers on the Genebank (sequence number: 9626372) and streptococcus aureus nuclease A (sequence number: 21281729) design primer: E1, E2, SN1 and SN2, design respectively 5 and 15 flexible amino acid Linker primer (E2 ', SN1 ', E2 " and SN2 ") lysis genes E and SN gene are contacted.Italic is the Linker part, and all primers are synthetic by Shanghai bio-engineering corporation.
PCR reacts the primer
2.E the pcr amplification of gene:
With PhiX174 phage RFI plasmid is that template is carried out pcr amplification: 94 ℃ of pre-sex change 3min, and 94 ℃ of sex change 45s, 54 ℃ of annealing 30s, 72 ℃ are extended 1min, 30 circulations, 72 ℃ are extended 10min.Get PCR product 5 μ L after the end, 1% agarose gel electrophoresis is identified.
3.SN the pcr amplification of gene:
Extracting streptococcus aureus type strain ATCC25923 bacterial genomes DNA, is that template is carried out pcr amplification according to designed primer with its DNA: 94 ℃ of pre-sex change 3min, 94 ℃ of sex change 45s, 55 ℃ of annealing 30s, 72 ℃ are extended 1min, 30 circulations, and 72 ℃ are extended 10min.Get the PCR product after the end, 1% agarose gel electrophoresis is identified.
4. dual-gene polyphone:
E1, E2 ', SN1 ', SN2 be increase respectively E and SN gene of primer each other; Be the polyphone gene E-5L-SN of five flexible amino acid Linker of primer amplification band again with E1, SN2; E1, E2 ", SN1 ", SN2 increase respectively E and SN gene of primer each other; Be the polyphone gene E-15L-SN of 15 flexible amino acid Linker of primer amplification again with E1, SN2.The touchdown PCR amplifying target genes, reaction conditions: 94 ℃ of pre-sex change 3min; 94 ℃ of sex change 45s, 60 ℃ of annealing 90s, 0.5 ℃ of every cycle down, 72 ℃ are extended 1min, 20 circulations; 94 ℃ of sex change 45s again, 55 ℃ of annealing 90s, 72 ℃ are extended 1min, 30 circulations, 72 ℃ are extended 10min.
5. the clone of goal gene and evaluation:
E, the SN gene, PCR products such as E-SN gene reclaim test kit with glue and reclaim, and are connected with the pMD18-T carrier, transform DH5 α competent cell, at the dull and stereotyped enterprising row filter of LB (Amp 50 μ g/mL).The picking white colony is inoculated in LB (the Amp 50 μ g/mL) substratum and cultivates, and extracts plasmid.Then recombinant plasmid is carried out the PCR evaluation and cut evaluation with enzyme.
6. the order-checking of goal gene:
Positive recombinant plasmid send the precious biotech firm in Dalian to carry out sequencing.Applied analysis software is analyzed the E gene and the SN gene order of reading in the frame, and compares with known array.(E, the sequencing result of SN gene and E-SN gene is seen the gene order table)
7. goal gene is connected with carrier:
Cut expression vector PMAL-p2X and positive recombinant clone plasmid pT-E, pT-E-5L-SN, pT-E-15L-SN respectively with restriction enzyme EcolRI, SalI, reclaim corresponding purpose carrier segments and gene and be inserted into fragment.16 ℃ of connections of spending the night of T4 ligase enzyme transform and identify same cloned plasmids.Positive colony plasmid PMAL-E, PMAL-E-5L-SN and PMAL-E-15L-SN further transform the TB1 competent cell.
