CN110755605A - Flavobacterium columnare transgenic engineering oral vaccine, use method and application - Google Patents

Flavobacterium columnare transgenic engineering oral vaccine, use method and application Download PDF

Info

Publication number
CN110755605A
CN110755605A CN201910914742.8A CN201910914742A CN110755605A CN 110755605 A CN110755605 A CN 110755605A CN 201910914742 A CN201910914742 A CN 201910914742A CN 110755605 A CN110755605 A CN 110755605A
Authority
CN
China
Prior art keywords
lip
pbe2r
flavobacterium columnare
bacillus subtilis
strain
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201910914742.8A
Other languages
Chinese (zh)
Inventor
罗璋
张振国
郝爽
白晓慧
冯守明
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tianjin Fisheries Research Laboratory
Original Assignee
Tianjin Fisheries Research Laboratory
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tianjin Fisheries Research Laboratory filed Critical Tianjin Fisheries Research Laboratory
Priority to CN201910914742.8A priority Critical patent/CN110755605A/en
Publication of CN110755605A publication Critical patent/CN110755605A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/02—Bacterial antigens
    • A61K39/0208—Specific bacteria not otherwise provided for
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/52—Bacterial cells; Fungal cells; Protozoal cells
    • A61K2039/523—Bacterial cells; Fungal cells; Protozoal cells expressing foreign proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/54—Medicinal preparations containing antigens or antibodies characterised by the route of administration
    • A61K2039/541—Mucosal route
    • A61K2039/542—Mucosal route oral/gastrointestinal
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
    • A61K2039/552—Veterinary vaccine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Veterinary Medicine (AREA)
  • Plant Pathology (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Oncology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Communicable Diseases (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention relates to a flavobacterium columnare transgenic engineering oral vaccine which is prepared by ⑴ analysis of mature peptide fragment sequence of protective antigen gene lip of flavobacterium columnare, construction of ⑵ shuttle plasmid, screening of ⑶ recombinant strain, culture of ⑷ recombinant strain and preparation of ⑸ into oral vaccine.

