CN114561496B - Primer and probe for identifying novel coronavirus Delta strain and application of primer and probe - Google Patents
Primer and probe for identifying novel coronavirus Delta strain and application of primer and probe Download PDFInfo
- Publication number
- CN114561496B CN114561496B CN202210457177.9A CN202210457177A CN114561496B CN 114561496 B CN114561496 B CN 114561496B CN 202210457177 A CN202210457177 A CN 202210457177A CN 114561496 B CN114561496 B CN 114561496B
- Authority
- CN
- China
- Prior art keywords
- probe
- seq
- primer
- novel coronavirus
- delta
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention provides a primer and a probe for identifying a novel coronavirus Delta strain and application thereof. The primer of the invention comprises a primer with a sequence shown as SEQ ID NO.1 and a primer with a sequence shown as SEQ ID NO. 2. The probe of the invention comprises a probe with a sequence shown in SEQ ID NO. 3. By using the primer and the probe, the novel coronavirus Delta strain and other strains can be identified by a PCR method.
Description
Technical Field
The invention relates to a primer and a probe for identifying a novel coronavirus Delta strain and application thereof, in particular to a primer, a probe, a kit and a detection method aiming at a Delta 156-157 mutation site of an S gene of the novel coronavirus Delta strain, and belongs to the technical field of molecular biology detection.
Background
Infection with the novel coronavirus (SARS-CoV-2) causes respiratory symptoms, fever, cough, shortness of breath, dyspnea, etc., and severe cases may cause the novel coronavirus to pneumonia (COVID-19). With the spread of new coronaviruses in the human population, many mutations occur in the viral genome, wherein the mutations occur at the key amino acid sites of the protective antigen S protein, which may result in the enhancement of the spreading capability and pathogenicity of the virus and the reduction of the protective effect of the existing vaccines. Compared with the prototype strain, the novel coronavirus Delta strain has obviously enhanced infectivity and transmission capability, high virus load in human bodies and shortened incubation period in the bodies.
Therefore, the rapid and accurate identification of the novel coronavirus Delta strain is of great significance.
Disclosure of Invention
It is an object of the present invention to provide a primer for identifying a novel coronavirus Delta strain.
Another object of the present invention is to provide a probe for identifying a novel coronavirus Delta strain.
Another object of the invention is to provide a kit for identifying a novel coronavirus Delta strain.
Another object of the invention is to provide the relevant application of the primer, probe or kit for identifying the novel coronavirus Delta strain.
In one aspect, the invention provides a primer for identifying a novel coronavirus Delta strain, which comprises a primer with a sequence shown as SEQ ID NO.1 and a primer with a sequence shown as SEQ ID NO. 2:
SEQ ID NO.1：5’-GTTTATTACCACAAAAACAACAAAAG-3’；
SEQ ID NO.2：5’-CATATTCAAAAGTGCAATTATTCGC-3’。
the primer for identifying the novel coronavirus Delta strain is designed aiming at the novel coronavirus Delta strain S protein. The mutation sites of the novel coronavirus Delta strain compared to the prototype strain include: T19R, Delta 156-157, R158G, L452R, T478K, D614G, P681R, D950N, etc. Specifically, the primers for identifying the novel coronavirus Delta strain are designed based on the Delta 156-157 mutation site.
In another aspect, the invention also provides a probe for identifying a novel coronavirus Delta strain, the probe comprising:
a probe having a sequence shown in SEQ ID NO. 3:
SEQ ID NO.3：5’-GATGGAAAGTGGAGTTTATTC-3’。
according to a particular embodiment of the invention, the probe further comprises:
a probe having a sequence shown as SEQ ID No. 4:
SEQ ID NO.4：5’-GGAAAGTGAGTTCAGAGTTTATTC-3’。
the probe with the sequence shown as SEQ ID NO.3 is designed based on the Delta 156-157 mutation site of the S gene of the novel coronavirus Delta strain. The probe with the sequence shown in SEQ ID NO.4 is designed for other novel coronaviruses except the Delta strain.