8. the expression of bacterium shadow carrier in the host bacterium:
Recombinant bacterial strain TB1 (PMAL-E, PMAL-E-5L-SN and PMAL-E-15L-SN) spend the night increase bacterium after, be inoculated in 100ml LB (the Amp 50 μ g/mL) substratum by 0.5% commentaries on classics, 37 ℃ of shaking culture to A600 values are 0.4 o'clock, add IPTG (final concentration 1mmol/L), simultaneously add CaCl2 and MgCl2 in addition, make Ca
2+And Mg
2+Final concentration is respectively 10 and 1mmol/L.37 ℃ of shaking culture, the A600 value is surveyed in every 1h sampling, observes the cracking level of bacterium.To the bacterium before and after inducing suitably dilution carry out live bacterial count (CFU, individual/as ml), to calculate cleavage rate: cleavage rate=(1-induce back CFU)/induce preceding CFU * 100%.As calculated, the lysis efficiency of bacterium shadow carrier PMAL-E-15L-SN is the highest, can reach 99.99%, abbreviates PMAL-E-SN as, and selected PMAL-E-SN is the carrier of preparation bacterium shadow.
Embodiment 2
Intestinal bacteria O
138The preparation of bacterium shadow
1. electric transformed into escherichia coli O
138The preparation of competent cell:
Get the E.Coli O of-80 ℃ of preservations
138Bacterial strain is coated LB and is cultivated 24h for dull and stereotyped 37 ℃, picking list bacterium colony, shaking culture 12-14h (about OD
600Value reaches 0.7, inoculates in the fresh LB substratum of 200mL, and 37 ℃ of shaking culture are to OD
600Between 0.1-0.2; Take out, ice bath 30min, electric shock transforms culture medium C YT and places simultaneously on ice; 4 ℃, the centrifugal 10min of 5 000rpm is with the abundant resuspended precipitation of CYT of 30mL ice bath; 4 ℃, the centrifugal 10min of 5 000rpm abandons supernatant, with the abundant resuspended precipitation of the CYT of 500 μ L ice baths.
2. electroporation transformed into escherichia coli O
138:
Bacteria ghost vector PMAL-E-SN is got 20 μ L, the intestinal bacteria O above-mentioned with 80 μ L
138The competent cell mixing is put into the 0.2cm electricity revolving cup of ice precooling, and ice bath 5min shocks by electricity on the electric shock instrument, and condition is voltage 1500V, and capacitance is 25 μ F, resistance 200 Ω,〉100ms, continuous 5 pulses.After the electric shock, add 1mL LB nutrient solution immediately, hatch 1-2h for 37 ℃, coating LB (Amp 50 μ g/mL) flat board places 37 ℃ of static cultivations to cultivate 24h.The bacterium colony that picking transforms extracts plasmid and does PCR and double digestion evaluation.
3. intestinal bacteria O
138The preparation of bacterium shadow:
Recombinant bacterial strain O
138(PMAL-E-SN) spend the night increase bacterium after, change to be inoculated in 100ml LB (the Amp50 μ g/mL) substratum by 0.5%, 37 ℃ of shaking culture to A600 values are 0.4 o'clock, add IPTG (final concentration 1mmol/L), the while adds CaCl2 and MgCl2 in addition, makes Ca
2+And Mg
2+Final concentration is respectively 10 and 1mmol/L.37 ℃ of shaking culture, the A600 value is surveyed in every 1h sampling, observes the cracking level of bacterium.Lysis efficiency is 99.99% after measured.
4. the transmission electron microscope of bacterium shadow (TEM) is observed:
Bacterium liquid 4000g * 10min of 4h is centrifugal with inducing, and physiological saline washing 3 times is inserted in 2.5% the glutaraldehyde solution and fixed, and puts 4 ℃ of following 2h, and ethanol dewaters step by step, and step process such as embedding medium embedding are observed under TEM.Intestinal bacteria O
138(PMAL-E-SN) induce the bacterium liquid processing back of 4h to observe under TEM, cracking in various degree takes place in thalline, and the bacterium shadow is the cavity shape, complete form, adventitia and cracking bacterium no significant difference not, and intracellular organic matter has been discharged, show that the bacterium shadow prepares successfully, the results are shown in Figure 2 and Fig. 3.
5. the preservation of bacterium shadow:
Relatively the lysis efficiency of each recon is chosen the highest expression system of lysis efficiency great expression under best inductive condition, in the centrifugal collection of cellular lysate vertex bacterium shadow cell.Abandon most supernatant, repeat to wash twice with physiological saline.Be dissolved in proper volume distilled water at last, calculate bacterium shadow concentration, be sub-packed in 1.5mL vaccine bottle, (contain bacterium shadow 5.0 * 10 about every bottle 800 μ L
10Individual/as mL), highly to be no more than 0.5cm, be stored in-80 ℃ after the lyophilize.