Description

Flavobacterium columnare transgenic engineering oral vaccine, use method and application
Technical Field
The invention belongs to the technical field of molecular biology and aquatic products, relates to aquatic animal immunology, and particularly relates to an oral vaccine for flavobacterium columnare transgenic engineering, a use method and application.
Background
Flavobacterium columnare a world-wide pathogenic bacterium of aquatic animals, and are gram-negative bacilli. The host range is very wide, fishes in families including Cyprinidae, Perch, catfish, Salmonidae, Suidae, mullet and the like can be infected, and almost all freshwater fishes are sensitive to the fishes. In China, flavobacterium columnare mainly harmful to fishes such as grass carp, mandarin fish, channel catfish, loach, goldfish and the like, and the caused columniform disease is the bacterial disease with the highest morbidity of freshwater fishes, thereby causing serious harm to the aquaculture industry in China.
At present, the cylindrical diseases are mainly prevented and treated by using chemical drugs such as antibiotics, disinfectants and the like, and certain effects are achieved, but the problems caused by long-term use and messy use of the antibiotics are gradually brought into the attention of people. In the aquaculture-developed countries such as norway, usa and japan, chemical drugs are gradually limited or forbidden in aquaculture industry, and development of new control methods is urgently needed. Compared with other prevention and treatment approaches, the method for immune prevention and treatment by using the vaccine has the irreplaceable advantages of strong pertinence, obvious effect, no toxicity, no harm, long disease-resistant period and the like, accords with the concepts of high efficiency, greenness and environmental protection, and is increasingly valued by people.
With regard to the study of Flavobacterium columnare vaccines, there are currently three main reports in the prior art:
(1) flavobacterium columnare inactivated vaccine
Inoculating Flavobacterium columnare strain in shieh culture medium, culturing at 25 deg.C by shaking culture to a plateau phase, centrifuging to collect bacteria, and diluting to a certain concentration with normal saline. Phenol with the final concentration of 2% or formalin with the final concentration of 0.5% is added into the bacterial liquid for inactivation for 24 hours at 25 ℃, and the flavobacterium columnare inactivated vaccine is obtained.
(2) Flavobacterium columnare attenuated live vaccine
Repeatedly passaging the flavobacterium columnare in shieh culture medium containing rifampicin, after 243 passages, the content of rifampicin in the culture medium is gradually increased from 5 mu g/mL to 200 mu g/mL, the flavobacterium columnare resistant to rifampicin, the pathogenicity of the flavobacterium columnare is gradually weakened, the flavobacterium columnare with weakened toxicity, and the bacterium concentration is adjusted by physiological saline, so that the flavobacterium columnare attenuated live vaccine.
(3) Flavobacterium columnare recombinant subunit vaccine
Protective antigen genes of flavobacterium columnare subjected to PCR amplification and are connected with an expression vector, then the genes are transferred into an escherichia coli expression strain DE3, an IPTG is utilized to induce a recombinant strain, the induced bacteria are collected and ultrasonically crushed, recombinant proteins are collected and purified, and the recombinant subunit vaccine of flavobacterium columnis is obtained after the recombinant subunit vaccine is diluted to a certain concentration.
The Flavobacterium columnare inactivated vaccine has complex components and low stability, and can cause partial loss of protein immunogenicity in the inactivation process to influence the immune effect. The flavobacterium columnare attenuated live vaccine has the risk of reversion and potential safety hazard. The preparation of the flavobacterium columnare recombinant subunit vaccine is complicated, injection immunization is needed, and the practical operation process is difficult.
Through searching, the following patent publications related to the patent application of the invention are found:
a preparation method of flavobacterium columnare gene recombinant vaccine (CN103495159A) comprises the following steps: (1) constructing an expression vector; (2) expression and purification of the target protein; (3) and adjusting the concentration of the purified protein to obtain the directly-used flavobacterium columnare gene recombinant subunit vaccine. The vaccine prepared by the invention has the advantages of high safety, stable immune effect, high production efficiency and the like.
By contrast, the preparation method (CN103495159A) of the flavobacterium columnare gene recombinant vaccine is an injection type oral vaccine, the tail-by-tail injection is needed to be carried out on the fish body, the operation is troublesome, and the workload is large.
Disclosure of Invention
The invention aims to overcome the defects in the prior art and provides a flavobacterium columnare transgenic engineering oral vaccine, a use method and application.
The technical scheme adopted by the invention for solving the technical problems is as follows:
a Flavobacterium columnare transgenic engineering oral vaccine is prepared by the following steps:
⑴, analyzing a mature peptide sequence of protective antigen gene lip of flavobacterium columnare, artificially synthesizing the mature peptide sequence of the lip gene according to the codon preference of bacillus subtilis, adding Pst I and SphI enzyme cutting sites at two ends of the sequence respectively, adding 2 bases at the N end to ensure that the sequence is not shifted, removing a stop codon TAA at the C section, and obtaining the synthesized lip gene sequence of SEQ NO.1 which is 760bp in total;
⑵, after the lip gene sequence artificially synthesized in the step ⑴ is subjected to double enzyme digestion by Pst I and SphI restriction enzymes, the artificially synthesized lip gene sequence is connected with a vector pBE2R subjected to double enzyme digestion by the same restriction enzymes to construct a shuttle plasmid pBE 2R-lip;
⑶ shuttle plasmid pBE2R-lip constructed in step ⑵ was transferred into Bacillus subtilis WB800Screening to obtain WB800(pBE2R-lip) strain;
⑷ WBs obtained by screening in step ⑶800(pBE2R-lip) the strain was inoculated in an LB medium containing 50. mu.g/mL kanamycin at an inoculum size of 1:100 by volume, cultured at 37 ℃ at 200rpm/min for 48 hours, and then centrifuged to collect the bacteria;
⑸ bacteria collected in step ⑷ was added at 3.0X 108And (3) uniformly spraying the CFU/feed into the feed, drying in the shade, and preparing into an oral vaccine, namely the flavobacterium columnare transgenic engineering oral vaccine.
The preparation method comprises the following specific steps:
⑴ downloading Flavobacterium columnare lip gene sequence from Genbank, analyzing the signal peptide by using on-line software to obtain the mature peptide sequence of lip gene, synthesizing the mature peptide sequence of Flavobacterium columnare lip gene according to the preference of Bacillus subtilis codon, adding Pst I and SphI enzyme cutting sites at two ends respectively, and ensuring the sequence not to shift codes by adding 2 bases at the front end, removing termination codon TAA, the synthesized sequence is shown as SEQ NO.1, and the total number is 760 bp;
⑵ double digestion of artificially synthesized lip gene fragment
The digestion system per 20. mu.L was as follows:
Figure BDA0002215752010000031
after enzyme digestion for three hours, denaturation is carried out for 10min at 65 ℃, and electrophoresis gel cutting is carried out for recovery;
⑶ the expression fragment after double digestion was ligated to pBE2R vector digested simultaneously with the same endonuclease, in 10. mu.L:
Figure BDA0002215752010000032
ligation was carried out overnight at 16 ℃;
⑷ transforming TOP10 competent cell with the ligation product, PCR screening recombinant clone, selecting positive clone, sequencing to check the correctness of gene sequence;
⑸ the positive clone is inoculated into LB liquid culture medium containing 50 ug/mL kanamycin in a volume of 1:100, and is shake-cultured at 37 ℃ and 200rpm on a constant temperature shaking table until OD is reached600Collecting bacteria, and extracting a plasmid pBE2R-lip by using a bacterial plasmid extraction kit, wherein the number of the bacteria is 0.8-1.0;
⑹ Bacillus subtilis WB800Streaking the strain on an LB (Langmuir-Blodgett) plate containing 1 mu g/mL of erythromycin, and culturing overnight in an incubator at 37 ℃; on the next day, a single colony was picked up in LB medium containing 1. mu.g/mL erythromycin, and OD was cultured by shaking at 37 ℃ with a shaker at 200rpm6000.8-1.0, adding xylose with the final mass concentration of 1%, and continuously culturing for 2h to prepare the Bacillus subtilis WB800Competent cells of the strain;
⑺ transformation of plasmid pBE2R-lip into Bacillus subtilis WB800Competent cells, PCR screening, recombinant cloning, and selecting positive clone to construct Bacillus subtilis WB800(pBE2R-lip) strain;
⑻ Bacillus subtilisBacterium WB800(pBE2R-lip) after the activation of the strain, inoculating the activated strain in LB medium containing 50. mu.g/mL kanamycin at a volume ratio of 1:100, culturing at 37 ℃ for 48 hours at 200rpm, calculating the concentration of bacteria, and centrifuging to collect the bacteria;
⑼ collected Bacillus subtilis WB800(pBE2R-lip) adjusted to a concentration of 3X 10 with PBS9CFU/mL; uniformly spraying 1 part of the bacterial liquid on the surface of 10 parts of the feed according to the mass ratio to ensure that the content of the bacillus subtilis WB800(pBE2R-lip) in the feed is 3 multiplied by 108CFU/g;
⑽ drying the feed sprayed with the bacteria liquid in the shade to obtain the oral vaccine.
The flavobacterium columnare transgenic engineering oral vaccine is applied to the aspect of preventing the flavobacterium columnare infection.
Moreover, the fish is grass carp.
The application method of the flavobacterium columnare transgenic engineering oral vaccine comprises the following steps:
when the fry of the year is raised to 5-7cm, the vaccine is adopted for immunization, the immunization mode is oral vaccine, the grass carp is fed according to the feeding amount of 2% of the weight of the grass carp, and the continuous immunization is carried out for 7 days.
Furthermore, after the first immunization, booster immunization was performed once at intervals of 2 weeks, and the immunization dose was the same as that of the first immunization.
The invention has the advantages and positive effects that:
1. the vaccine is an oral vaccine, is inoculated in an oral immunization mode, is more convenient to use than injection immunization and immersion immunization vaccines, saves more labor force and has the advantage of no limitation of the size of a fish body.
2. The vaccine is a vaccine taking bacillus subtilis as a carrier, can be prepared by culturing bacillus and has the characteristics of low production cost and high efficiency.
3. The vaccine can effectively reduce fishery economic loss caused by cylindrical diseases caused by flavobacterium columnare, and lays a foundation for developing fish genetic engineering multi-vaccine in the future.
Drawings
FIG. 1 is a diagram showing the double restriction enzyme digestion verification of plasmid pBE2R-lip according to the present invention; wherein, 1 is after enzyme cutting, and 2 is before enzyme cutting;
FIG. 2 is a selection chart of positive clones in the present invention;
FIG. 3 is an SDS-PAGE electrophoresis of the present invention; wherein, M is marker; 1, WB800(pBE2R-lip) strain supernatant 48h sample; 2, WB800(pBE2R-lip) strain supernatant 24h samples; 3, WB800(pBE2R) strain supernatant 48h samples; 4, WB800(pBE2R) strain supernatant 24h samples; 5, WB800(pBE2R-lip) Strain secreted fluid 48h samples; 6, WB800(pBE2R-lip) strain secreted 24h samples; 7, WB800(pBE2R) strain secretion 48h samples; 8, WB800(pBE2R) strain secretion 24h samples;
FIG. 4 is a diagram showing the detection of the secretion of lip protein by the immunoblotting experiment in the present invention; wherein, M is marker; 1, WB800(pBE2R-lip) strain supernatant 48h sample; 2, WB800(pBE2R-lip) strain supernatant 24h samples; 3, WB800(pBE2R) strain supernatant 48h samples; 4, WB800(pBE2R) strain supernatant 24h samples; 5, WB800(pBE2R-lip) Strain secreted fluid 48h samples; 6, WB800(pBE2R-lip) strain secreted 24h samples; 7, WB800(pBE2R) strain secretion 48h samples; 8, WB800(pBE2R) strain secretion 24h samples;
FIG. 5 is a graph showing the cumulative mortality of grass carp in the test group and the control group within 14 days after artificial infection in the artificial infection test using Flavobacterium columnare strain G4 in the present invention.
Detailed Description
The following detailed description of the embodiments of the present invention is provided for the purpose of illustration and not limitation, and should not be construed as limiting the scope of the invention.
The raw materials used in the invention are conventional commercial products unless otherwise specified; the methods used in the present invention are conventional in the art unless otherwise specified.
A Flavobacterium columnare transgenic engineering oral vaccine is prepared by the following steps:
⑴, analyzing a mature peptide sequence of protective antigen gene lip of flavobacterium columnare, artificially synthesizing the mature peptide sequence of the lip gene according to the codon preference of bacillus subtilis, adding Pst I and SphI enzyme cutting sites at two ends of the sequence respectively, adding 2 bases at the N end to ensure that the sequence is not shifted, removing a stop codon TAA at the C section, and obtaining the synthesized lip gene sequence of SEQ NO.1 which is 760bp in total;
⑵, after the lip gene sequence artificially synthesized in the step ⑴ is subjected to double enzyme digestion by Pst I and SphI restriction enzymes, the artificially synthesized lip gene sequence is connected with a vector pBE2R subjected to double enzyme digestion by the same restriction enzymes to construct a shuttle plasmid pBE 2R-lip;