According to a particular embodiment of the invention, the probe may be modified with a fluorophore, the modification comprising:
the base at the 5 'end of the probe sequence is modified by a fluorescent reporter group, and the base at the 3' end of the probe sequence is modified by a fluorescent quenching group.
According to a particular embodiment of the invention, the fluorescent reporter group of the probe of the sequence shown in SEQ ID NO.4 is different from the fluorescent reporter group of the probe of the sequence shown in SEQ ID NO. 3.
In some embodiments of the invention, the 5 'base of the sequence of the novel coronavirus Delta strain probe (the probe with the sequence shown as SEQ ID NO. 3) is modified by a fluorescence reporter group FAM, and the 3' base of the sequence of the probe is modified by a fluorescence quenching group; delta strain other novel coronavirus probe (probe with sequence shown as SEQ ID NO. 4) sequence 5 'end base is modified by fluorescent reporter group CY5, and probe sequence 3' end base is modified by fluorescent quenching group.
In another aspect, the present invention also provides a kit for identifying a novel coronavirus Delta strain, comprising: the primer and/or the probe are/is provided.
According to a particular embodiment of the invention, the kit of the invention further comprises PCR reaction reagents and/or reaction buffers.
According to a specific embodiment of the present invention, the kit of the present invention further comprises a positive quality control material and a negative quality control material; preferably, the positive quality control product comprises a novel coronavirus Delta strain S gene standard plasmid template, and the negative quality control product comprises other novel coronavirus S gene standard plasmid templates except the Delta strain.
In another aspect, the invention also provides the application of the primer or the probe or the kit in identifying whether the novel coronavirus Delta strain exists in a sample in vitro. Namely, the invention also provides a method for identifying whether the novel coronavirus Delta strain exists in a sample in vitro.
According to a specific embodiment of the invention, in the application of the invention, the existence of the novel coronavirus Delta strain in the sample is identified through PCR reaction, the final concentration of the primer in the PCR reaction system is 0.1-10 mu M, and the final concentration of the probe in the PCR reaction system is 0.1-10 mu M.
According to a specific embodiment of the present invention, in the application of the present invention, the PCR may be a single PCR, a multiplex PCR, a digital PCR or an RT-PCR.
In some embodiments of the invention, in the application of the invention, the PCR is a dual probe qPCR, wherein the amplification curve of the probe with the sequence shown in SEQ ID NO.3 is an S-shaped curve, and the probe can be identified as positive for the novel coronavirus Delta strain.
In some embodiments of the invention, the method of authenticating applications of the present invention comprises the steps of:
s1: extracting RNA of a sample to be detected, and reversely transcribing the RNA into cDNA;
s2: preparing a reaction system: adding the upstream primer, the downstream primer and the probe at any concentration in the range of 0.1-10 mu M into the system, adding the sample cDNA at any concentration in the range of 1pg-1 mu g, adding the qPCR premixed enzyme, and finally using ddH 2 O adjusting the total volume of the reaction system to any volume within the range of 10-20 mul;
s3: setting reaction conditions: setting reaction conditions according to the used qPCR premixed enzyme;
s4: and (4) analyzing results: according to the Delta strain amplification channel and other novel coronavirus amplification channels except the Delta strain, analyzing and recording the result.
Different probes are designed aiming at the Delta strain Delta 156-157 site and corresponding regions of other novel coronaviruses outside the Delta strain, different fluorescent groups such as FAM and CY5 fluorescent groups are respectively selected for modification for the Delta strain probe and the other novel coronaviruses outside the Delta strain probe, and the amplification results of the Delta strain and other novel coronaviruses outside the Delta strain can be observed through different fluorescent channels in one reaction. The amplification curve in the amplification result is a typical S-shaped curve, and the amplification result is a positive result; the amplification curve in the amplification result is not a typical "S-shaped" curve, and is a negative result.