Embodiment 3
The immune effect evaluation of intestinal bacteria O138 bacterium shadow vaccine and formalin-inactivated seedling
1. intestinal bacteria O
138The preparation of bacterium shadow
Get freeze-drying intestinal bacteria O
138The bacterium shadow is resuspended in proper volume physiological saline, and making bacterium shadow concentration is 5.0 * 10
10Individual/mL, abundant mixing.
2. the preparation of formalin-inactivated aluminium adjuvant seedling
With intestinal bacteria O
138Pure choosing on common LB flat board is inoculated in the LB liquid nutrient medium and is prepared into kind of a daughter bacteria liquid behind 37 ℃ of cultivation 18-24h, is inoculated in the LB liquid nutrient medium, take out behind 37 ℃ of cultivation 18-24h and carry out live bacterial count on a small quantity, all the other bacterium liquid add formaldehyde by 0.1%, 37 ℃ of deactivation 24h, and 4 ℃ of preservations are standby.5000rpm is centrifugal during use, and after washing twice with physiological saline, adds aluminium hydroxide gel in the 1:5 ratio, and fully vibration is formalin-inactivated aluminium adjuvant seedling.
3. steriling test
With prepared intestinal bacteria O
138Bacterium shadow and the stochastic sampling of formalin-inactivated aluminium adjuvant seedling are got 200uL respectively and are inoculated in the LB flat board, cultivate 48h for 37 ℃, check to have or not bacterial growth.Through check intestinal bacteria O
138Bacterium shadow and formalin-inactivated aluminium adjuvant seedling all do not have bacterial growth, are up to the standards.
4. safety examination
Get 10 18-22g mouse, every abdominal injection intestinal bacteria O
138Bacterium shadow, injected dose are about 10 times of immunizing dose, observe 7-10d continuously; Intestinal bacteria O
138Formalin-inactivated aluminium adjuvant seedling is the same.Abdominal injection intestinal bacteria O
138Mouse does not have death and disease symptom behind bacterium shadow and the formalin-inactivated aluminium adjuvant seedling, and liver organization contact microscopy no pathogenicity intestinal bacteria show intestinal bacteria O
138Bacterium shadow and formalin-inactivated aluminium adjuvant seedling safety are qualified.
5. immunization experiment
The mouse random packet, 10 every group, inoculate not that synantigen carries out immunity, the blank group is exempted from same dose physiological saline, sub-cage rearing under the same terms, immune programme for children sees the following form.
The immunization experiment grouping
6. the detection of immune level
Indirect elisa method detects antibody titer, and the splenic lymphocyte conversion test detects cellular immune level.
Serum antibody level detection result: indirect ELISA regularly detects serum IgG antibody and tires and see Fig. 4, abdominal injection intestinal bacteria O behind the immune mouse
138The serum IgG antibody level with formalin-inactivated aluminium adjuvant seedling of bacterium shadow is higher, and the time that head is exempted from is decided to be 0d, and three immunity back antibody titers reach 3000 * more than, intestinal bacteria O
138The oral mucosal immunity antibody titer of bacterium shadow is low slightly, be up to 1600 *.
Splenic lymphocyte conversion test result: the results are shown in following table, immune group and stimulating group all have tangible cell increment than control group, wherein use intestinal bacteria O
138The bacterium shadow is done stimulates abdominal injection bacterium shadow and the no significant difference of the SI value formalin-inactivated seedling in former, and between 1.6～1.8, bacterium shadow oral immunity group is low slightly, and about 1.0, mitogen ConA stimulating group IS value is the highest, also more stable in each is organized, about 2.0.
Splenic lymphocyte conversion test result
7. attack the poison experiment
Three exempt from one week of back, and the viable bacteria of 3 times of minimum lethal doses of mouse peritoneal injection carries out heavy dose of infection experiment, and the mouse survival condition is counted, and detects the protection effect of vaccine.