⑶ shuttle plasmid pBE2R-lip constructed in step ⑵ was transferred into Bacillus subtilis WB800Screening to obtain WB800(pBE2R-lip) strain;
⑷ WBs obtained by screening in step ⑶800(pBE2R-lip) the strain was inoculated in an LB medium containing 50. mu.g/mL kanamycin at an inoculum size of 1:100 by volume, cultured at 37 ℃ at 200rpm/min for 48 hours, and then centrifuged to collect the bacteria;
⑸ bacteria collected in step ⑷ was added at 3.0X 108And (3) uniformly spraying the CFU/feed into the feed, drying in the shade, and preparing into an oral vaccine, namely the flavobacterium columnare transgenic engineering oral vaccine.
Preferably, the preparation method comprises the following steps:
⑴ downloading Flavobacterium columnare lip gene sequence from Genbank, analyzing the signal peptide by using on-line software to obtain the mature peptide sequence of lip gene, synthesizing the mature peptide sequence of Flavobacterium columnare lip gene according to the preference of Bacillus subtilis codon, adding Pst I and SphI enzyme cutting sites at two ends respectively, and ensuring the sequence not to shift codes by adding 2 bases at the front end, removing termination codon TAA, the synthesized sequence is shown as SEQ NO.1, and the total number is 760 bp;
⑵ double digestion of artificially synthesized lip gene fragment
The digestion system per 20. mu.L was as follows:
Figure BDA0002215752010000061
after enzyme digestion for three hours, denaturation is carried out for 10min at 65 ℃, and electrophoresis gel cutting is carried out for recovery;
⑶ the expression fragment after double digestion was ligated to pBE2R vector digested simultaneously with the same endonuclease, in 10. mu.L:
ligation was carried out overnight at 16 ℃;
⑷ transforming TOP10 competent cell with the ligation product, PCR screening recombinant clone, selecting positive clone, sequencing to check the correctness of gene sequence;
⑸ the positive clone is inoculated into LB liquid culture medium containing 50 ug/mL kanamycin in a volume of 1:100, and is shake-cultured at 37 ℃ and 200rpm on a constant temperature shaking table until OD is reached600Collecting bacteria, and extracting a plasmid pBE2R-lip by using a bacterial plasmid extraction kit, wherein the number of the bacteria is 0.8-1.0;
⑹ Bacillus subtilis WB800Streaking the strain on an LB (Langmuir-Blodgett) plate containing 1 mu g/mL of erythromycin, and culturing overnight in an incubator at 37 ℃; on the next day, a single colony was picked up in LB medium containing 1. mu.g/mL erythromycin, and OD was cultured by shaking at 37 ℃ with a shaker at 200rpm6000.8-1.0, adding xylose with the final mass concentration of 1%, and continuously culturing for 2h to prepare the Bacillus subtilis WB800Competent cells of the strain;
⑺ transformation of plasmid pBE2R-lip into Bacillus subtilis WB800Competent cells, PCR screening, recombinant cloning, and selecting positive clone to construct Bacillus subtilis WB800(pBE2R-lip) strain;
⑻ Bacillus subtilis WB800(pBE2R-lip) after the activation of the strain, inoculating the activated strain in LB medium containing 50. mu.g/mL kanamycin at a volume ratio of 1:100, culturing at 37 ℃ for 48 hours at 200rpm, calculating the concentration of bacteria, and centrifuging to collect the bacteria;
⑼ collected Bacillus subtilis WB800(pBE2R-lip) adjusted to a concentration of 3X 10 with PBS9CFU/mL; uniformly spraying 1 part of the bacterial liquid on the surface of 10 parts of the feed according to the mass ratio to ensure that the content of the bacillus subtilis WB800(pBE2R-lip) in the feed is 3 multiplied by 108CFU/g;
⑽ drying the feed sprayed with the bacteria liquid in the shade to obtain the oral vaccine.
The flavobacterium columnare transgenic engineering oral vaccine is applied to the aspect of preventing the flavobacterium columnare infection.
Preferably, the fish is grass carp.
The application method of the flavobacterium columnare transgenic engineering oral vaccine comprises the following steps:
when the fry of the year is raised to 5-7cm, the vaccine is adopted for immunization, the immunization mode is oral vaccine, the grass carp is fed according to the feeding amount of 2% of the weight of the grass carp, and the continuous immunization is carried out for 7 days.
Preferably, the booster immunization is performed once after the first immunization, at an interval of 2 weeks, and the immunization dose is the same as the first immunization.
The preparation and detection of the invention are as follows:
first, construction of Bacillus subtilis WB800(pBE2R-lip) Strain
(1) Downloading a flavobacterium columnare lip gene sequence from Genbank, and analyzing a signal peptide thereof by using online software to obtain a mature peptide fragment sequence of the lip gene. Synthesizing mature peptide segments of the flavobacterium columnare lip gene according to the preference of the bacillus subtilis codon, adding Pst I and SphI enzyme cutting sites at two ends respectively, adding 2 bases at the front end to ensure that the sequence does not shift, removing a termination codon TAA, and obtaining a total of 760bp after synthesis, wherein the sequence is shown as SEQ NO. 1.
(2) Carrying out double enzyme digestion on artificially synthesized lip gene segments
The enzyme digestion system is as follows:
Figure BDA0002215752010000071
after three hours of enzyme digestion. Denaturation at 65 deg.C for 10min, electrophoresis cutting and recovery.
(3) The expression fragment after double digestion was ligated with pBE2R vector digested simultaneously with the same endonuclease. The linking system is as follows:
ligation was carried out overnight at 16 ℃.
(4) Transforming TOP10 competent cells with the ligation product, PCR screening recombinant clones, selecting positive clones, extracting plasmids by using a bacterial plasmid extraction kit for double enzyme digestion verification (shown in figure 1), and sequencing to check the correctness of the gene sequence.
(5) Inoculating the positive clone into LB (containing 50. mu.g/mL kanamycin) liquid culture medium at a volume of 1:100, and shaking-culturing at 37 ℃ and 200rpm on a constant temperature shaking table until OD is reached600And (3) collecting bacteria, and extracting the plasmid pBE2R-lip by using a bacterial plasmid extraction kit, wherein the concentration of the bacteria is 0.8-1.0.
(6) Bacillus subtilis WB800The strain was streaked on LB (containing 1. mu.g/mL erythromycin) plate and cultured overnight in an incubator at 37 ℃. The next day, a single colony was picked up in 10mL of LB medium (containing 1. mu.g/mL of erythromycin), and cultured OD was shaken at 37 ℃ with 200rpm of a shaker6001.0, adding xylose with the final concentration of 1% (w/v), continuing culturing for 2h, and preparing the Bacillus subtilis WB800The competent cells of the strain are selected from the group consisting of,