In some specific embodiments of the invention, one section of gene sequence synthetic plasmid in the Delta strain and other novel coronavirus S proteins except the Delta strain are respectively selected as standard substances, and the linearity, the detection limit and the specificity (specificity) of the dual probe qPCR method are verified. As can be seen from the specificity verification experiment of the dual probe qPCR method, the identification method provided by the invention has better linearity, the detection limit is 0.03 pg/mu l, and the Delta strain and other novel coronaviruses can be effectively identified.
The invention has the advantages of low cost, simple operation, low requirement on instruments and equipment, short detection period, accurate and reliable result and the like. The identification applications described herein may be for non-diagnostic purposes, or for diagnostic purposes. Applications for non-diagnostic purposes may include, for example, rapid identification of virus species in the production of novel inactivated coronavirus vaccines, as well as identification of inactivated novel coronavirus stocks. In addition, the invention can be applied to the identification of the Delta strain and other novel coronavirus strains in the novel coronavirus nucleic acid screening process, and the sample to be identified can be an ex vivo sample from human or animals or an environmental sample from non-hosts. The invention can quickly and accurately distinguish the Delta strain of the novel coronavirus from other novel coronavirus identification. The popularization and the application of the invention can save a great deal of time and cost for detection personnel, scientific research workers and medical workers in the vaccine production process.
Drawings
FIG. 1 is a schematic diagram of the experimental design scheme of the primers and probes of the present invention.
FIG. 2 is a standard curve of the Delta strain amplification channel for PCR reactions using primers and probes of the invention.
FIG. 3 is a standard curve of the amplification pathway of other novel viruses of the Delta strain for PCR reactions using primers and probes of the invention.
FIG. 4 shows the results of specificity verification experiments for the dual probe qPCR method using the primers and probes of the invention.
Detailed Description
The technical solutions of the present invention will be described in detail below in order to clearly understand the technical features, objects, and advantages of the present invention, but the present invention is not limited to the practical scope of the present invention. The present invention has been described generally and/or specifically with respect to materials used in the experiments and the methods of testing. The method operations, which are not specified in detail, are carried out according to the conventional operations of the prior art or the operations suggested by the manufacturer's specifications.
Example 1
This example provides primers, probes and methods for identifying novel coronaviruses other than Delta strains and Delta strains. The design scheme of the primer, the probe and the fluorescent label is shown in figure 1.
Experimental sample: cDNA of a sample to be detected, a Delta strain S gene standard plasmid template (SEQ ID NO. 5) and S gene standard plasmid templates (SEQ ID NO. 6) of other novel coronaviruses (prototype strain samples in the embodiment) except the Delta strain.
Obtaining cDNA of a sample to be tested: 200 mul of cell culture of the novel coronary prototype strain and the Delta strain are respectively taken, RNA is extracted by a commercialized RNA kit, the RNA is reversely transcribed into cDNA by the commercialized reverse transcription kit, the extracted RNA and cDNA can be stored in a refrigerator at 60 ℃ below zero, and repeated freeze thawing is avoided before use.
Acquisition of standard plasmids: delta strain S gene standard plasmid (SEQ ID NO. 5) and other novel coronavirus S gene standard plasmids (SEQ ID NO. 6) except the Delta strain are directly biosynthesized by the Populaceae. The sequences of the standard plasmids are as follows:
SEQ ID NO.5：
ACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGATGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGTGGAGTTTATTCTAGTGCGAATAATTGCACTTTTGAATATGTCTCTCAGCCTTTTCTTATGGACCTTGAAGGAAAACAGGGTAATT；
SEQ ID NO.6：
CTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGTGAGTTCAGAGTTTATTCTAGTGCGAATAATTGCACTTTTGAATATGTCTCTCAGCCTTTTCTTATGGACCTTGAAGGAAAACAG。
qPCR amplification: the reaction system and reaction conditions are shown in Table 1, wherein the amount of the forward primer, the reverse primer and the probe added to the reaction system may be any one of concentrations in the range of 0.1 to 10. mu.M, the total reaction system may be any one of volumes in the range of 10 to 20. mu.l, and the amount of the sample cDNA added may be any one of concentrations in the range of 1pg to 1. mu.g. The qPCR premixed enzyme used this time was TaqMan Gene Expression Master Mix (cat # 4370048) from Saimer Miller, in which any temperature within the range of 52-60 ℃ was selected as the annealing temperature.