Three times immunity back immunoprotection the results are shown in following table, and the protection ratio of abdominal injection bacterium shadow and the protection ratio of formalin-inactivated seedling all reach 100%, and the oral mucosal immunity protection ratio of bacterium shadow is 70%, and the blank group is all dead.
Vaccine immunity protection measurement result
The gene order table
The nucleotide sequence of E gene:
5’-ATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCC
TGTTGAGTTTATTGCTGCCGTCATTGCTTATTATGTTCATCCCGTC
AACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTAC
GGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTG
AATTGTTCGCGTTTACCTTGCGTGTACGCGCAGGAAACACTGAC
GTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTG
CGGAAG?GAGTGA-3’
The nucleotide sequence of SN gene:
5’-GCAACTTCAACTAAAAAATTACATAAAGAACCTGCGACATTA
ATTAAAGCGATTGATGGTGATACTGTTAAATTAATGTACAAAGGT
CAACCAATGACATTCAGACTATTATTGGTTGATACACCTGAAAC
AAAGCATCCTAAAAAAGGTGTAGAGAAATATGGTCCTGAAGCA
AGTGCATTTACGAAAAAGATGGTAGAAAATGCAAAGAAAATTG
AAGTCGAGTTTGACAAAGGTCAAAGAACTGATAAATATGGACG
TGGCTTAGCGTATATTTATGCTGATGGAAAAATGGTAAACGAAG
CTTTAGTTCGTCAAGGCTTGGCTAAAGTTGCTTATGTTTATAAAC
CTAACAATACACATGAACAACTTTTAAGAAAAAGTGAAGCACA
AGCGAAAAAAGAGAAATTAAATATTTGGAGCGAAGACAACGCT
GATTCAGGTCAATAA-3’
The nucleotide sequence of E-SN gene:
TCCTGCTCCTGTTGAGTTTATTGCTGCCGTCATTGCTTATTATGTT
CATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGC
TGAATTTACGGAAAACATTATTAATGGCGTCGAGCGTCCGGTTA
AAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTACGCGCAGGA
AACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAA
AATTACGTGCGGAAG
AAAGAACCTGCGACATTAATTAAAGCGATTGATGGTGATACTGT
TAAATTAATGTACAAAGGTCAACCAATGACATTCAGACTATTATT
GGTTGATACACCTGAAACAAAGCATCCTAAAAAAGGTGTAGAG
AAATATGGTCCTGAAGCAAGTGCATTTACGAAAAAGATGGTAG
AAAATGCAAAGAAAATTGAAGTCGAGTTTGACAAAGGTCAAA
GAACTGATAAATATGGACGTGGCTTAGCGTATATTTATGCTGATG
GAAAAATGGTAAACGAAGCTTTAGTTCGTCAAGGCTTGGCTAA
AGTTGCTTATGTTTATAAACCTAACAATACACATGAACAACTTTT
AAGAAAAAGTGAAGCACAAGCGAAAAAAGAGAAATTAAATAT
TTGGAGCGAAGACAACGCTGATTCAGGTCAATAA
GTCGACGC-3’
Black italic: downstream primer; Black italic in the frame: upstream and downstream primer repeating part;
Restriction enzyme site: start for EcoR I (GAATTC), end up and establish the protection base for Sal I (GTCGAC)
Claims (4)
1, a kind of bacteria ghost vector PMAL-E-SN is characterized in that: be made up of E gene, SN gene and plasmid vector PMAL-p2X.
2, the construction process of the described bacteria ghost vector PMAL-E-SN of claim 1 is as follows: with PhiX174 phage RFI plasmid is that template is carried out pcr amplification, obtains the E gene; With streptococcus aureus type strain ATCC25923 genomic dna is that template is carried out pcr amplification, obtains the SN gene; With 15 amino acid whose Linker polyphone E genes of flexibility and SN gene, obtain the E-SN gene; E-SN gene PCR amplified production is connected with the pMD18-T carrier, screening positive plasmid pT-E-SN order-checking; Make up bacteria ghost vector PMAL-E-SN with plasmid vector PMAL-p2X and the correct recombinant plasmid pT-E-SN of order-checking.