(7) plasmid pBE2R-lip was transformed into Bacillus subtilis WB800Competent cells, PCR screening of recombinant clones, selection of positive clones (as shown in FIG. 2), construction of Bacillus subtilis WB800(pBE2R-lip) strain.
(8) Detection of expression of target protein Using SDS-PAGE assay
Culturing strain WB800(pBE2R-lip) with fermentation medium at a ratio of 1:100, shake culturing at 37 deg.C and 150r/min, sampling at 24h and 48h respectively with Bacillus subtilis transformed with pBE2R empty plasmid as control, and concentrating the secretory protein in the culture medium and supernatant in the Bacillus thallus by 15 times. Through SDS-PAGE analysis, the secretory proteins and the bacterial supernatant proteins of the strains WB800(pBE2R-lip) and WB800(pBE2R) in a culture medium are different, and the WB800(pBE2R-lip) has one more band at the position of 32KDa and is possibly a protein expressed by a lip gene according to molecular weight calculation (shown in figure 3).
(9) Detection of expression of target protein by immunoblotting assay
Performing SDS-PAGE electrophoresis on the sample prepared in the step (8), after electrophoresis is finished, converting the sample into a membrane for 45min at a voltage of 80V, transferring the protein onto a PVDF membrane, slightly rinsing the membrane for 3 times by using PBST solution in sequence, sealing the lh by using PBST containing 5% skimmed milk powder at room temperature, adding primary antibody (rabbit anti-lip protein antibody, diluted by 1: 1000 times) to incubate the lh at room temperature, washing the membrane for 3 times, adding secondary antibody (goat anti-rabbit IgG with horseradish peroxidase label, diluted by 1:5000 times) to incubate the lh at room temperature, washing the membrane for 3 times by using PBST at room temperature, finally developing the color, and checking to find a strain WB800The supernatant and exudate samples of (pBE2R-lip) had a clear condition at the 32kDa position, similar to the size position in the SDS-PAGE gel of (8), strain WB800The supernatant sample and the secretion sample of (pBE2R) showed no significant band, and therefore, it was confirmed that the lip gene was likely to be expressed in Bacillus subtilis and secreted into the extracellular supernatant (as shown in FIG. 4).
Preparation of vaccine
(1) Bacillus subtilis WB800(pBE2R-lip) after activation of the strain, the strain was inoculated into LB medium containing 50. mu.g/mL kanamycin at a volume of 1:100, cultured at 37 ℃ for 48 hours at 200rpm, and the concentration of the bacteria was calculated and collected by centrifugation.
(2) The collected WB of the bacillus subtilis800(pBE2R-lip) adjusted to a concentration of 3X 10 with PBS9CFU/mL. Uniformly spraying 1 part of the bacterial liquid on the surface of 10 parts of the feed according to the mass ratio to ensure that the content of the bacillus subtilis WB800(pBE2R-lip) in the feed is 3 multiplied by 108CFU/gram.
(3) And drying the feed sprayed with the bacterial liquid in the shade to obtain the oral vaccine.
Third, evaluation of protective Effect of vaccine
The evaluation of the protective effect of the bacillus subtilis vector flavobacterium columnare transgenic engineering oral vaccine comprises the following specific steps: after 180 healthy grass carp fingerlings (the body length is 3-5 cm) are raised indoors for 14 days, the grass carp fingerlings are divided into an experimental group and a control group, each group comprises 3 aquariums, and each aquarium contains 30 grass carps. Feeding the grass carp in the test group with the oral vaccine for 7 days, then feeding the grass carp with common feed for 14 days, then feeding the grass carp with the oral vaccine for 7 days, and then feeding the grass carp with the common feed; the control group was fed with normal feed all the time. After feeding at 28 ℃ for 56 days, an artificial infection test is carried out by using flavobacterium columniformis G4 strain, the cumulative mortality rate of the grass carps of the experimental group and the control group in 14d after the artificial infection is counted (as shown in figure 5), and the immune protection rate of the vaccine is calculated. The immune protection rate can reach 52.4 percent by calculation.
The formula of the immune protection rate is as follows: [1- (mortality in the immune group/mortality in the control group) ]. times.100%.
Fourth, use of vaccine
When the fry of the year is raised to 5-7cm, the fry can be immunized by adopting an oral feeding mode, and the grass carp is fed according to the feeding amount of 2 percent of the weight of the grass carp and is continuously immunized for 7 days. The booster immunization was performed once 2 weeks after the first immunization, and the immunization dose was the same as the first immunization.
The synthesized lip gene sequence of the invention is SEQ NO. 1:
CTGCAGCTCACCATCATCACCATCATCATTGTAAGAAGAACGAGACGGGAGTTCTTGATTCTACTGAAACAGCTTCTGAAACTGATTTCACAGGAATGTACAGTGGAACAACACCATGTGCAGATTGCCCTGGTATCTATACAAATATTACCTTTAAGAAAAACGGAAACGTGGCCAAATCAACACTGTACTTAGACAGTGATGATACATCACTCACAGAATATGGAGTATGGTCTAAAGAGAACAACATCATCGAAGTCACAATTCCTAACTCACCGAAAGAGTATTATGCTATCAAACCGGATCACTTGTTGGTGAGACTTAATGCTGATAAGAAAGAGGTTAGCGGAGAATTAAGCAAGAAATACATCTTCGAGAAGACCGAAAGCTATACATCCAAAATGCTGAATGGCACGTACCAAACTTCAATTGACGGTAAAGGTTATAATCAAATTCTGGAACTCAAAGCAGACAATGACTCGATATATAATGTAAAAATTACGTTTACCGGCGCAACGAAAGGCTGCACGTTTGAAGGCAAAGGGCAATTAGTTAATAATCAGATAGACCTGGACCTTAACAAAATCAAAAAGAATCTTAAAGCGACCATGACGATTCAGTTTAAAGATGATACGAAAATTGCCGAAGTCTTTACCTCCAAATTTGATGAACGCTTTGATTTGATGCATTTCTGCGGGGGGGGCGCGAGCTTAGCGGGCGATTATACTAAGAAACATCACCATCATCACCATTCGCATGC。
although the embodiments of the present invention have been disclosed for illustrative purposes, those skilled in the art will appreciate that: various substitutions, changes and modifications are possible without departing from the spirit and scope of the invention and the appended claims, and therefore the scope of the invention is not limited to the disclosure of the embodiments and the accompanying drawings.
Sequence listing
<110> Tianjin City Water production research institute
<120> Flavobacterium columnare transgenic engineering oral vaccine, use method and application
<160>1
<170>SIPOSequenceListing 1.0
<210>1
<211>760
<212>DNA
<213> sequence of synthesized lip Gene (Unknown)
<400>1
ctgcagctca ccatcatcac catcatcatt gtaagaagaa cgagacggga gttcttgatt 60
ctactgaaac agcttctgaa actgatttca caggaatgta cagtggaaca acaccatgtg 120
cagattgccc tggtatctat acaaatatta cctttaagaa aaacggaaac gtggccaaat 180
caacactgta cttagacagt gatgatacat cactcacaga atatggagta tggtctaaag 240
agaacaacat catcgaagtc acaattccta actcaccgaa agagtattat gctatcaaac 300
cggatcactt gttggtgaga cttaatgctg ataagaaaga ggttagcgga gaattaagca 360
agaaatacat cttcgagaag accgaaagct atacatccaa aatgctgaat ggcacgtacc 420
aaacttcaat tgacggtaaa ggttataatc aaattctgga actcaaagca gacaatgact 480
cgatatataa tgtaaaaatt acgtttaccg gcgcaacgaa aggctgcacg tttgaaggca 540
aagggcaatt agttaataat cagatagacc tggaccttaa caaaatcaaa aagaatctta 600
aagcgaccat gacgattcag tttaaagatg atacgaaaat tgccgaagtc tttacctcca 660
aatttgatga acgctttgat ttgatgcatt tctgcggggg gggcgcgagc ttagcgggcg 720
attatactaa gaaacatcac catcatcacc attcgcatgc 760

Claims (6)

1. A Flavobacterium columnare transgenic engineering oral vaccine is characterized in that: the preparation steps are as follows:
⑴, analyzing a mature peptide sequence of protective antigen gene lip of flavobacterium columnare, artificially synthesizing the mature peptide sequence of the lip gene according to the codon preference of bacillus subtilis, adding Pst I and SphI enzyme cutting sites at two ends of the sequence respectively, adding 2 bases at the N end to ensure that the sequence is not shifted, removing a stop codon TAA at the C section, and obtaining the synthesized lip gene sequence of SEQ NO.1 which is 760bp in total;
⑵, after the lip gene sequence artificially synthesized in the step ⑴ is subjected to double enzyme digestion by Pst I and SphI restriction enzymes, the artificially synthesized lip gene sequence is connected with a vector pBE2R subjected to double enzyme digestion by the same restriction enzymes to construct a shuttle plasmid pBE 2R-lip;
⑶ shuttle plasmid pBE2R-lip constructed in step ⑵ was transferred into Bacillus subtilis WB800Screening to obtain WB800(pBE2R-lip) strain;
⑷ WBs obtained by screening in step ⑶800(pBE2R-lip) the strain was inoculated in an LB medium containing 50. mu.g/mL kanamycin at an inoculum size of 1:100 by volume, cultured at 37 ℃ at 200rpm/min for 48 hours, and then centrifuged to collect the bacteria;
⑸ bacteria collected in step ⑷ was added at 3.0X 108And (3) uniformly spraying the CFU/feed into the feed, drying in the shade, and preparing into an oral vaccine, namely the flavobacterium columnare transgenic engineering oral vaccine.
2. The Flavobacterium columnare genetically engineered oral vaccine of claim 1, wherein: the preparation method comprises the following specific steps:
⑴ downloading Flavobacterium columnare lip gene sequence from Genbank, analyzing the signal peptide by using on-line software to obtain the mature peptide sequence of lip gene, synthesizing the mature peptide sequence of Flavobacterium columnare lip gene according to the preference of Bacillus subtilis codon, adding Pst I and SphI enzyme cutting sites at two ends respectively, and ensuring the sequence not to shift codes by adding 2 bases at the front end, removing termination codon TAA, the synthesized sequence is shown as SEQ NO.1, and the total number is 760 bp;
⑵ double digestion of artificially synthesized lip gene fragment
The digestion system per 20. mu.L was as follows:
after enzyme digestion for three hours, denaturation is carried out for 10min at 65 ℃, and electrophoresis gel cutting is carried out for recovery;
⑶ the expression fragment after double digestion was ligated to pBE2R vector digested simultaneously with the same endonuclease, in 10. mu.L:
Figure FDA0002215749000000021
ligation was carried out overnight at 16 ℃;
⑷ transforming TOP10 competent cell with the ligation product, PCR screening recombinant clone, selecting positive clone, sequencing to check the correctness of gene sequence;
⑸ the positive clone is inoculated into LB liquid culture medium containing 50 ug/mL kanamycin in a volume of 1:100, and is shake-cultured at 37 ℃ and 200rpm on a constant temperature shaking table until OD is reached600Collecting bacteria, and extracting a plasmid pBE2R-lip by using a bacterial plasmid extraction kit, wherein the number of the bacteria is 0.8-1.0;
⑹ Bacillus subtilis WB800Streaking the strain on an LB (Langmuir-Blodgett) plate containing 1 mu g/mL of erythromycin, and culturing overnight in an incubator at 37 ℃; on the next day, a single colony was picked up in LB medium containing 1. mu.g/mL erythromycin, and OD was cultured by shaking at 37 ℃ with a shaker at 200rpm6000.8-1.0, adding xylose with the final mass concentration of 1%, and continuously culturing for 2h to prepare the Bacillus subtilis WB800Competent cells of the strain;
⑺ transformation of plasmid pBE2R-lip into Bacillus subtilis WB800Competent cells, PCR screening, recombinant cloning, and selecting positive clone to construct Bacillus subtilis WB800(pBE2R-lip) strain;
⑻ Bacillus subtilis WB800(pBE2R-lip) after the activation of the strain, inoculating the activated strain in LB medium containing 50. mu.g/mL kanamycin at a volume ratio of 1:100, culturing at 37 ℃ for 48 hours at 200rpm, calculating the concentration of bacteria, and centrifuging to collect the bacteria;
⑼ collected Bacillus subtilis WB800(pBE2R-lip) adjusted to a concentration of 3X 10 with PBS9CFU/mL; uniformly spraying 1 part of the bacterial liquid on the surface of 10 parts of the feed according to the mass ratio to ensure that the content of the bacillus subtilis WB800(pBE2R-lip) in the feed is 3 multiplied by 108CFU/g;
⑽ drying the feed sprayed with the bacteria liquid in the shade to obtain the oral vaccine.
3. The use of the flavobacterium columnare genetically engineered oral vaccine of claim 1 or 2 for preventing flavobacterium columnare infection.
4. Use according to claim 3, characterized in that: the fish is grass carp.
5. The method of using Flavobacterium columnare genetically engineered oral vaccine of claim 1 or 2, wherein: the method comprises the following steps:
when the fry of the year is raised to 5-7cm, the vaccine is adopted for immunization, the immunization mode is oral vaccine, the grass carp is fed according to the feeding amount of 2% of the weight of the grass carp, and the continuous immunization is carried out for 7 days.
6. The method for using Flavobacterium columnare transgenic engineering oral vaccine of claim 5, characterized in that: after the first immunization, booster immunization was performed once at intervals of 2 weeks, and the immunization dose was the same as the first immunization.
CN201910914742.8A 2019-09-26 2019-09-26 Flavobacterium columnare transgenic engineering oral vaccine, use method and application Pending CN110755605A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910914742.8A CN110755605A (en) 2019-09-26 2019-09-26 Flavobacterium columnare transgenic engineering oral vaccine, use method and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910914742.8A CN110755605A (en) 2019-09-26 2019-09-26 Flavobacterium columnare transgenic engineering oral vaccine, use method and application

Publications (1)

Publication Number Publication Date
CN110755605A true CN110755605A (en) 2020-02-07

Family

ID=69330366

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910914742.8A Pending CN110755605A (en) 2019-09-26 2019-09-26 Flavobacterium columnare transgenic engineering oral vaccine, use method and application

Country Status (1)

Country Link
CN (1) CN110755605A (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112322543A (en) * 2020-11-19 2021-02-05 肇庆大华农生物药品有限公司 Flavobacterium columnare isolated culture medium
CN115976092A (en) * 2022-07-13 2023-04-18 浙江大学 Method for autocrine expression of foreign protein by using bacillus subtilis

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103495159A (en) * 2013-09-17 2014-01-08 聂品 Preparation method of flavobacterium columnare genetic recombination vaccines
CN107115524A (en) * 2017-05-15 2017-09-01 中国科学院水生生物研究所 A kind of oral recombinant spore vaccine of the anti-reovirus of grass carp and preparation method thereof
CN107126559A (en) * 2017-05-15 2017-09-05 中国科学院水生生物研究所 Oral recombinant spore vaccines of a kind of anti-CyHV 2 of hybridized prussian carp and preparation method thereof
US20170347664A1 (en) * 2016-03-16 2017-12-07 Spogen Biotech Inc. Fusion proteins, recombinant bacteria, and exosporium fragments for animal health and aquaculture

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103495159A (en) * 2013-09-17 2014-01-08 聂品 Preparation method of flavobacterium columnare genetic recombination vaccines
US20170347664A1 (en) * 2016-03-16 2017-12-07 Spogen Biotech Inc. Fusion proteins, recombinant bacteria, and exosporium fragments for animal health and aquaculture
CN107115524A (en) * 2017-05-15 2017-09-01 中国科学院水生生物研究所 A kind of oral recombinant spore vaccine of the anti-reovirus of grass carp and preparation method thereof
CN107126559A (en) * 2017-05-15 2017-09-05 中国科学院水生生物研究所 Oral recombinant spore vaccines of a kind of anti-CyHV 2 of hybridized prussian carp and preparation method thereof

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
L.L. FU等: "Oral vaccination with envelope protein VP28 against white spot syndrome virus in Procambarus clarkii using Bacillus subtilis as delivery vehicles", 《LETTERS IN APPLIED MICROBIOLOGY》 *
LING-LIN FU等: "In vivo assessment for oral delivery of Bacillus subtilis harboring a viral protein (VP28) against white spot syndrome virus in Litopenaeus vannamei", 《AQUACULTURE》 *
ZHANG LUO等: "Immunogenic proteins and their vaccine development potential evaluation in outer membrane proteins (OMPs) of Flavobacterium columnare", 《AQUACULTURE AND FISHERIES》 *
天津市水产研究所: "《草鱼烂鳃病芽孢杆菌载体口服疫苗的制备和免疫机理研究》", 《科技成果16JCYBJC30000》 *
罗璋等: "枯草芽孢杆菌表达柱状黄杆菌lip基因口服疫苗对草鱼免疫保护效果的研究", 《渔业科学进展》 *
陈继楚等: "草鱼免疫基因研究进展", 《江苏农业科学》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112322543A (en) * 2020-11-19 2021-02-05 肇庆大华农生物药品有限公司 Flavobacterium columnare isolated culture medium
CN115976092A (en) * 2022-07-13 2023-04-18 浙江大学 Method for autocrine expression of foreign protein by using bacillus subtilis

Similar Documents

Publication Publication Date Title
CN102796755B (en) Lactococcus lactis expression vector and preparation method and application thereof
CN107257853B (en) Novel enterohemorrhagic escherichia coli bacteriophage Esc-CHP-1 and application thereof in inhibiting enterohemorrhagic escherichia coli proliferation
CN109536507B (en) Antibacterial peptide gene of pompano and its coded peptide and prokaryotic expression preparation method
CN104593397B (en) A kind of enterotoxigenic escherichia coil polyvalent antigen gene order of optimization and its application in preventing post-weaning diarrhea
CN105801707B (en) A kind of hemorrhagic disease of grass carp oral vaccine and its preparation and application
CN102146135A (en) Recombinant human-like collagen and production method thereof
CN107653260A (en) A kind of preparation method and application of Recombinant Lactococcus lactis
CN103789317A (en) Scylla paramamosain antibacterial peptide hyastatin gene clone, encoding protein recombination and application
CN102212124B (en) Scylla paramamosain anti-lipopolysaccharide factor, and preparation method and application thereof
CN104120142A (en) Protein recombinant lactococcus lactis for secretory expression of core antigen COE of PEDV (Porcine Epidemic Diarrhea Virus) as well as preparation method and application of protein recombinant lactococcus lactis
CN110755605A (en) Flavobacterium columnare transgenic engineering oral vaccine, use method and application
CN111420037B (en) Application of phage lyase Lysep3 in preparation of broad-spectrum antibacterial drugs
CN107474142A (en) Promote polypeptide and its relevant biological material and the application of destination protein secretion
CN104263709A (en) Egg-white lysozyme and preparation method thereof
CN110256570A (en) A kind of recombination fusion antibacterial peptide and application
CN107022549B (en) Pelteobagrus fulvidraco beta defensin gene, beta defensin antibacterial peptide and application thereof
CN108977457B (en) Preparation method of finless eel antibacterial peptide
CN104131021A (en) Antibacterial peptide coexpression vector, construction and expression method thereof
CN115850404A (en) Recombinant erysipelothrix rhusiopathiae surface protection antigen A with tandem dominant epitopes and application thereof
CN106397602B (en) A kind of reinforced chicken Marek&#39;s disease protein engineering vaccine of molecule adjuvant
CN116162637A (en) Fusion gene, protein encoded by fusion gene and application of fusion gene in fish iridovirus and rhabdovirus bivalent oral vaccine
CN104418945A (en) Preparation method of peptide and application of peptide in preparation of medicine and feed additive
CN105713908A (en) Recombinant bombyx mori gloverin and preparation method and application thereof
CN107893059B (en) Preparation and application of tilapia disease-resistant immune gene recombinant protein
CN107827986B (en) Pig O/Mya98 and O/PanAsia type foot-and-mouth disease gene engineering inactivated vaccine

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20200207

WD01 Invention patent application deemed withdrawn after publication