The sequence of the upstream primer 156/157-F is shown as SEQ ID NO. 1; the sequence of the downstream primer 156/157-R is shown as SEQ ID NO. 2; the sequence of the Delta strain probe (156/157-P-Delta) is shown in SEQ ID NO. 3; the sequences of other novel coronavirus probes (156/157-P-other novel coronaviruses) except Delta strain are shown in SEQ ID NO. 4.
SEQ ID NO.1（156/157-F）：GTTTATTACCACAAAAACAACAAAAG；
SEQ ID NO.2（156/157-R）：CATATTCAAAAGTGCAATTATTCGC；
SEQ ID NO.3（156/157-P-Delta）：GATGGAAAGTGGAGTTTATTC；
SEQ ID NO.4 (156/157-P-other novel coronaviruses): GGAAAGTGAGTTCAGAGTTTATTC are provided.
TABLE 1 reaction System and reaction conditions
And (4) analyzing results: taking Roche480 instrument as an example, each test is set after the experiment is finishedAnd (4) testing the sample type (a sample to be tested, a standard substance, a negative control or a positive control) of the hole, wherein the standard substance needs to be set in concentration. Opening an analysis interface, selecting a fluorescence channel used by the probe, and adjusting a Noise band value according to an amplification image to ensure the amplification efficiency and R of the generated standard curve 2 Both the value and the slope are within acceptable ranges. The invention relates to a double probe qPCR method, which analyzes and records the results of a Delta strain amplification channel and other novel coronavirus amplification channels in one reaction.
And (4) judging a result: the amplification curve in the amplification result is a typical S-shaped curve, and the amplification result is a positive result; the amplification curve in the amplification result is not a typical "S-shaped" curve, and is a negative result. The specific result interpretation method is shown in Table 2.
TABLE 2 determination of results
Adding a sample to be detected into a reaction system for on-machine detection, and if positive amplification occurs in an FAM channel and positive amplification does not occur in a CY5 channel in a detection result, displaying that the sample is a Delta strain; if positive amplification occurs in the CY5 channel and positive amplification does not occur in the FAM channel, the sample is shown as other novel coronavirus strains instead of the Delta strain. The method can quickly and accurately identify the Delta strain in one reaction.
This example demonstrates the method of the dual probe qPCR of the present invention. The results are shown in FIGS. 2 to 4. FIG. 2 is a standard curve of the Delta strain amplification channel, R 2 The amplification efficiency was 0.99, 1.013, and the slope was-3.353. FIG. 3 is a standard curve of the amplification pathway of other novel coronaviruses, R 2 0.99, amplification efficiency of 1.021, slope-3.421. From FIGS. 2 and 3, it can be seen that the detection limit of the present invention is 0.03pg/μ l and has good linearity. FIG. 4 is specificity (specificity) verification of the dual probe qPCR method, the result shows that the Delta strain sample is positively amplified in the Delta strain amplification channel, and is negatively amplified in other novel coronavirus amplification channels; the prototype strain sample is in Delta strainThe amplification channel has negative amplification, and other novel coronavirus amplification channels have positive amplification, so that the method has good specificity and can accurately identify the Delta strain.