3, the application of the bacteria ghost vector PMAL-E-SN of claim 1 in preparation intestinal bacteria bacterium shadow.
4, utilize the intestinal bacteria O138 bacterium shadow of the described bacteria ghost vector PMAL-E-SN preparation of claim 1, may further comprise the steps: bacteria ghost vector PMAL-E-SN is transformed into enterobacteria TB1 and O
138In, make up the recombinant bacterial strain TB1 and the O that comprise bacteria ghost vector PMAL-E-SN
138With 37 ℃ of shaking culture of recombinant bacterial strain during to OD600=0.4, the IPTG that adds final concentration and be 1mmol/L induces, and 37 ℃ are continued shaking culture 4h, are prepared into intestinal bacteria O138 bacterium shadow.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA200810051489XA CN101457231A (en) | 2008-11-28 | 2008-11-28 | Construction of bacteria ghost vector PMAL-E-SN and its application in bacillus coli |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA200810051489XA CN101457231A (en) | 2008-11-28 | 2008-11-28 | Construction of bacteria ghost vector PMAL-E-SN and its application in bacillus coli |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101457231A true CN101457231A (en) | 2009-06-17 |
Family
ID=40768351
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA200810051489XA Pending CN101457231A (en) | 2008-11-28 | 2008-11-28 | Construction of bacteria ghost vector PMAL-E-SN and its application in bacillus coli |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101457231A (en) |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101934072A (en) * | 2010-03-24 | 2011-01-05 | 天津农学院 | Method for preparing actinobacillus pleuropneumoniae (App) bacterial ghost and method for preparing subunit vaccine by loading pasteurella antigen with App bacterial ghost |
| CN101683524B (en) * | 2009-07-15 | 2012-03-28 | 吉林大学 | Method for preparing bacterial ghost by combination of antibacterial peptide and ultrahigh pressure and application thereof |
| CN102586307A (en) * | 2012-03-02 | 2012-07-18 | 山东师范大学 | Chlorampenicol resistant temperature controlled lytic plasmid, its construction and application in bacterial ghost preparation |
| CN103146732A (en) * | 2013-01-28 | 2013-06-12 | 山东省农业科学院畜牧兽医研究所 | Efficient splitting tandem gene, efficient splitting plasmid and construction method and appliance |
| CN103436550A (en) * | 2013-07-26 | 2013-12-11 | 黑龙江八一农垦大学 | Construction method of bacterial ghost carrier |
| RU2564110C2 (en) * | 2010-08-06 | 2015-09-27 | Вернер Проф. Др. ЛЮБИТЦ | Application of bacterial ghosts for mediated stimulation of innate immunity |
| CN108324956A (en) * | 2018-03-06 | 2018-07-27 | 东北农业大学 | It is a kind of using Escherichia coli bacterium shadow as the preparation method of carrier load taxol drug |
| CN112410360A (en) * | 2021-01-18 | 2021-02-26 | 西南大学 | Chicken pathogenic bacterium ghost and preparation method and application thereof |
-
2008
- 2008-11-28 CN CNA200810051489XA patent/CN101457231A/en active Pending
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101683524B (en) * | 2009-07-15 | 2012-03-28 | 吉林大学 | Method for preparing bacterial ghost by combination of antibacterial peptide and ultrahigh pressure and application thereof |
| CN101934072A (en) * | 2010-03-24 | 2011-01-05 | 天津农学院 | Method for preparing actinobacillus pleuropneumoniae (App) bacterial ghost and method for preparing subunit vaccine by loading pasteurella antigen with App bacterial ghost |
| RU2564110C2 (en) * | 2010-08-06 | 2015-09-27 | Вернер Проф. Др. ЛЮБИТЦ | Application of bacterial ghosts for mediated stimulation of innate immunity |
| CN102586307A (en) * | 2012-03-02 | 2012-07-18 | 山东师范大学 | Chlorampenicol resistant temperature controlled lytic plasmid, its construction and application in bacterial ghost preparation |
| CN102586307B (en) * | 2012-03-02 | 2014-07-09 | 山东师范大学 | Chlorampenicol resistant temperature controlled lytic plasmid, its construction and application in bacterial ghost preparation |
| CN103146732A (en) * | 2013-01-28 | 2013-06-12 | 山东省农业科学院畜牧兽医研究所 | Efficient splitting tandem gene, efficient splitting plasmid and construction method and appliance |
| CN103436550A (en) * | 2013-07-26 | 2013-12-11 | 黑龙江八一农垦大学 | Construction method of bacterial ghost carrier |
| CN103436550B (en) * | 2013-07-26 | 2015-04-15 | 黑龙江八一农垦大学 | Construction method of bacterial ghost carrier |
| CN108324956A (en) * | 2018-03-06 | 2018-07-27 | 东北农业大学 | It is a kind of using Escherichia coli bacterium shadow as the preparation method of carrier load taxol drug |
| CN112410360A (en) * | 2021-01-18 | 2021-02-26 | 西南大学 | Chicken pathogenic bacterium ghost and preparation method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Gunasekaran et al. | A review on edible vaccines and their prospects | |
| CN101457231A (en) | Construction of bacteria ghost vector PMAL-E-SN and its application in bacillus coli | |
| CN104593397B (en) | A kind of enterotoxigenic escherichia coil polyvalent antigen gene order of optimization and its application in preventing post-weaning diarrhea | |
| US8142771B2 (en) | Use of coccidian | |
| CN104693310B (en) | A kind of chimeric protein, virus-like particle and its application | |
| CN106928373A (en) | A kind of porcine mycoplasmal pneumonia multi-epitope mucosal vaccine | |
| CN102274496B (en) | O/Asia I type foot and mouth disease virus bivalent genetic engineering polypeptide vaccine, its preparation method and its purpose | |
| CN106434728A (en) | Recombinational bacillus subtilis of expressing highly pathogenic avian influenza H5N1 hemagglutinin HA protein | |
| CN101880647A (en) | Recombinant salmonella choleraesuis, bivalent genetic engineering vaccine and application | |
| CN104530230B (en) | A kind of duck hepatitis A virus VP1 GFPs and its application | |
| CN101638661B (en) | Construction of recombinant lactic acid bacteria with HN gene and F gene of Newcastle disease virus | |
| CN116003537B (en) | Rhabdovirus recombinant G protein, recombinant cell comprising rhabdovirus recombinant G protein and application of rhabdovirus recombinant G protein | |
| CN108410784B (en) | Streptococcus suis delta CPS/SsnA-mSly (P353L) -SC19 engineering bacteria and application thereof in vaccines | |
| CN102847168B (en) | The design of a kind of nucleic acid vaccine PV-Fn preventing bovine mastitis and structure thereof | |
| CN109021115A (en) | A kind of pig circular ring virus trivalent subunit vaccine | |
| CN100435844C (en) | Use of escherichia coli heat labile toxin as an adjuvant in birds and poultry | |
| CN105497885B (en) | A kind of subunit vaccine and its preparation method and application | |
| CN103446581B (en) | Method for preparing bacterial ghost vaccine of haemophilus parasuis as well as product and application thereof | |
| CN101962625A (en) | Salmonella choleraesuis gene deletion mutant without resistant marker and vaccine thereof | |
| CN113046384A (en) | Construction method of broad-spectrum antiviral recombinant salmonella | |
| CN103421729B (en) | Gene recombined swine cholera salmonella choleraesuis vaccine for blue-ear disease and application thereof | |
| CN102676570B (en) | Recombinant bacillus subtilis immunoglobulin binding protein functional-domain expression vector and application thereof | |
| CN111100833A (en) | Recombinant strain for expressing outer membrane protein of Edwardsiella ictaluri, preparation method and application | |
| CN107119064A (en) | Recombined bacillus subtilis expressing in series avian influenza virus HA antigen fragments and PB1-F2 albumen | |
| CN116731982B (en) | Duck plague herpesvirus gene deletion attenuated vaccine strain, construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Open date: 20090617 |