Sequence listing
<110> limited liability company of Beijing institute of biological products
<120> primers and probes for identifying novel coronavirus Delta strains and application thereof
<130> GAI22CN0632
<160> 6
<170> PatentIn version 3.5
<210> 1
<211> 26
<212> DNA
<213> Artificial sequence
<220>
<223> primer
<400> 1
gtttattacc acaaaaacaa caaaag 26
<210> 2
<211> 25
<212> DNA
<213> Artificial sequence
<220>
<223> primer
<400> 2
catattcaaa agtgcaatta ttcgc 25
<210> 3
<211> 21
<212> DNA
<213> Artificial sequence
<220>
<223> Probe
<400> 3
gatggaaagt ggagtttatt c 21
<210> 4
<211> 24
<212> DNA
<213> Artificial sequence
<220>
<223> Probe
<400> 4
ggaaagtgag ttcagagttt attc 24
<210> 5
<211> 200
<212> DNA
<213> Artificial sequence
<220>
<223> Delta strain S gene standard plasmid
<400> 5
acttattgtt aataacgcta ctaatgttgt tattaaagtc tgtgaatttc aattttgtaa 60
tgatccattt ttggatgttt attaccacaa aaacaacaaa agttggatgg aaagtggagt 120
ttattctagt gcgaataatt gcacttttga atatgtctct cagccttttc ttatggacct 180
tgaaggaaaa cagggtaatt 200
<210> 6
<211> 198
<212> DNA
<213> Artificial sequence
<220>
<223> other novel coronavirus S gene standard plasmids except Delta strain
<400> 6
cttattgtta ataacgctac taatgttgtt attaaagtct gtgaatttca attttgtaat 60
gatccatttt tgggtgttta ttaccacaaa aacaacaaaa gttggatgga aagtgagttc 120
agagtttatt ctagtgcgaa taattgcact tttgaatatg tctctcagcc ttttcttatg 180
gaccttgaag gaaaacag 198
Claims (6)
1. A composition of a primer and a probe for identifying a novel coronavirus Delta strain by a dual-probe qPCR method is characterized in that the primer comprises a primer with a sequence shown as SEQ ID NO.1 and a primer with a sequence shown as SEQ ID NO. 2:
SEQ ID NO.1：5’-GTTTATTACCACAAAAACAACAAAAG-3’；
SEQ ID NO.2：5’-CATATTCAAAAGTGCAATTATTCGC-3’；
the probe comprises a probe with a sequence shown as SEQ ID NO.3 and a probe with a sequence shown as SEQ ID NO. 4:
SEQ ID NO.3：5’-GATGGAAAGTGGAGTTTATTC-3’；
SEQ ID NO.4：5’-GGAAAGTGAGTTCAGAGTTTATTC-3’；
the probe is modified by a fluorophore, the modification comprising: modifying the base at the 5 'end of the probe sequence by adopting a fluorescent reporter group, and modifying the base at the 3' end of the probe sequence by adopting a fluorescent quenching group; wherein, the base at the 5 'end of the probe with the sequence shown in SEQ ID NO.3 is modified by a fluorescent reporter group FAM, and the base at the 5' end of the probe with the sequence shown in SEQ ID NO.4 is modified by a fluorescent reporter group CY 5.
2. A kit for identifying a novel coronavirus Delta strain by a dual probe qPCR method, the kit comprising: the combination of the primer and the probe as set forth in claim 1.
3. The kit of claim 2, further comprising a positive quality control and a negative quality control; the positive quality control product comprises a novel coronavirus Delta strain S gene standard plasmid template, and the negative quality control product comprises other novel coronavirus S gene standard plasmid templates except the Delta strain.
4. Use of a combination of primers and probes according to claim 1 or a kit according to claim 2 or 3 for non-diagnostic purposes in the in vitro dual probe qPCR method for the identification of the presence of a novel coronavirus Delta strain in a sample.
5. The use according to claim 4, wherein the presence or absence of the novel coronavirus Delta strain in the sample is identified by a PCR reaction, wherein the final concentration of the primer in the PCR reaction system is 0.1-10 μ M, and the final concentration of the probe in the PCR reaction system is 0.1-10 μ M.
6. The use according to claim 4, wherein the amplification curve of the probe having the sequence shown in SEQ ID No.3 is an S-shaped curve and is identified as positive for the novel coronavirus Delta strain.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210457177.9A CN114561496B (en) | 2022-04-28 | 2022-04-28 | Primer and probe for identifying novel coronavirus Delta strain and application of primer and probe |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210457177.9A CN114561496B (en) | 2022-04-28 | 2022-04-28 | Primer and probe for identifying novel coronavirus Delta strain and application of primer and probe |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114561496A CN114561496A (en) | 2022-05-31 |
| CN114561496B true CN114561496B (en) | 2022-08-19 |
Family
ID=81721015
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210457177.9A Active CN114561496B (en) | 2022-04-28 | 2022-04-28 | Primer and probe for identifying novel coronavirus Delta strain and application of primer and probe |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114561496B (en) |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022044011A1 (en) * | 2020-08-25 | 2022-03-03 | B. G. Negev Technologies And Applications Ltd., At Ben-Gurion University | Oligonucleotides and methods of using same |
| CA3194430A1 (en) * | 2020-10-02 | 2022-04-07 | Patrick HALLEY | Dna nanodevice hinge biosensors and methods of use thereof |
| CN113846191B (en) * | 2021-11-30 | 2022-03-15 | 深圳康美生物科技股份有限公司 | Primer and probe for detecting novel coronavirus and application of primer and probe |
-
2022
- 2022-04-28 CN CN202210457177.9A patent/CN114561496B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN114561496A (en) | 2022-05-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109576352B (en) | Method, probe and kit for detecting multiple target nucleic acid sequences to be detected through single tube | |
| CN111187856A (en) | Cpf1 kit for rapid detection of new coronavirus nucleic acid and preparation method and application thereof | |
| WO2020259210A1 (en) | Method and kit for detecting african swine fever virus | |
| CN114592097B (en) | Primer and probe for identifying novel coronavirus Omicron strain BA.1 and/or BA.3 sublines and application thereof | |
| CN107988326A (en) | Prawn Acute Hepatic pancreatic necrosis（AHPND）RAA constant temperature fluorescence detection method and reagent | |
| CN113774168A (en) | 2019 novel coronavirus, Deltay and lambda variant strain typing nucleic acid detection kit and detection method thereof | |
| CN113774169A (en) | 2019 novel coronavirus delta variant nucleic acid detection reagent, kit and detection method | |
| CN113980957A (en) | Single-stranded DNA probe based on CRISPR/Cas12a and method for detecting target nucleic acid | |
| CN113025734A (en) | Primer and probe for identifying Brucella vaccine strain A19 and wild strain and application | |
| CN114107567A (en) | Virus nucleic acid mutation detection method and application | |
| CN112725539B (en) | RPA/Cas12a/IF kit for respiratory syncytial virus and detection method thereof | |
| CN113817872A (en) | 2019 novel coronavirus lambda variant nucleic acid detection reagent, kit and detection method | |
| CN114561496B (en) | Primer and probe for identifying novel coronavirus Delta strain and application of primer and probe | |
| WO2022257663A1 (en) | Method and kit for detecting and screening n501y mutation in covid-19 | |
| CN114574557B (en) | General type preclinical biodistribution detection kit for NK cell therapy products | |
| CN114561497B (en) | Primer and probe for identifying novel coronavirus Omicron strain BA.1 subline and application thereof | |
| CN116219040A (en) | Molecular marker, primer probe group and detection method for detecting lactobacillus plantarum S58 | |
| CN113528686B (en) | Reagent and kit for detecting nucleic acid of brucella | |
| CN106521038B (en) | A kind of real-time fluorescence quantitative PCR detection methods of highly sensitive BHV 2 and kit | |
| CN116479093A (en) | Rhinoceros nucleic acid rapid detection method and detection kit based on CRISPR fluorescence method | |
| KR102435116B1 (en) | Method for detecting influenza virus using CRISPR-Cas system and multiplex LAMP primer set | |
| CN111996271A (en) | RPA detection primer group, kit and method for drug-resistant gene NDM-1 of superbacteria | |
| CN117265187A (en) | Primer and probe composition for identifying novel coronavirus Omicron strain BA.4 subline, kit and application | |
| CN115873991B (en) | Block crRNA, function enabling crRNA to switch and control binding with Cas12a and function verification method thereof | |
| CN113862381B (en) | Loop-mediated isothermal amplification primer, kit and method for detecting aedes albopictus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |